ID: 1015258406

View in Genome Browser
Species Human (GRCh38)
Location 6:131206608-131206630
Sequence ATACAGAACTAGAATTGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015258404_1015258406 6 Left 1015258404 6:131206579-131206601 CCAGTTCCTGAATTGTTTGGTGA 0: 1
1: 0
2: 2
3: 13
4: 161
Right 1015258406 6:131206608-131206630 ATACAGAACTAGAATTGTAATGG No data
1015258405_1015258406 0 Left 1015258405 6:131206585-131206607 CCTGAATTGTTTGGTGATTGAAT 0: 1
1: 0
2: 4
3: 33
4: 271
Right 1015258406 6:131206608-131206630 ATACAGAACTAGAATTGTAATGG No data
1015258402_1015258406 22 Left 1015258402 6:131206563-131206585 CCATTAAGAGGAAATTCCAGTTC 0: 1
1: 0
2: 1
3: 18
4: 182
Right 1015258406 6:131206608-131206630 ATACAGAACTAGAATTGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015258406 Original CRISPR ATACAGAACTAGAATTGTAA TGG Intronic
No off target data available for this crispr