ID: 1015250911

View in Genome Browser
Species Human (GRCh38)
Location 6:131126773-131126795
Sequence TTGTAACCACACCATGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015250911_1015250914 -8 Left 1015250911 6:131126773-131126795 CCCTGCTCATGGTGTGGTTACAA No data
Right 1015250914 6:131126788-131126810 GGTTACAAGGACCAGAACTGAGG No data
1015250911_1015250917 25 Left 1015250911 6:131126773-131126795 CCCTGCTCATGGTGTGGTTACAA No data
Right 1015250917 6:131126821-131126843 GAGAAATCGGAGTAATTTAATGG No data
1015250911_1015250916 12 Left 1015250911 6:131126773-131126795 CCCTGCTCATGGTGTGGTTACAA No data
Right 1015250916 6:131126808-131126830 AGGTTTGAACAAAGAGAAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015250911 Original CRISPR TTGTAACCACACCATGAGCA GGG (reversed) Intergenic
No off target data available for this crispr