ID: 1015264867

View in Genome Browser
Species Human (GRCh38)
Location 6:131280702-131280724
Sequence GGGGCTCCTTCCCCAGTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015264867_1015264877 23 Left 1015264867 6:131280702-131280724 CCCTTAACTGGGGAAGGAGCCCC 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1015264877 6:131280748-131280770 GAGTCTGAAAGAGAGTGACTGGG 0: 1
1: 0
2: 0
3: 18
4: 231
1015264867_1015264872 1 Left 1015264867 6:131280702-131280724 CCCTTAACTGGGGAAGGAGCCCC 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1015264872 6:131280726-131280748 TAGTTCCTTTTCCCAGTTAAAGG 0: 1
1: 0
2: 5
3: 14
4: 204
1015264867_1015264876 22 Left 1015264867 6:131280702-131280724 CCCTTAACTGGGGAAGGAGCCCC 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1015264876 6:131280747-131280769 GGAGTCTGAAAGAGAGTGACTGG 0: 1
1: 0
2: 4
3: 25
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015264867 Original CRISPR GGGGCTCCTTCCCCAGTTAA GGG (reversed) Intronic
901640838 1:10692321-10692343 GGCTCTCCTGCCCCAGGTAAGGG + Intronic
904094621 1:27967174-27967196 GAGGCTGCTTCGCCAGTGAAGGG + Exonic
905766758 1:40607783-40607805 GGGGCATCTTCCTCAGATAAAGG + Intergenic
905889281 1:41509596-41509618 AGGGCTCCTTCCCCAGCCCAGGG + Exonic
908816893 1:68043854-68043876 GGGGCACCTTCTCCTGATAAAGG - Intergenic
912411932 1:109485660-109485682 GGGCCTGCTTCCCCATTTAAAGG - Intronic
912505174 1:110151054-110151076 GGGGCTCCGTCGCCAGGCAACGG - Intronic
914922042 1:151853734-151853756 GGGGCTCCTAGACCAGCTAAAGG - Intergenic
915123833 1:153649573-153649595 AGGTCTTCCTCCCCAGTTAAAGG + Intergenic
916981602 1:170144014-170144036 GCGAATCCTTCCCCAATTAACGG - Intergenic
923498364 1:234544175-234544197 GGGGCTGTTTCCACACTTAATGG + Intergenic
924170484 1:241334527-241334549 GGGGCCCATTCCACAGTGAAAGG + Intronic
1063088767 10:2842819-2842841 GGGGCTGCTTGTCCAGTTACTGG + Intergenic
1071814270 10:89215962-89215984 GGCACTGCTTCCCCAGTCAAAGG + Exonic
1073300112 10:102466028-102466050 CGGGCTCCTTCCTCAGGTAAGGG - Exonic
1073716676 10:106115289-106115311 GGGGGTTCTCACCCAGTTAAGGG - Intergenic
1077713445 11:4558247-4558269 GTGGATCATTCCCCAGATAAGGG + Intergenic
1078864265 11:15281945-15281967 GAGGCTCCTTCCACAGGTTATGG - Intergenic
1079222458 11:18575659-18575681 GGGCCACCTTCCCCACTTAGAGG + Intronic
1084323114 11:68384521-68384543 GTGGCTCCCTCCCCAGGTTAGGG - Intronic
1084504884 11:69559338-69559360 AGGGCTCTTTCTCCAGTGAAGGG - Intergenic
1084603211 11:70158817-70158839 GGGTCCCCTTCTCCAGGTAAGGG - Intronic
1084730026 11:71066930-71066952 GAGGCCCCTTCCCCAGTCAGTGG + Intronic
1086415897 11:86588730-86588752 AGGGCCCTTTCCCCTGTTAATGG + Intronic
1096984708 12:55748744-55748766 GCGGTCCCTTCCCCAGTTAGGGG - Exonic
1102297438 12:111747902-111747924 GGGGCTCATACCCCAGGCAAGGG - Intronic
1104047338 12:125172758-125172780 GGGGCTCCTGGCCCAGTCCAAGG + Intergenic
1104537470 12:129631659-129631681 GGTGATCCTTTCCCAGCTAAGGG - Intronic
1113533546 13:111046419-111046441 GTGGCTCCTTCCCCAGGTCTGGG + Intergenic
1114951631 14:27761705-27761727 GAGTCTCCTTCCCTAGTTCAAGG + Intergenic
1120529011 14:85609716-85609738 GGGGCTGCTCCCCCAGCTCATGG - Intronic
1123205077 14:106704562-106704584 GGGGCTTCTTCTTCAGTGAAAGG - Intergenic
1123210073 14:106751003-106751025 GGGGCTTCTTCTTCAGTGAAAGG - Intergenic
1123389715 15:19858389-19858411 GGGCCTCCAACTCCAGTTAAGGG - Intergenic
1124043497 15:26126221-26126243 GGGGCTGTTTCCCCAGTTCTGGG + Intergenic
1132799242 16:1743529-1743551 GAGGCTCCCGCCCCAGTGAACGG - Intronic
1133510290 16:6451681-6451703 GGGACACCTGCCCCAGTAAAGGG - Intronic
1138419022 16:56887185-56887207 GGGGCTCCTTCTGCAGCAAAAGG - Intronic
1140300907 16:73756548-73756570 TGGTCTCCCTCCCCAGTGAAGGG - Intergenic
1142504863 17:356895-356917 GGGGCTCCTTCCCCAGCCCCTGG + Intronic
1145251284 17:21298239-21298261 GGGCCTCCTTCCCCCTTTGAAGG + Intronic
1146373493 17:32279857-32279879 GGGGCTCCTTCCCCAGTCTGGGG - Intronic
1147564931 17:41530126-41530148 GGGTTTCCTGCCCCAGTTCAAGG - Intergenic
1148392308 17:47281341-47281363 AGGGCTCCTTACCAAGTTGAGGG - Intronic
1153822070 18:8840548-8840570 GGGGCTCCTGACCTAGTTGAGGG + Intergenic
1155441870 18:25870464-25870486 GGGGGTACTTCACCATTTAAGGG + Intergenic
1158420135 18:57286089-57286111 GGGCCTCCTTCCACAGGGAATGG + Intergenic
1161621216 19:5298375-5298397 GGGGGTCCTGCCCCGGTCAAGGG - Intronic
1166943387 19:46382283-46382305 TGGGCTCCTTCCCCAAGGAAGGG + Intronic
926131857 2:10308088-10308110 GGAGCTCCTACCCCAGTATAGGG + Intronic
926476578 2:13329756-13329778 GGGTCTTCTTTCCCAGTTAGGGG + Intergenic
928283035 2:29965378-29965400 GGGGCTTCCTCCCCTTTTAATGG - Intergenic
932139192 2:69260659-69260681 GGGGCTGGTTCCCCTGATAAAGG + Intergenic
932305138 2:70696533-70696555 TGGACTCCTGCCCCAGGTAAGGG - Intronic
937225320 2:120365464-120365486 GGGACTCCTTCCTCTGCTAAGGG + Intergenic
938118471 2:128617907-128617929 GGTTCTCCCTCCACAGTTAATGG + Intergenic
938246152 2:129779418-129779440 GGGGCTCCTTCCACAGCCACAGG - Intergenic
945176523 2:207048947-207048969 GGGGCAGCTTCCCCAGTTTGTGG + Intergenic
946284636 2:218693761-218693783 GGGGCTCCTGCCCCAGAAGACGG - Exonic
947432755 2:230045131-230045153 CGGGCTCCTTACCCATTTGAAGG - Intronic
947957597 2:234207065-234207087 AGGGCTCCTTCCTCAGGAAACGG - Intergenic
1170575203 20:17657337-17657359 GGGGCTGCTGCCCCAGCAAATGG + Intronic
1172033275 20:31995960-31995982 GGGACCCCTTGCCCAGTTACGGG + Intronic
1174059203 20:47820609-47820631 AGAGTTCCTTCCCCAGTAAAAGG - Intergenic
1174358641 20:50014615-50014637 GGGGCCCCTTCCCCATCCAATGG + Intergenic
1176414861 21:6468278-6468300 GGGGCTCCTTCGCCAGGTCCCGG + Intergenic
1177854409 21:26384969-26384991 GTTGCTCCTTCCCCAGACAAAGG - Intergenic
1179690361 21:43076600-43076622 GGGGCTCCTTCGCCAGGTCCCGG + Intronic
1181779874 22:25184920-25184942 GGGGGCCCTTCCCCAGACAAAGG + Intronic
1184113405 22:42408614-42408636 GGGGCTCCTTGCCCAGCACATGG - Intronic
952342066 3:32455325-32455347 GGGGCTCCATCCCCAGGCACAGG + Exonic
953069787 3:39507692-39507714 GGAGCTCCTTCTCCAATGAAAGG + Intronic
956158022 3:66318401-66318423 GGGGCTCCCTCCCCTGGTCAAGG - Intronic
956178056 3:66492869-66492891 TGAGTTCCTTCCCCAGTGAATGG - Intronic
959120183 3:102223314-102223336 GGGCCTCCCTCCCCAGCCAAGGG - Intronic
961629288 3:128284494-128284516 AAGGCTCCTTCCTCAGTTACTGG + Intronic
962282035 3:134059405-134059427 GGGGCTGCCTCACCAGCTAATGG + Intergenic
964220456 3:154338506-154338528 GGGCATATTTCCCCAGTTAAAGG + Intronic
968511291 4:997062-997084 AGGTCTCCTTTCCCAGTAAATGG - Intronic
968898909 4:3421601-3421623 AGTGCTCCTTCCCCAGCCAAGGG - Intronic
970095736 4:12461274-12461296 GGGTCTCCCTCTACAGTTAATGG + Intergenic
985361142 4:189177462-189177484 AGGGCTTCCTCCCCAGCTAATGG + Intergenic
994852677 5:105075789-105075811 CAGGCTCCTTCCCCAGGCAAAGG + Intergenic
999295962 5:150459575-150459597 GGGTCTCCTTCCCCACGGAAGGG + Intergenic
1002953314 6:1837751-1837773 GGAGTTCCTTCCCCAGTGAGTGG + Intronic
1005684619 6:28241212-28241234 TGGACTCCTTTCCCAATTAATGG - Intergenic
1006744786 6:36333997-36334019 GCGCTTCCTTACCCAGTTAACGG + Intronic
1008416656 6:51248451-51248473 TAGGTTCTTTCCCCAGTTAAAGG - Intergenic
1010798161 6:80141935-80141957 TGGGTTCCTCCCCCTGTTAAAGG - Intronic
1015264867 6:131280702-131280724 GGGGCTCCTTCCCCAGTTAAGGG - Intronic
1020040467 7:4997242-4997264 GAGGCTGCTTCGCCAGTGAAGGG + Intronic
1020278459 7:6637953-6637975 GGGGCTCCTTCTGCAGATGAGGG - Exonic
1031415999 7:121497264-121497286 GGGGCTGGTTCCCCAGATAATGG - Intergenic
1031830849 7:126623584-126623606 GGGCCTTCATCCCCAGTGAATGG - Intronic
1034397555 7:150838735-150838757 GGGGCTCTTTCTCCAGCTTAGGG - Intronic
1037432746 8:18830906-18830928 GAAGCTCCTTCCCCAGTAAATGG - Intronic
1037984297 8:23277511-23277533 GGGGTTCCTGTCCCAGTTTATGG + Intronic
1041642095 8:60214323-60214345 GAGGGTCCTTCCCTTGTTAATGG - Intronic
1046856737 8:119040792-119040814 GTGGCTCCTTCCCCTGTCAATGG - Intronic
1048972028 8:139650544-139650566 GGGTCTACTTCCTCAGGTAAGGG - Intronic
1050225994 9:3456122-3456144 AGGGCTCCTTCCCTTGTGAATGG - Intronic
1056380337 9:86052023-86052045 GGGGCTCCTTCCACTGTGACAGG - Intronic
1057425814 9:94948667-94948689 AGGGCTCCTTCACCCTTTAAAGG - Intronic
1061090268 9:128421991-128422013 GGGGCCCCTTCCCCAGGAGAGGG + Intronic
1061729815 9:132604989-132605011 GGATCTCCTTCCCCACATAAAGG - Intronic
1061883645 9:133580058-133580080 GGGGCTCCCTCCCGAGGTAGGGG + Intronic
1187394503 X:18907795-18907817 GGGGCTCCTTCACAAGTAAGAGG + Intronic
1195260001 X:103122547-103122569 GGGGCTCCATCTCCAGCTGATGG + Intergenic
1199272311 X:145898651-145898673 GGGGCTGCATCCCCACTAAAAGG - Intergenic
1200179859 X:154143714-154143736 GGGGCTCCTCCTCCAGTGTAGGG - Intergenic
1201349396 Y:13023327-13023349 TGGGCTCCTCCCCTAGTCAAGGG + Intergenic