ID: 1015250914

View in Genome Browser
Species Human (GRCh38)
Location 6:131126788-131126810
Sequence GGTTACAAGGACCAGAACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015250906_1015250914 14 Left 1015250906 6:131126751-131126773 CCTCTGCTGCTCCATTAGCCTTC No data
Right 1015250914 6:131126788-131126810 GGTTACAAGGACCAGAACTGAGG No data
1015250911_1015250914 -8 Left 1015250911 6:131126773-131126795 CCCTGCTCATGGTGTGGTTACAA No data
Right 1015250914 6:131126788-131126810 GGTTACAAGGACCAGAACTGAGG No data
1015250910_1015250914 -4 Left 1015250910 6:131126769-131126791 CCTTCCCTGCTCATGGTGTGGTT No data
Right 1015250914 6:131126788-131126810 GGTTACAAGGACCAGAACTGAGG No data
1015250912_1015250914 -9 Left 1015250912 6:131126774-131126796 CCTGCTCATGGTGTGGTTACAAG No data
Right 1015250914 6:131126788-131126810 GGTTACAAGGACCAGAACTGAGG No data
1015250907_1015250914 3 Left 1015250907 6:131126762-131126784 CCATTAGCCTTCCCTGCTCATGG No data
Right 1015250914 6:131126788-131126810 GGTTACAAGGACCAGAACTGAGG No data
1015250905_1015250914 15 Left 1015250905 6:131126750-131126772 CCCTCTGCTGCTCCATTAGCCTT No data
Right 1015250914 6:131126788-131126810 GGTTACAAGGACCAGAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015250914 Original CRISPR GGTTACAAGGACCAGAACTG AGG Intergenic
No off target data available for this crispr