ID: 1015261370

View in Genome Browser
Species Human (GRCh38)
Location 6:131241280-131241302
Sequence ATGGAGAAGGAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5522
Summary {0: 1, 1: 6, 2: 119, 3: 872, 4: 4524}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015261363_1015261370 0 Left 1015261363 6:131241257-131241279 CCTGCACTTGGCATTTGCAGTGG 0: 1
1: 0
2: 2
3: 20
4: 212
Right 1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG 0: 1
1: 6
2: 119
3: 872
4: 4524

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015261370 Original CRISPR ATGGAGAAGGAGAAGGAGGA GGG Intronic
Too many off-targets to display for this crispr