ID: 1015250917

View in Genome Browser
Species Human (GRCh38)
Location 6:131126821-131126843
Sequence GAGAAATCGGAGTAATTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015250912_1015250917 24 Left 1015250912 6:131126774-131126796 CCTGCTCATGGTGTGGTTACAAG No data
Right 1015250917 6:131126821-131126843 GAGAAATCGGAGTAATTTAATGG No data
1015250911_1015250917 25 Left 1015250911 6:131126773-131126795 CCCTGCTCATGGTGTGGTTACAA No data
Right 1015250917 6:131126821-131126843 GAGAAATCGGAGTAATTTAATGG No data
1015250910_1015250917 29 Left 1015250910 6:131126769-131126791 CCTTCCCTGCTCATGGTGTGGTT No data
Right 1015250917 6:131126821-131126843 GAGAAATCGGAGTAATTTAATGG No data
1015250915_1015250917 -1 Left 1015250915 6:131126799-131126821 CCAGAACTGAGGTTTGAACAAAG No data
Right 1015250917 6:131126821-131126843 GAGAAATCGGAGTAATTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015250917 Original CRISPR GAGAAATCGGAGTAATTTAA TGG Intergenic
No off target data available for this crispr