ID: 1015255832

View in Genome Browser
Species Human (GRCh38)
Location 6:131178729-131178751
Sequence CAGGTCAAACAGAAGGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 262}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015255832_1015255836 -5 Left 1015255832 6:131178729-131178751 CCTATCTCCTTCTGTTTGACCTG 0: 1
1: 0
2: 0
3: 20
4: 262
Right 1015255836 6:131178747-131178769 ACCTGTCTGGGAAACACCGATGG 0: 1
1: 0
2: 0
3: 4
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015255832 Original CRISPR CAGGTCAAACAGAAGGAGAT AGG (reversed) Intronic
902549648 1:17211784-17211806 GAGGTCACACAGAGGGTGATGGG - Intronic
903164787 1:21512586-21512608 CAGGTCACACAGCTGGCGATTGG - Intronic
903442800 1:23401137-23401159 CAGGCCAAACAGCAAGAGGTGGG - Intronic
907926053 1:58956145-58956167 CAGGCCACACAGCAGGAGGTAGG + Intergenic
908280196 1:62525422-62525444 CAGGTCAAAAACAAGGATGTTGG - Intronic
912203525 1:107484648-107484670 CAGGTCCAAGAGAAGGTGAGGGG - Intergenic
913597196 1:120389542-120389564 CAGGTCAAACAGAAGGCAAGCGG - Intergenic
914001359 1:143697672-143697694 AAGGTCAAACAGAAGGCAAGGGG + Intergenic
914090128 1:144489764-144489786 CAGGTCAAACAGAAGGCAAGCGG + Intergenic
914308480 1:146444458-146444480 CAGGTCAAACAGAAGGCAAGCGG - Intergenic
914514277 1:148361035-148361057 CAGGTCAAACAGAAGGCAAGCGG + Intergenic
914593629 1:149128675-149128697 CAGGTCAAACAGAAGGCAAGCGG + Intergenic
915599711 1:156914528-156914550 CAAGGCAAAGAGAAGCAGATGGG - Intronic
916008646 1:160684600-160684622 CAGGACAAAATGAAGGAAATAGG + Intronic
917045518 1:170855527-170855549 CAAGTCACACTGAAGGAGTTGGG + Intergenic
917097961 1:171418391-171418413 CAGGACAACTAGAAGGAGGTGGG + Intergenic
917707266 1:177647238-177647260 CAGGACAAACAGATGAAGAAAGG - Intergenic
918157247 1:181860430-181860452 CAGGTGAAAAAGAAGGGGAATGG + Intergenic
924841685 1:247716995-247717017 CAGATCAAACAGAATAAAATTGG + Intergenic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1065476019 10:26138865-26138887 GAGGACACACAGAAGGAAATGGG + Intronic
1066423696 10:35285347-35285369 CAGTTCAAACACAATGATATAGG - Intronic
1067131253 10:43567451-43567473 CAGGTAAAACAGTAGCACATAGG + Intronic
1067522541 10:47019223-47019245 CTGGGGAAAAAGAAGGAGATTGG + Intergenic
1068926660 10:62546894-62546916 CAGGTCAGAAAGAAAGAGAAGGG + Intronic
1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG + Intronic
1071305356 10:84294687-84294709 CAGCCCAAACAGAAGGGGACAGG + Intergenic
1073293291 10:102423901-102423923 CAGGGGAAACAGATGGGGATAGG + Intronic
1074414918 10:113259629-113259651 CAGGTGAACCAGGAGAAGATGGG - Intergenic
1075172034 10:120124651-120124673 CAGTTCAAACTTAAGGAGAAGGG + Intergenic
1075360940 10:121833207-121833229 CAGTTCTAACAGAATGTGATAGG - Intronic
1076934998 10:133562019-133562041 CAGGCCAAACTGAAAGAGAAAGG + Intronic
1076947282 10:133659923-133659945 GAAGTCAAACAGAAGCAGGTGGG + Intergenic
1077860822 11:6178272-6178294 CAGGCCACACAGAAGGAGTTGGG + Intergenic
1078435117 11:11318325-11318347 GAGGTCACACAGAAGTAGAATGG + Intronic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1078678165 11:13446889-13446911 GAGGTCAAAGAGAAGAAAATGGG + Intronic
1079551477 11:21704243-21704265 AAGGACAAACATAAGGAGAGGGG - Intergenic
1080131930 11:28806077-28806099 CAGGTAAAATAGAAAGAGATAGG + Intergenic
1080714299 11:34783899-34783921 CAAGTCACTCAGAAGTAGATGGG + Intergenic
1082798045 11:57392666-57392688 GAGGTCAAACAAAAGGAGAAGGG + Intronic
1088549029 11:110991645-110991667 AAGGTGAGAGAGAAGGAGATCGG + Intergenic
1088912506 11:114202453-114202475 CAGGTCACACAGAAGGCCCTGGG - Intronic
1091284779 11:134402521-134402543 CAGGTGTAACAGAGGGAGGTGGG - Intronic
1091883840 12:4001895-4001917 CAGGCCAGATAGAAGGATATGGG - Intergenic
1092203483 12:6601628-6601650 CAGGTAAAACAGAAGGGGTTTGG - Exonic
1092647438 12:10591464-10591486 CAGTTCAAAGGGAAAGAGATGGG - Intergenic
1093905753 12:24690210-24690232 CAGATCAAACTGAAGGAAAGAGG + Intergenic
1094426282 12:30320480-30320502 CAGATCCAACAAAAGGAGCTTGG - Intergenic
1095320229 12:40818283-40818305 TTGGACAACCAGAAGGAGATGGG - Intronic
1096024422 12:48349144-48349166 TAGGTCAAACAGAAAAAAATGGG + Intronic
1096243319 12:49970990-49971012 CAGGGAGAACAGAAGGAAATGGG + Intronic
1097594866 12:61616658-61616680 CAGGCAAAGGAGAAGGAGATTGG - Intergenic
1097937803 12:65273090-65273112 CAGGTGAGACAGGAGGTGATTGG - Intergenic
1098140350 12:67444479-67444501 CAGGTTGAACAAAAGGAGCTAGG + Intergenic
1098184244 12:67879340-67879362 CAGATCAACCAGAAAAAGATAGG - Intergenic
1099082836 12:78207884-78207906 GAGGACAGACTGAAGGAGATAGG + Intronic
1099111258 12:78564459-78564481 CAGGGCAAACACCAGGAGAGTGG + Intergenic
1099853897 12:88140268-88140290 TAGGACAAACTGAAGGAAATTGG - Intronic
1101629444 12:106478766-106478788 AAGGTCAAACAGAACAAGAAAGG + Intronic
1105898572 13:24738845-24738867 CAGGTTAGATAGGAGGAGATTGG + Intergenic
1106001611 13:25728746-25728768 GGGGTAAAACAGAATGAGATAGG - Intronic
1106685867 13:32057998-32058020 CAGGCCACACAGAAGCAGAAAGG + Intronic
1106845444 13:33733120-33733142 CAGGTGAAACAGAGGTAGACAGG + Intergenic
1108669596 13:52671433-52671455 CAGGTCAAACAAAATGGGACTGG - Intronic
1109083159 13:57933437-57933459 CAGGCCACATAGCAGGAGATAGG - Intergenic
1112630729 13:101158733-101158755 CCAGTCAAACAGAAAGAGACTGG - Intronic
1113013360 13:105796460-105796482 CAGGTCTAACTGAGGGAGAAAGG + Intergenic
1113050656 13:106207839-106207861 CAAGTGAATCAGAAGCAGATGGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118746666 14:68779018-68779040 CAGGACAAACAGCCGGAGAGGGG + Intergenic
1119140316 14:72261377-72261399 CAGGTCATACAAAAGGAGGAGGG + Intronic
1122357624 14:101132921-101132943 TAGATCAAACAGAAGGAAAGGGG + Intergenic
1122481173 14:102048437-102048459 AAGGTCAAACAGAAGTAACTCGG - Intronic
1122511420 14:102271514-102271536 CAGGTCTAACAGAACAAGTTGGG - Intronic
1122863967 14:104595241-104595263 CAGCTAAAACAGCAGGACATAGG + Exonic
1202921338 14_KI270723v1_random:32476-32498 GAAGTCAAACAGAAGCAGGTGGG + Intergenic
1202923572 14_KI270724v1_random:5104-5126 GAAGTCAAACAGAAGCAGGTGGG - Intergenic
1127408246 15:58676515-58676537 CATGTCAAACAAAAACAGATGGG - Intronic
1129937837 15:79465602-79465624 CGGCTCAGACAGAAGGAAATTGG - Intronic
1131070705 15:89463944-89463966 CAGGTGAAATAGATGGAGAGTGG - Intergenic
1131252428 15:90839258-90839280 CATGTCCAACAGTAGGGGATTGG - Intergenic
1131496929 15:92920431-92920453 CAGTTCAAAGGGAATGAGATGGG + Intronic
1134303563 16:13012648-13012670 CAGGTCACAGAGAAGGAGGTGGG + Intronic
1140264746 16:73410654-73410676 CTGGTCCAAGAGCAGGAGATGGG - Intergenic
1141948666 16:87326786-87326808 CAGGTCAAAGGGAAGGACACAGG + Intronic
1143071576 17:4299764-4299786 CAGGTAAAATAGAAGAAGAGGGG - Intronic
1144005545 17:11096056-11096078 CAGGTAGAACAGGAGGTGATGGG - Intergenic
1144146236 17:12401246-12401268 CAGGATAAACAAAAGGAGAAAGG + Intergenic
1145001136 17:19305451-19305473 TAGGTCAAACAGAAAGAAAGTGG - Intronic
1148735679 17:49863554-49863576 CAAGTCAAAAAAAAAGAGATGGG - Intergenic
1149016518 17:51914642-51914664 CATGGCAAAGAGAAGGAAATTGG + Intronic
1149101285 17:52909638-52909660 CAGGTCAAGCTGCAAGAGATGGG - Intergenic
1150220846 17:63495221-63495243 CGGGGCACACAGAAGGAGAGGGG - Intronic
1150370226 17:64631194-64631216 CAGGTCAAAAAAAGGGAGAGAGG + Intronic
1150371324 17:64641120-64641142 AAGGTCATAGAGAAGCAGATTGG - Intronic
1151385113 17:73750437-73750459 CAGCACAAACAGAGGGAGGTGGG + Intergenic
1151420932 17:73997069-73997091 CAGGTGACACACCAGGAGATGGG + Intergenic
1151432949 17:74076927-74076949 AAAGTCCAACAAAAGGAGATGGG + Intergenic
1152008254 17:77695680-77695702 CAGGTGAAGCAGCAGCAGATTGG - Intergenic
1152188724 17:78875300-78875322 AAGGACAAACAGAAGGAAAGAGG + Intronic
1203171185 17_GL000205v2_random:148923-148945 GAAGTCAAACAGAAGCAGGTGGG + Intergenic
1153469443 18:5427648-5427670 CAGGACAAACAGAAAGAGCATGG + Intronic
1153773817 18:8435669-8435691 CTGGTGAAACAGGAGGAGTTTGG - Intergenic
1155190359 18:23423930-23423952 CACGTCAATCATAAGGAGCTGGG + Intronic
1155334407 18:24749734-24749756 CAGGCCAAAAACAAGGACATGGG - Intergenic
1155445215 18:25904250-25904272 CAGGTTGAAGATAAGGAGATAGG + Intergenic
1155445262 18:25904836-25904858 CAGGTTGAAGATAAGGAGATAGG - Intergenic
1156063544 18:33112815-33112837 CAAGACAAACAGAAGATGATGGG + Intronic
1162316059 19:9938695-9938717 CAGGTCAATGAGAAAGAGCTTGG + Intergenic
1162957332 19:14106797-14106819 CTGGTGAAACACAAGGAGACCGG - Exonic
1163003786 19:14384719-14384741 AAGGGGAAACAGGAGGAGATGGG - Intronic
1163161469 19:15467144-15467166 GAGGTCACACAGAGGGAGAGGGG - Intergenic
1164144411 19:22502844-22502866 GAACTCAAACAGATGGAGATTGG - Intronic
926556839 2:14367519-14367541 GAAGTCAAGTAGAAGGAGATAGG + Intergenic
927056023 2:19366169-19366191 CAGGTCAAACAGAAGCCAAAGGG + Intergenic
927522220 2:23706001-23706023 CAGGTCACACAGAAGCACCTTGG + Intronic
928096533 2:28408409-28408431 CAGGCCAGAGAGAAGGAGCTGGG - Intronic
928517342 2:32056103-32056125 AAGGACAAAAAGAAGGAGCTAGG - Intergenic
930246605 2:48990021-48990043 CAGATCCAAAAGGAGGAGATGGG - Intronic
930296300 2:49558672-49558694 CAGTTCAAACTGAAGGAAAAAGG - Intergenic
930916404 2:56694516-56694538 CAGGTAGTACAGAAGAAGATGGG + Intergenic
930924749 2:56803448-56803470 CAGTTTAAACAGACAGAGATAGG + Intergenic
932062601 2:68522736-68522758 CAGTTCAAACTGATGGAGAAAGG + Intronic
934772989 2:96919838-96919860 CAGGAAAGACAGAAAGAGATGGG + Intronic
935221177 2:101014585-101014607 CAGGTGAAATGGAAGCAGATTGG - Intronic
935237935 2:101153422-101153444 CAAGTCAAACAGAAGCCAATAGG + Intronic
935407757 2:102726861-102726883 CAGGACAAACAGAAACACATTGG + Exonic
935578258 2:104733363-104733385 CAGGTCAAGAAGAAGGTGTTGGG + Intergenic
937395195 2:121529106-121529128 TAGGTAAAACACAAGGAGAGGGG + Intronic
940096697 2:149984122-149984144 GAGGTGAAAGACAAGGAGATTGG + Intergenic
940876573 2:158903604-158903626 TAGGTCAAGCAGAAGCAGCTTGG - Intergenic
942423018 2:175827528-175827550 CAGGTAAAATGAAAGGAGATAGG + Intergenic
946314457 2:218900634-218900656 CATCTCAGACAGAAGGAGACTGG - Intergenic
947049898 2:226030785-226030807 AAGATCAAATAGAAAGAGATCGG - Intergenic
947873224 2:233451103-233451125 CCCGTCAAACTGAAAGAGATGGG + Intronic
947931524 2:233968705-233968727 CCCGTCAAGCAGAAGGAGTTTGG - Intronic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
1170337456 20:15286005-15286027 CAGGTGAAAGAGGTGGAGATGGG - Intronic
1170872066 20:20214877-20214899 CAGGGCAGGCAGAAGGAGAGTGG + Intronic
1172699749 20:36845816-36845838 CAGATCCAACTGAAGGAGCTGGG + Intronic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1174062350 20:47841737-47841759 CAGGTGAAAAAGAAAGAGAAGGG - Intergenic
1174414905 20:50360144-50360166 GAGGTCACACAGAAGGTCATGGG - Intergenic
1174645958 20:52085512-52085534 CAGGTCAAACAGCAGGGATTTGG + Intronic
1175155182 20:56966354-56966376 GAGGTGAAAGAGAAGGAAATGGG + Intergenic
1175368250 20:58470033-58470055 CAGGTTAGACAGAATTAGATGGG + Intronic
1175571644 20:60027227-60027249 CAGGTGAAAAAGAAGGACAGTGG + Intronic
1175736518 20:61391062-61391084 CAGGACAAAAAGAAGCAGACAGG - Intronic
1176327169 21:5510753-5510775 GAAGTCAAACAGAAGCAGGTGGG + Intergenic
1176330544 21:5545458-5545480 GAAGTCAAACAGAAGAAGGTGGG - Intergenic
1176397213 21:6275493-6275515 GAAGTCAAACAGAAGAAGGTGGG + Intergenic
1176400588 21:6310198-6310220 GAAGTCAAACAGAAGCAGGTGGG - Intergenic
1176436569 21:6678906-6678928 GAAGTCAAACAGAAGCAGGTGGG + Intergenic
1176439944 21:6713611-6713633 GAAGTCAAACAGAAGAAGGTGGG - Intergenic
1176460831 21:7005976-7005998 GAAGTCAAACAGAAGCAGGTGGG + Intergenic
1176464206 21:7040680-7040702 GAAGTCAAACAGAAGAAGGTGGG - Intergenic
1176484392 21:7387754-7387776 GAAGTCAAACAGAAGCAGGTGGG + Intergenic
1176487767 21:7422459-7422481 GAAGTCAAACAGAAGAAGGTGGG - Intergenic
1181787649 22:25238428-25238450 CAGGTGAAACTGGAGGAAATTGG + Intergenic
1181819385 22:25463466-25463488 CAGGTGAAACTGGAGGAAATTGG + Intergenic
1183177129 22:36232594-36232616 CAGGTCACACAGAAGGGACTTGG + Intronic
949599350 3:5581314-5581336 CAGTTCATAAATAAGGAGATAGG + Intergenic
949729933 3:7097152-7097174 CAGGTAAAGCAGATGGAGAGTGG + Intronic
949927668 3:9054943-9054965 CAGCTCATACAGAAGAACATTGG + Intronic
950680846 3:14584112-14584134 CAGGTCACACAGTAGGTGAGGGG + Intergenic
952597008 3:35029686-35029708 CAGGCCAGAGAGAAGGAGATGGG - Intergenic
954082663 3:48221699-48221721 CAGGCCAAACAGAAGGATCGGGG + Intergenic
955443566 3:58982885-58982907 CAATTCACACAGGAGGAGATTGG + Intronic
960185567 3:114633899-114633921 CATGTCAAACATAAGGAACTAGG + Intronic
961483076 3:127196528-127196550 CAGGTCGCACAGGAGGGGATGGG - Intronic
963290424 3:143481539-143481561 AAAGCCAAACAGAATGAGATGGG + Intronic
964958179 3:162388584-162388606 CAGTTCAAATATAAAGAGATTGG - Intergenic
964973902 3:162597217-162597239 CAGGGCAGAAAGTAGGAGATGGG - Intergenic
966143254 3:176780978-176781000 CAGACAAAACAGAAGGAAATGGG + Intergenic
967279307 3:187806658-187806680 CAGGACACACAGAATGAGAGTGG - Intergenic
968282549 3:197488064-197488086 CATGACAAACAGAAGCAGATGGG + Intergenic
968610362 4:1554226-1554248 CAGGTCAGACAGAGGGTGAGGGG - Intergenic
968807220 4:2782193-2782215 CAGGTCATACATAGGTAGATAGG + Intergenic
968818523 4:2833885-2833907 CAGGCCACACAGACGGACATGGG + Exonic
970215152 4:13751167-13751189 CAGATCACAAAGAAGGAGAAGGG + Intergenic
970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG + Intronic
971664707 4:29467454-29467476 CAGGGCAGACAGGAGGAGCTGGG + Intergenic
972026381 4:34383475-34383497 CACGTGACAAAGAAGGAGATTGG + Intergenic
972336630 4:38112818-38112840 CAGGTCACACAGATGGAGTGTGG - Intronic
977747647 4:100569468-100569490 CAGGGCAAGCAGAGGGAGATGGG - Intronic
978068697 4:104439142-104439164 CAGGGCAACCATAAGCAGATAGG + Intergenic
979150275 4:117304485-117304507 CAGGTGAAAGAGAAGGTGAAAGG + Intergenic
981735439 4:147945282-147945304 CAGGAAAAAAAAAAGGAGATGGG - Intronic
981784497 4:148462162-148462184 CAGGCCACACAGCAGGAGGTAGG + Intergenic
987885087 5:23802201-23802223 GAGCCCAAACAGCAGGAGATAGG - Intergenic
990987009 5:61649890-61649912 CAGATGACACAGAAGGAGAGGGG - Intronic
993276496 5:85866327-85866349 CAGTTCATACAGATTGAGATAGG + Intergenic
994457571 5:100031522-100031544 CAGGCCAAATAGAATGAGTTTGG - Intergenic
996394719 5:123002078-123002100 CAGGTCTAACAGAGTGACATTGG + Intronic
996831431 5:127744357-127744379 CCTGTCAAGCAGAAGGAGAGAGG + Intergenic
997090879 5:130856100-130856122 GAGTTCAAACAGAAAGACATGGG + Intergenic
997436724 5:133880984-133881006 CACTTAAAGCAGAAGGAGATGGG - Intergenic
999571851 5:152927556-152927578 CAGGTGACACAGAAGGAGTTAGG + Intergenic
1001433805 5:171683904-171683926 TAGGGCAAACAGGAGGAGGTGGG - Intergenic
1001756654 5:174175466-174175488 GAGGTCAAACTGGAGGAGAGTGG - Intronic
1001953479 5:175832169-175832191 CATGTCTGACAGCAGGAGATGGG + Intronic
1003141755 6:3477698-3477720 CAGGCCACACAGCAGGAGGTGGG - Intergenic
1003149102 6:3533694-3533716 CAGAACAAACAGATGGAGACAGG + Intergenic
1003553764 6:7122012-7122034 CAACTCACACAGAAGGGGATGGG - Intronic
1003858872 6:10303688-10303710 GAGGTCACACAGATGGAGGTGGG - Intergenic
1004477052 6:15982846-15982868 GAGGTCAAACAGAAGTTCATAGG - Intergenic
1004991022 6:21138898-21138920 AAGGGCACACAGAAGGAGAAAGG - Intronic
1005115961 6:22337282-22337304 CATGTCAAAAACATGGAGATGGG + Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005505142 6:26463131-26463153 AAGGTAAAAAAGAGGGAGATAGG - Intronic
1007035828 6:38672601-38672623 CAGGTAAAAATGAAGGAAATTGG + Intergenic
1007143072 6:39596147-39596169 CAGGTCAACCAGATGGAGTTTGG + Exonic
1010935797 6:81859893-81859915 CAGGTCAAAGATAAATAGATTGG - Intergenic
1011967722 6:93180214-93180236 CAGCTGAAAGAGAAGGAGAAAGG - Intergenic
1012525754 6:100176114-100176136 CAAGTCAAACAAAAGAAGTTTGG - Intergenic
1013041003 6:106433324-106433346 CTGGTCAAACTGGAGGAGAAAGG + Intergenic
1013236825 6:108204221-108204243 CAGGAGAGACAGAAAGAGATTGG - Intergenic
1013421271 6:109969434-109969456 AATGTCAAACAGAAGGGGAATGG + Intergenic
1013993194 6:116278460-116278482 CAGGTCCAGCAGAAGGTGGTAGG + Exonic
1014783334 6:125589488-125589510 CATGGCTAACAGAAGGAGCTGGG - Intergenic
1014831453 6:126107368-126107390 CAGGTCAAAGAAAAGGGAATTGG - Intergenic
1014944765 6:127484092-127484114 GAGGTCAAAGAGAAGGACAGGGG + Intronic
1015186373 6:130421041-130421063 CAGATGAAACAGAAGGGGAGGGG - Intronic
1015255832 6:131178729-131178751 CAGGTCAAACAGAAGGAGATAGG - Intronic
1015383023 6:132591399-132591421 CAGGTCAAAAAGAAGGAAGGAGG + Intergenic
1016189811 6:141251042-141251064 AATGTCAAACAGAAGGTGAGTGG + Intergenic
1017316913 6:153042022-153042044 AAGGTCACACAGATAGAGATGGG + Intronic
1018561747 6:165107202-165107224 CGGGCCACACAGCAGGAGATGGG - Intergenic
1019973622 7:4562462-4562484 AAGGTCAAACAAAATGAAATAGG + Intergenic
1020910084 7:14118224-14118246 CAGGTGAAACAGAAGAGAATAGG + Intergenic
1021059991 7:16099457-16099479 CAGGAAAAACATAAGGAGAAGGG + Intronic
1021562511 7:21982525-21982547 CAGTGGAAACAGAAAGAGATTGG - Intergenic
1022772795 7:33492569-33492591 CAGGTAACACAGATGTAGATGGG + Intronic
1022944627 7:35270022-35270044 CAGGTCACTCAGAAGGAGCCAGG - Intergenic
1023103875 7:36745551-36745573 CAGGTCAAACAAAATGGGAGAGG + Intergenic
1023598656 7:41859101-41859123 CAGGTCCATTAGAATGAGATAGG - Intergenic
1025232092 7:57209408-57209430 CAGGTGAAATAGAAAGAGAAGGG + Intergenic
1025255584 7:57382054-57382076 GAGGTCACACAGAAGGTCATGGG + Intergenic
1028328408 7:89557543-89557565 CATATGAAACAGAAGGAAATGGG - Intergenic
1028438992 7:90837539-90837561 CAGATTACACAGAAAGAGATGGG + Intronic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1030663587 7:112249568-112249590 GTGGTCAAAGAGAAGGAAATAGG + Intronic
1031452136 7:121935394-121935416 CAGCTCAGACAGAAGAAGAAGGG - Intronic
1031949362 7:127876117-127876139 AAGGACAAAGAGAAGGAGAGGGG - Intronic
1032061750 7:128730559-128730581 CTGGTCAAACAGAGGCACATAGG - Intronic
1032071383 7:128809495-128809517 AAGGCCAGCCAGAAGGAGATGGG + Exonic
1035014735 7:155755285-155755307 CAGGACACACAGAAGGACAGGGG - Intronic
1035632267 8:1117135-1117157 CAGGTCAAAGAGACGGTGTTGGG - Intergenic
1035632272 8:1117168-1117190 CAGGTCAAACAGACGGTGTTGGG - Intergenic
1037492406 8:19408675-19408697 CAGGTCATAAAGAAGGAAACTGG - Exonic
1037953992 8:23039231-23039253 CAGGCCACACAGCAGGAGGTGGG - Intronic
1038145141 8:24888391-24888413 CAGGGGAAACAGCAGGTGATGGG + Intergenic
1040700898 8:50064388-50064410 CAAGGTAAGCAGAAGGAGATGGG - Intronic
1042751940 8:72167185-72167207 CTGGTCACACAGAATGAGTTAGG + Intergenic
1045705286 8:104915621-104915643 CTGGTTTACCAGAAGGAGATAGG - Intronic
1045990081 8:108296699-108296721 CTGATCAAGCAGAAGGAAATGGG - Intronic
1046124960 8:109894546-109894568 AAGATCAAAAAGAAGGAAATTGG - Intergenic
1047491083 8:125375177-125375199 CAGGTAAAACTGAAGGAAACAGG + Intergenic
1047747775 8:127857567-127857589 TAGGTGAAAGAGGAGGAGATGGG + Intergenic
1049547266 8:143238884-143238906 CTGGTCAAACAGAATGCCATTGG - Intergenic
1052784191 9:32813620-32813642 CAGGCCAAACAGAAGGCGCTAGG - Intergenic
1053377979 9:37624336-37624358 CAGGGCACACAGCAGGAGACAGG + Intronic
1055717052 9:79129213-79129235 CAGGACACACAGAAGGACACAGG + Intergenic
1057733194 9:97629917-97629939 CAGGTCATATAGAGGGAGATTGG - Intronic
1059499254 9:114737221-114737243 CAGGTCACACAGCAGGAGCTGGG - Intergenic
1059779460 9:117510973-117510995 CAAGTCAAATACAAGGAGAGTGG - Intergenic
1060527198 9:124327312-124327334 CAGGGCGAGGAGAAGGAGATTGG - Intronic
1060889943 9:127181738-127181760 CAGGCCAAAGAGATGGAGAAAGG - Intronic
1203431551 Un_GL000195v1:94868-94890 GAAGTCAAACAGAAGAAGGTGGG + Intergenic
1203434943 Un_GL000195v1:129753-129775 GAAGTCAAACAGAAGCAGGTGGG - Intergenic
1187502086 X:19847293-19847315 CATGTAAAACAGAAGCTGATGGG + Intronic
1187692911 X:21889332-21889354 AAGTTAGAACAGAAGGAGATAGG + Intergenic
1188381740 X:29502806-29502828 CAGGTCTTACAGAATGAGTTTGG + Intronic
1190446242 X:50527354-50527376 CAAGTGAAACAGCAGGAGCTAGG - Intergenic
1190451482 X:50585569-50585591 CAGGTCAATTAGAGGGAGCTGGG + Intergenic
1192219983 X:69191295-69191317 AAGGTCAAACAGCAGGAAAGTGG - Intergenic
1192985776 X:76396976-76396998 CAGTTCACACAGAAAGACATGGG - Intergenic
1194040487 X:88936209-88936231 CTGGTCTCATAGAAGGAGATAGG + Intergenic
1198466740 X:136910210-136910232 GAGGGGAAAGAGAAGGAGATGGG - Intergenic
1199423179 X:147670258-147670280 GAGGACCAACAGAAGGACATGGG + Intergenic
1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG + Intergenic
1200135665 X:153873424-153873446 CAGGTCAAGCCCAGGGAGATGGG + Intronic