ID: 1015250916

View in Genome Browser
Species Human (GRCh38)
Location 6:131126808-131126830
Sequence AGGTTTGAACAAAGAGAAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015250912_1015250916 11 Left 1015250912 6:131126774-131126796 CCTGCTCATGGTGTGGTTACAAG No data
Right 1015250916 6:131126808-131126830 AGGTTTGAACAAAGAGAAATCGG No data
1015250910_1015250916 16 Left 1015250910 6:131126769-131126791 CCTTCCCTGCTCATGGTGTGGTT No data
Right 1015250916 6:131126808-131126830 AGGTTTGAACAAAGAGAAATCGG No data
1015250911_1015250916 12 Left 1015250911 6:131126773-131126795 CCCTGCTCATGGTGTGGTTACAA No data
Right 1015250916 6:131126808-131126830 AGGTTTGAACAAAGAGAAATCGG No data
1015250907_1015250916 23 Left 1015250907 6:131126762-131126784 CCATTAGCCTTCCCTGCTCATGG No data
Right 1015250916 6:131126808-131126830 AGGTTTGAACAAAGAGAAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015250916 Original CRISPR AGGTTTGAACAAAGAGAAAT CGG Intergenic
No off target data available for this crispr