ID: 1015264980

View in Genome Browser
Species Human (GRCh38)
Location 6:131281766-131281788
Sequence TAGACTCAGCAGAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 304}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015264980_1015264985 19 Left 1015264980 6:131281766-131281788 CCTGCTTCCCTCTGCTGAGTCTA 0: 1
1: 0
2: 2
3: 41
4: 304
Right 1015264985 6:131281808-131281830 CTGTTTAAGTTAAGTTTCTCTGG 0: 1
1: 0
2: 0
3: 12
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015264980 Original CRISPR TAGACTCAGCAGAGGGAAGC AGG (reversed) Exonic
900598142 1:3491714-3491736 TTGTCTCTGCAGAGGGAAGTGGG - Intronic
900822797 1:4902116-4902138 TGCACACAGCAGAGGGACGCTGG + Intergenic
900827868 1:4941064-4941086 TCCACTCAGAAGAGGGCAGCAGG + Intergenic
902594265 1:17497453-17497475 GAGACTCAGAAGAGGGAGGATGG - Intergenic
902736896 1:18407284-18407306 TGGGCTCAGCAGAGCTAAGCAGG - Intergenic
904026099 1:27504693-27504715 CATTCTCACCAGAGGGAAGCAGG - Intergenic
904575156 1:31500798-31500820 AAGACTCAGAAGGGGGAGGCTGG - Intergenic
905109529 1:35585112-35585134 TAAACTCAGTAGAGTGGAGCAGG + Intronic
908624815 1:66028339-66028361 TACACACAGCATAGGGAACCTGG + Intronic
909134494 1:71780860-71780882 TGGGCTCAGAAGAGGGAAGGTGG - Intronic
912417615 1:109520805-109520827 CAGACTCAGGAGATTGAAGCGGG - Intergenic
913382408 1:118226528-118226550 TAGCCTCAGAAAAGAGAAGCAGG - Intergenic
915137590 1:153744282-153744304 CAGACTCAGGACAGGGAAGCAGG - Intronic
915356145 1:155256030-155256052 GTGGCACAGCAGAGGGAAGCTGG + Exonic
915636542 1:157190833-157190855 TAGAGTCAGCAGTGGGAACAGGG + Intergenic
915648039 1:157287869-157287891 TGGACTCTGCAGAGGGATGGTGG - Intergenic
915805705 1:158847146-158847168 AAGACTCAGAAGCGGGAGGCTGG + Intronic
916858769 1:168780005-168780027 TAGAGTCAGCAGATGCCAGCAGG - Intergenic
918002434 1:180510084-180510106 GAGACTCAGCAGGGGGAGGGTGG - Intergenic
918248163 1:182678995-182679017 TAGACACATCTGAGGGCAGCTGG - Intronic
919190111 1:194205438-194205460 AAGAGTCAGTAGAGGGAAGTGGG + Intergenic
919323824 1:196080245-196080267 TAGCCTCAGCAGCCAGAAGCTGG - Intergenic
919666408 1:200297062-200297084 TAGCCTCAGCTGAGGCAAGAGGG + Intergenic
919813691 1:201424678-201424700 TAGAGCCTGCAGGGGGAAGCAGG + Intronic
919976525 1:202616373-202616395 CAGCCTCAGCTGAGGGAAGGGGG - Intronic
920399822 1:205669810-205669832 ATGACTCAGCTGAGGAAAGCGGG + Intronic
920611144 1:207438969-207438991 GAGACTCAGAAGGGGGAAGGTGG + Intergenic
920905594 1:210163758-210163780 TAGATTCAGTAGAGTGAAGTGGG - Intronic
922743049 1:228026613-228026635 GAGACTCAGAAGAGGGAGGTTGG - Intronic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923536253 1:234854314-234854336 TTGTCTCAAAAGAGGGAAGCCGG + Intergenic
923688227 1:236169082-236169104 GAGCCTCAGCAGAAGGAAACAGG + Intronic
923880900 1:238103173-238103195 GAGACTCAGCAGGGGGAAGGGGG - Intergenic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
924719984 1:246613702-246613724 TAGACTCAGAAGAGGGAGACGGG - Intronic
1063163988 10:3443222-3443244 TAGGCTCAGCTGGGGGAAACCGG - Intergenic
1063713449 10:8503939-8503961 TAGGCTCTGAAGTGGGAAGCTGG + Intergenic
1064506647 10:16038166-16038188 GAGACTCAGAAGAGGAAGGCTGG + Intergenic
1065452184 10:25870493-25870515 TAGGGTCAGGAGAGGGAAGGAGG + Intergenic
1066695276 10:38071873-38071895 TAGAAGCATCAGAGGGAACCTGG - Intergenic
1066984663 10:42454444-42454466 TAGCCTCAGCCTAGGGCAGCGGG - Intergenic
1066997223 10:42575393-42575415 TAGAAGCATCAGAGGGAACCTGG + Intronic
1068596169 10:58905170-58905192 TAGCCCCAGCAGAGGGTGGCAGG - Intergenic
1069020212 10:63478591-63478613 TAAAATCAGCAAAGGGAAGAGGG + Intergenic
1071531297 10:86391991-86392013 GAGAGGGAGCAGAGGGAAGCAGG + Intergenic
1071549689 10:86557109-86557131 GAGGCTCTGCAGAGGGAACCAGG + Intergenic
1072304025 10:94089227-94089249 GAGCCCCAGGAGAGGGAAGCAGG + Intronic
1072790819 10:98316429-98316451 CAGGCTGAGCTGAGGGAAGCAGG + Intergenic
1073100095 10:101001994-101002016 GAGGCCCAGCAGAGGGAGGCAGG + Exonic
1073350402 10:102815556-102815578 TGGACTCACCAGAGGCAGGCAGG - Exonic
1074540625 10:114362555-114362577 TAGAATCAGCAGAGGGAGCGCGG + Intronic
1074640213 10:115370928-115370950 TGGACACAGCAGAGGGACCCTGG - Intronic
1075186498 10:120263739-120263761 TATACCAAGCAGAGGGAATCTGG - Intergenic
1075205662 10:120445596-120445618 TGGAGTCTGCAGAGGCAAGCAGG - Intergenic
1076108315 10:127842281-127842303 TACAATCAGCAGATGGAAACAGG - Intergenic
1077866835 11:6229406-6229428 TAGGATCAGGAGAAGGAAGCAGG - Intronic
1079604088 11:22343586-22343608 CAGCCACAGCAGAGGGAAGGAGG - Intronic
1079786538 11:24680276-24680298 CAGAAGCAGCACAGGGAAGCTGG - Intronic
1080110400 11:28560375-28560397 TAGAGTCAGCAAAGGCAAACAGG - Intergenic
1080572973 11:33573288-33573310 TAAACTCTGAAGAGGGAAGAAGG - Intronic
1081261706 11:40970090-40970112 TAGAGTCAGCAGGGGTCAGCTGG - Intronic
1081550064 11:44102644-44102666 TGGCCTCAGCAGAAGGAAGAGGG - Intronic
1082752807 11:57038807-57038829 AAGACTCAGCAGGGGGTAGAGGG + Intergenic
1082790948 11:57346479-57346501 TAGACCCAGCAGACAGAAGCTGG - Intronic
1083039137 11:59669126-59669148 TAGTCTCAGCGGCGGGAAGGAGG + Intergenic
1083897209 11:65625862-65625884 GAGACTCAGCTGATGGGAGCAGG - Intronic
1084546359 11:69817043-69817065 TGGAGCCCGCAGAGGGAAGCTGG + Intronic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1086018851 11:82200875-82200897 TAGACTTAGCAGAGGGCATAAGG + Intergenic
1089877743 11:121741982-121742004 TAGATTCAGCAGAGGAATGGGGG - Intergenic
1090597370 11:128334552-128334574 TAGCCACAACAGAGGGTAGCAGG - Intergenic
1091929155 12:4380704-4380726 TATACTCAGTACAGGGAAACTGG - Intergenic
1092859286 12:12706037-12706059 TAGTCTAAGCAGAGGGTAGATGG - Intergenic
1093690364 12:22102497-22102519 TAGCCTCAGCAGAGGGTAGTTGG + Intronic
1094334899 12:29338530-29338552 CCTACTCAGCAGATGGAAGCAGG + Exonic
1096737028 12:53663688-53663710 GAAACTGAGAAGAGGGAAGCAGG + Intronic
1101369103 12:104108505-104108527 TAATCTCAGCAGAGGGGATCTGG + Intergenic
1101583850 12:106067358-106067380 AAGACCCAGCAGAGAGAATCAGG - Exonic
1102986520 12:117282943-117282965 TACACTGTGCTGAGGGAAGCAGG - Intronic
1103357632 12:120333238-120333260 AACACTCAGCAGATGGTAGCTGG - Intergenic
1104877911 12:132049321-132049343 AAGAGTAAGCAAAGGGAAGCAGG - Intronic
1104954713 12:132458576-132458598 TGGACCCAGCAGAGTGCAGCCGG - Intergenic
1106812916 13:33377847-33377869 TACACCCAGCAGAGGAAAACAGG + Intergenic
1108738995 13:53315146-53315168 GAGACTCAGAAGAGGGAGGGTGG + Intergenic
1108810639 13:54219478-54219500 TGGAGTCTGCAGAGGCAAGCAGG - Intergenic
1109781836 13:67121083-67121105 ATGACTCAGCATAGAGAAGCGGG + Intronic
1111092981 13:83471910-83471932 TAGAGTAAGCAGAGGGCAGAAGG - Intergenic
1111459400 13:88519910-88519932 TACACACAGCAGAGGGACCCTGG - Intergenic
1113460063 13:110476072-110476094 TGGCCTCAGCAGGGGGCAGCAGG - Intronic
1113509467 13:110841489-110841511 TAGAAGCTGCAGAGGGAAGATGG - Intergenic
1116133602 14:40891756-40891778 TACACACAGCAGAGGGACCCTGG + Intergenic
1117066184 14:52015014-52015036 TAGATACAGCTGAGGGGAGCGGG + Intronic
1117366958 14:55038621-55038643 CAGACACAGCAGAGGGTAGAGGG - Intronic
1119050100 14:71358774-71358796 TAGTCATGGCAGAGGGAAGCAGG + Intronic
1120284495 14:82481286-82481308 TAGGCTCAGCAGAGAGAATCTGG - Intergenic
1120858271 14:89231808-89231830 AAGACCAAGCAGATGGAAGCAGG + Intronic
1121114733 14:91335622-91335644 TAGCCTCTGGGGAGGGAAGCAGG - Intronic
1121958819 14:98239986-98240008 TAGACTCAGCACATGGAACCAGG + Intergenic
1122040312 14:98983153-98983175 TACAGACAGCTGAGGGAAGCTGG - Intergenic
1122714533 14:103687137-103687159 TAGACGCAGCAGTGAGAAGCTGG + Intergenic
1123877593 15:24639531-24639553 TAGAGTCTACAGAGGCAAGCAGG + Intergenic
1124492171 15:30164723-30164745 CAGCCTCAGCCGAGGGAAGGGGG - Intergenic
1124751365 15:32373594-32373616 CAGCCTCAGCCGAGGGAAGGGGG + Intergenic
1126715863 15:51516792-51516814 GAGACTCAGAAGAGGGAGGGTGG - Intronic
1126851849 15:52801871-52801893 TAGAGTCTGCAGAGGGAGGCGGG - Intergenic
1127449525 15:59103274-59103296 GAGACTCAGAAGAGGGAGGGTGG - Intergenic
1127918437 15:63474321-63474343 TTGACTAAGCAGATGAAAGCAGG - Intergenic
1128608975 15:69058765-69058787 CAGACTCAACAGAGGGAAAGAGG - Intronic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1129519331 15:76176164-76176186 TGGGCTCAGCAGAGGCAAGGGGG + Intronic
1133755333 16:8758406-8758428 TGGTCTCAGCAGAGAGAAGAGGG + Intronic
1134589640 16:15442032-15442054 AAGACTTAGGAGAGGGAGGCCGG + Intronic
1141047995 16:80734532-80734554 GAAACTCAGAATAGGGAAGCAGG + Intronic
1141177912 16:81732840-81732862 GAGACCCAGCAGGGGGCAGCGGG - Intergenic
1141458260 16:84159198-84159220 GGCACTCAGCAGAGGTAAGCGGG + Intronic
1141811879 16:86381393-86381415 TGGGCTCAGCAGTGGGCAGCGGG - Intergenic
1142980303 17:3667771-3667793 TAGACTAGGCAGAGGGAGGAAGG - Intronic
1143714652 17:8758216-8758238 TTGACTGAGGAGAGGGAAGGGGG - Intronic
1143942610 17:10558253-10558275 CAGACTCATCAGGGGGTAGCTGG + Intergenic
1145112566 17:20176684-20176706 TATACTCTGAAGAGGGAAGAAGG - Intronic
1145378196 17:22371139-22371161 TACACACAGCACAGGGAACCCGG + Intergenic
1146447302 17:32942615-32942637 TGGAGTCAGGAGAGGGAAGCTGG + Exonic
1146676520 17:34777097-34777119 TACACTGAGCAGAGAGAGGCAGG - Intergenic
1146977895 17:37131348-37131370 CTGACCCAGCAGATGGAAGCCGG + Intronic
1149356039 17:55840308-55840330 TAGATTCCCCAGAGGGAAGATGG + Intronic
1149684657 17:58528426-58528448 TAGAACCAGCAGATGGAGGCTGG + Intronic
1151404104 17:73875800-73875822 GAGCCACAGGAGAGGGAAGCAGG - Intergenic
1152340173 17:79720079-79720101 TGGGCTCAGCCGAGGGAAGAGGG + Intergenic
1152410221 17:80119347-80119369 TAGTCTCTCCAGAGGGAGGCTGG + Intergenic
1154326189 18:13392488-13392510 TCCTCTGAGCAGAGGGAAGCAGG + Intronic
1155426284 18:25710976-25710998 AAGACTCAGGAAAGGGAAGGGGG + Intergenic
1156892873 18:42209861-42209883 TCAACTGAGCAGAGGGAATCAGG - Intergenic
1157517543 18:48321487-48321509 TAGAATCAGCCTGGGGAAGCTGG - Intronic
1161487209 19:4542885-4542907 CCCACTCTGCAGAGGGAAGCGGG - Exonic
1161632070 19:5362548-5362570 GAGGCTCAGGAGAGGAAAGCGGG + Intergenic
1161848427 19:6725688-6725710 TACACTCAGCAGAAACAAGCTGG + Intronic
1163229299 19:15989307-15989329 GAGACTCAGAAGAGGGAAGGTGG - Intergenic
1164100513 19:22050860-22050882 TAGAAAGAGCAGAGGGCAGCAGG - Intergenic
1165201602 19:34149350-34149372 GATACTCAGCAGACTGAAGCAGG + Intergenic
1167472387 19:49682544-49682566 TAAACTCAGAGGAGGGCAGCTGG - Intronic
1167527347 19:49993220-49993242 CAAACTCAGCAGAGGGAAAAGGG + Intronic
1167721670 19:51184132-51184154 AGGACTGAGCAGAGGGATGCGGG - Intergenic
1167767506 19:51493440-51493462 TATAGTCAGCAGAGGGGAGAGGG - Intronic
1168165933 19:54547863-54547885 TAGACTCAGGAGACTGAGGCAGG - Intergenic
1168494009 19:56835429-56835451 TAGTCTCAGCAGAGGGGATAGGG - Intronic
1168720309 19:58551120-58551142 TGGACTCAGCAAAGGGAGACAGG - Intergenic
924981230 2:223376-223398 GAGACAGAGCTGAGGGAAGCTGG - Intronic
925440234 2:3879356-3879378 ATGAGTCTGCAGAGGGAAGCCGG + Intergenic
925498947 2:4483270-4483292 TGTACACAGCAGAGGGAACCTGG - Intergenic
929295677 2:40243848-40243870 TAGACTCATCAGAGGGAAGGAGG - Intronic
930225684 2:48790194-48790216 CAGACACAGCAGATGGAAGAAGG + Intergenic
930259874 2:49133174-49133196 TAGCCTCAGCAACGGGCAGCTGG - Intronic
932337525 2:70939401-70939423 TTGACCCTGGAGAGGGAAGCGGG - Exonic
934474538 2:94585736-94585758 TAGAATCTGCAGAGGGAGGCCGG + Intergenic
935681025 2:105637038-105637060 AAGGCGCAGCAGAGGGGAGCAGG + Intergenic
935854311 2:107258148-107258170 TTGACCCAGGAGTGGGAAGCAGG + Intergenic
936329486 2:111535479-111535501 TAAACTCTGCAGAAAGAAGCTGG + Intergenic
936433096 2:112481634-112481656 TAGACTCTGCTGGTGGAAGCAGG - Intergenic
938165118 2:129019355-129019377 GAGAGTCAGCAGAGAGAAGGGGG + Intergenic
941706511 2:168664241-168664263 TAGTCTCCTCAGAGGCAAGCAGG + Intronic
941801531 2:169665056-169665078 TGGACAAAGCAGAGGGAAGTGGG + Intronic
942062275 2:172238864-172238886 TAGACTCAGATGAAGGAAGGGGG + Intergenic
942419942 2:175797279-175797301 TGCACACAGCAGAGGGACGCTGG - Intergenic
944202498 2:197122462-197122484 TACACTAAGCAGAGGAAAACTGG - Intronic
944800137 2:203231042-203231064 TACACACAGCAGAGGGACCCTGG - Intergenic
946014444 2:216592743-216592765 TTGACTCAAGGGAGGGAAGCAGG - Intergenic
1169044510 20:2524989-2525011 AAGCCTCAGGAGCGGGAAGCCGG - Intergenic
1170071507 20:12374152-12374174 AAGACTGAGAAGAGAGAAGCGGG - Intergenic
1171388870 20:24788185-24788207 GAGACTCAGAAGGGGGAGGCTGG - Intergenic
1173092468 20:39986277-39986299 TAGAAACAGGAGAGGCAAGCGGG - Intergenic
1173501697 20:43558647-43558669 ATGACTCAGCGGAGGGAATCAGG + Intronic
1174269057 20:49353735-49353757 TTGCCTCTGCAGAGGGAAACTGG + Intergenic
1175225107 20:57440039-57440061 TATTCTGAGCAGCGGGAAGCTGG - Intergenic
1175588101 20:60162408-60162430 TAGACCCAGCAGGGGCAAGTGGG - Intergenic
1176517570 21:7797500-7797522 TCCACACAGCATAGGGAAGCAGG - Intergenic
1178186162 21:30223600-30223622 AACATTCAGCAGAGGTAAGCTGG + Intergenic
1178651598 21:34427512-34427534 TCCACACAGCATAGGGAAGCAGG - Intergenic
1178925788 21:36773814-36773836 TGAACTAAGCAGAGGGCAGCAGG - Intronic
1179615905 21:42583447-42583469 TTGACTCAGCAGAGCACAGCTGG + Intergenic
1182182330 22:28363183-28363205 TATACACAGCAGAGGGACCCTGG - Intronic
1182462462 22:30492194-30492216 GAGACTCAACAGAGGGCAGAGGG + Intronic
1182467430 22:30525971-30525993 GAGACTCAACAGAGGGCAGAGGG + Intronic
1182936037 22:34222597-34222619 TGGATTCAGAAGAGGGAATCTGG + Intergenic
1184878189 22:47288761-47288783 TAGACTCACAAGAGGGACTCTGG - Intergenic
1185074418 22:48675671-48675693 TGGAGACTGCAGAGGGAAGCCGG - Intronic
949262644 3:2120162-2120184 TAGACTAAGCTGAGTGAAGGGGG + Intronic
949357120 3:3192817-3192839 TAAACTCAGAAGCTGGAAGCAGG - Intergenic
950464832 3:13147317-13147339 CAGACTCAGAAGAGGGAGGGTGG - Intergenic
951578555 3:24138140-24138162 AGGACTCAGCAGAGGTCAGCTGG - Intronic
953195402 3:40727515-40727537 GAGACTCAGAAGAGGGAAGGTGG - Intergenic
953481571 3:43256684-43256706 CTGACCCAGCAGAGGGGAGCAGG + Intergenic
954080045 3:48208194-48208216 CAGACTCTGCTGAGAGAAGCTGG + Intergenic
954333096 3:49901189-49901211 TGTACTCAGCAGAGGGAGGGAGG + Intronic
955668119 3:61371741-61371763 TAGCCTGAGCAGATGGAAGTGGG - Intergenic
955750361 3:62180346-62180368 TTGTCTCAGCAGTGGGAAGCAGG + Intronic
956039585 3:65132031-65132053 TAGAGCCAACAGAGGGAAGGAGG - Intergenic
956778713 3:72587711-72587733 TGGAGGGAGCAGAGGGAAGCAGG + Intergenic
959103508 3:102040451-102040473 TGGAGTCTGCAGAGGCAAGCAGG - Intergenic
960104256 3:113776881-113776903 AAGACACTGCAGAGGGTAGCGGG - Intronic
960239795 3:115326996-115327018 TAGACTCATCTTAGGGTAGCTGG - Intergenic
961931999 3:130544539-130544561 TATACCCAGAAGAGGGATGCAGG + Intergenic
962475485 3:135751641-135751663 GAAACTCAGCAGAGAAAAGCAGG + Intergenic
962609637 3:137063659-137063681 TACACTCAGCAGAGGGAATTAGG + Intergenic
964089552 3:152858169-152858191 AAGACTCAGCTGAGGAAACCAGG + Intergenic
966676530 3:182596028-182596050 TAGTCACAGAAGAGAGAAGCCGG - Intergenic
968403017 4:315056-315078 TGCACACAGCAGAGGGACGCTGG + Intergenic
968605184 4:1532064-1532086 GAGAGTCAGCAGAGTGGAGCAGG - Intergenic
968797028 4:2713719-2713741 AACACTCAGCAGAGGCAAGCGGG - Intronic
969970054 4:11037609-11037631 TTGAATCAGAAGAGGGAAGCAGG + Intergenic
970550592 4:17177188-17177210 CAAACTGAGCAGAGGGAGGCAGG + Intergenic
971875300 4:32300861-32300883 TAGACACAGCAGAGGGACCCTGG - Intergenic
971880644 4:32366089-32366111 TAAACAAAGCAGCGGGAAGCTGG - Intergenic
972471735 4:39412051-39412073 GAGACTCAGAACAGGGAAGCTGG + Intronic
973229769 4:47827989-47828011 AAGACTGATCAGAGGAAAGCTGG - Intronic
976204764 4:82614322-82614344 GAGATTCATCAGAGGGAAGGTGG - Intergenic
977080666 4:92523707-92523729 CAGGTTCAGCAGAGGGACGCAGG + Intronic
977118029 4:93057703-93057725 TAGCCTCAGAAGTGGGAAACGGG + Intronic
977398258 4:96498665-96498687 TAGAAAGAGCAGAGGGAAGGAGG + Intergenic
978276758 4:106960410-106960432 GAGACTCAGAAGAGGGGAGCTGG + Intronic
978756587 4:112309347-112309369 TAGAGTCTGCAGAGGCAGGCAGG + Intronic
978813796 4:112879847-112879869 GAGACACAGAAGAAGGAAGCAGG - Intronic
980803157 4:137779324-137779346 GAGACTCAGAAGAGGGAGGCAGG - Intergenic
981028517 4:140100237-140100259 TTGAGTCAGCAGAGGAAATCCGG - Intronic
982647073 4:158037512-158037534 TAGACTCTGCACAGGGAGGGTGG - Intergenic
983509602 4:168593301-168593323 CAGATCCAGCAGAGAGAAGCTGG - Intronic
984918911 4:184747162-184747184 TGGACTCAGCAGATGGCACCTGG + Intergenic
986204843 5:5613855-5613877 AAGACCCAGCACAGGAAAGCTGG + Intergenic
986333686 5:6736915-6736937 CAGTCTCAGCAGAGAGAAACAGG - Intronic
986782454 5:11079289-11079311 GAGGCTCAGCAGAAGGGAGCTGG - Intronic
987293712 5:16531739-16531761 TAGACAGAGCAGAGTGGAGCAGG + Intronic
987508373 5:18801527-18801549 AAGACTCAGAAGAGGGGAGGGGG - Intergenic
987567092 5:19603343-19603365 GAGACTCAGGAGAGGGAAAATGG + Intronic
987916358 5:24220004-24220026 TAGACTCAGAAGAGGGAGGATGG - Intergenic
988379453 5:30481259-30481281 TGGACACAGCAGAGGGGACCTGG + Intergenic
988851044 5:35181169-35181191 TAAAGTCAGCAGAGGTTAGCTGG - Intronic
990052975 5:51531000-51531022 TAGCTTCAGCAAAGGGTAGCTGG - Intergenic
990592581 5:57281418-57281440 TAGAAGCAGAAGAGGGAGGCAGG + Intergenic
990624739 5:57598304-57598326 TAGACTAAGCAGAAGCTAGCAGG + Intergenic
991437158 5:66608788-66608810 TAGAAGCAGCAGGGGAAAGCGGG + Intronic
991450264 5:66743673-66743695 GAGACTCAGCCCAGGGAAACAGG + Intronic
991734413 5:69618658-69618680 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991780565 5:70128067-70128089 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
991810847 5:70473793-70473815 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991859853 5:71003490-71003512 TAGGGGCAGCAGAGGGAAGCTGG + Intronic
991873013 5:71128386-71128408 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
992461133 5:76961335-76961357 CAGACTCAGGAGAGAGAAGTAGG - Intronic
994082573 5:95723792-95723814 TAGAGACAGCACAGTGAAGCTGG - Intronic
996400689 5:123059038-123059060 AAGACTCAGAAGAGGGAGGGTGG + Intergenic
996785357 5:127231108-127231130 TAAACTCAGGAGAGAGAAGGGGG - Intergenic
997832196 5:137159491-137159513 GAGACTCAGAAGTGGGAGGCTGG - Intronic
999154876 5:149450916-149450938 CAGACCCAGCAGAAGGAAGAGGG - Intergenic
999692758 5:154162935-154162957 AAGGCTCAGGGGAGGGAAGCGGG - Intronic
1002159927 5:177309059-177309081 AAGACACAGCAGAGGGAGCCTGG + Intronic
1002853812 6:1020426-1020448 GAGACACAGCTGAGGGAGGCAGG + Intergenic
1004407932 6:15351870-15351892 TGTCATCAGCAGAGGGAAGCGGG - Intronic
1005111285 6:22284762-22284784 TACAGTCAGCAAAGGGTAGCAGG - Intergenic
1005298503 6:24449243-24449265 TTGAGTCTGCAGAGGGCAGCTGG + Intronic
1006028706 6:31163615-31163637 TGGACACAGCAGAGGGCAACTGG + Exonic
1006137452 6:31903854-31903876 TAGATTCAACAGAGGGAACTGGG - Intronic
1006609718 6:35287004-35287026 TAGACTTAGCTGGGGGAAGAGGG + Intronic
1007453835 6:41960978-41961000 TCCCCTCAGCAGAGGGAAGCTGG + Intronic
1007735353 6:43978881-43978903 TAGCATCAGAAGAGGAAAGCAGG + Intergenic
1008564234 6:52751574-52751596 CACCTTCAGCAGAGGGAAGCTGG + Exonic
1008568548 6:52792853-52792875 CACCTTCAGCAGAGGGAAGCTGG + Exonic
1008573003 6:52832856-52832878 CACCTTCAGCAGAGGGAAGCTGG + Exonic
1008577382 6:52874066-52874088 CACCTTCAGCAGAGGGAAGCTGG + Intronic
1008675015 6:53810038-53810060 TTGACTCTGTAGCGGGAAGCAGG + Intronic
1009059845 6:58385753-58385775 GAGACACAGCAGATAGAAGCAGG + Intergenic
1009231067 6:61061641-61061663 GAGACACAGCAGATAGAAGCAGG - Intergenic
1012442226 6:99271228-99271250 AGGACTCATCAGAGGGAAGAGGG - Exonic
1013830083 6:114261418-114261440 TAGATGCATGAGAGGGAAGCTGG + Intronic
1013980053 6:116120138-116120160 TTGACTCGGCATTGGGAAGCTGG + Exonic
1014314189 6:119842725-119842747 TACACTCTGTAGAGGGAAGGAGG - Intergenic
1014468164 6:121781984-121782006 TAGCGTCAGCAAAGAGAAGCTGG + Intergenic
1015264980 6:131281766-131281788 TAGACTCAGCAGAGGGAAGCAGG - Exonic
1015292016 6:131548003-131548025 TGGAGTCACCAGAGGGATGCAGG - Intergenic
1015636267 6:135277804-135277826 GAGACTCAGAAGGGGGAAGGTGG + Intergenic
1016878349 6:148885772-148885794 TGGACTAAGAAGGGGGAAGCAGG - Intronic
1017600049 6:156070437-156070459 TAGAGTCTGCAGAGGAAAGCAGG - Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018573472 6:165234107-165234129 TAGACTGAGCAGAGGGATGCTGG - Intergenic
1018964564 6:168474374-168474396 TGGAATCAGCAAAGGGCAGCAGG - Intronic
1019328421 7:451018-451040 CAGACTCAGCAGAGGCAGGAAGG - Intergenic
1020408811 7:7867625-7867647 CAGACTCAGTAGAGGGGTGCAGG + Intronic
1024113386 7:46169839-46169861 TAGGATCAGCGGAGGGAAGGAGG + Intergenic
1024933726 7:54690976-54690998 TAGAACCAACAGAGGGGAGCAGG + Intergenic
1025777735 7:64573890-64573912 TAGAAAGAGCAGAGGGCAGCCGG - Intergenic
1027226219 7:76245258-76245280 TTGAAGGAGCAGAGGGAAGCAGG + Intronic
1027331710 7:77103136-77103158 TACAGTCAGAAGAGGGAAGAGGG + Intergenic
1027560656 7:79724847-79724869 TAGACTCTGAAGAGAAAAGCAGG + Intergenic
1029784061 7:102768199-102768221 TACAGTCAGAAGAGGGAAGAGGG - Intronic
1030267094 7:107631789-107631811 TGGACTCGGCAGAGGGAGGCAGG - Intergenic
1030333275 7:108295914-108295936 TATACAAAGCAGAGGGAAGTGGG - Intronic
1030868287 7:114726570-114726592 TACACTCAGTAGGGGAAAGCTGG - Intergenic
1031556188 7:123179653-123179675 TAGAAACATTAGAGGGAAGCAGG - Intronic
1032865182 7:135917698-135917720 CATCCTCAGGAGAGGGAAGCAGG + Intergenic
1032877496 7:136053238-136053260 TAGACTCAGCAGTGTGGAGTGGG - Intergenic
1033164391 7:139027084-139027106 TAGACACAGCATAGGGTAGAAGG + Intronic
1033583071 7:142753980-142754002 TGGATGCAGCAGAGGGAGGCAGG + Intronic
1033584620 7:142764884-142764906 TGGATGCAGCAGAGGGAGGCAGG + Intergenic
1033586095 7:142775452-142775474 TGGACACAGCAGAGGGAGGCAGG + Intergenic
1034766176 7:153723530-153723552 TTGACTCAGTAAAGGTAAGCGGG - Intergenic
1037754665 8:21703113-21703135 GAGGTTCAGCAGAGGGAATCTGG - Intronic
1040416592 8:47201173-47201195 CAGACTCAGGGGAGGGGAGCAGG + Intergenic
1040745262 8:50634356-50634378 AAGTCTCAGCAGAGGGCATCCGG - Intronic
1043469157 8:80544835-80544857 GAAAGTGAGCAGAGGGAAGCTGG + Intergenic
1044053944 8:87544233-87544255 TAGTGTCAGTGGAGGGAAGCTGG - Intronic
1044722043 8:95160184-95160206 GAGCCTCAGCAGAGGGAATGGGG - Intergenic
1046004651 8:108464394-108464416 TGGACTCAGTGGAGGGAGGCAGG + Intronic
1047889186 8:129288461-129288483 AAGACTCAGAAGAGGGAGGGTGG + Intergenic
1048617272 8:136090951-136090973 GAGACACGGCACAGGGAAGCAGG - Intergenic
1050119074 9:2289377-2289399 GGGCATCAGCAGAGGGAAGCAGG + Intergenic
1052855516 9:33404014-33404036 TAGAATCTGCAGAGGGAGGCCGG - Intergenic
1053509142 9:38672526-38672548 CAGACCCAGCAGGGGGCAGCAGG - Intergenic
1053683528 9:40500366-40500388 TAGAATCTGCAGAGGGAGGCCGG - Intergenic
1053705429 9:40748406-40748428 TAGTGTCAGGAGAAGGAAGCTGG + Intergenic
1053933510 9:43128684-43128706 TAGAATCTGCAGAGGGAGGCCGG - Intergenic
1053933554 9:43129164-43129186 TAGATTAAGCAGAGGTTAGCTGG - Intergenic
1054280187 9:63124555-63124577 TAGAATCTGCAGAGGGAGGCCGG + Intergenic
1054296632 9:63335863-63335885 TAGAATCTGCAGAGGGAGGCCGG - Intergenic
1054394649 9:64640369-64640391 TAGAATCTGCAGAGGGAGGCCGG - Intergenic
1054415504 9:64872013-64872035 TAGTGTCAGGAGAAGGAAGCTGG + Intergenic
1054429297 9:65145569-65145591 TAGAATCTGCAGAGGGAGGCCGG - Intergenic
1054501086 9:65875962-65875984 TAGAATCTGCAGAGGGAGGCCGG + Intergenic
1055646519 9:78366817-78366839 TAAACTCTGCAGAGGGCAGGGGG + Intergenic
1055897816 9:81199586-81199608 TAGACGCAGGAGAGTGGAGCAGG + Intergenic
1056617029 9:88177601-88177623 TAGTCTCAATAGAGGGAAGAAGG + Intergenic
1056618267 9:88187424-88187446 TAGAGTCTGGAGAGGGAGGCTGG - Intergenic
1056756006 9:89382543-89382565 AATACACAGCAGAGGGAACCTGG + Intronic
1057357054 9:94340625-94340647 TGAACCCAGCAGAGAGAAGCGGG + Intergenic
1057650698 9:96917002-96917024 TGAACCCAGCAGAGAGAAGCGGG - Intronic
1058814510 9:108670914-108670936 TTGTCTCAGAAAAGGGAAGCAGG - Intergenic
1059368629 9:113807173-113807195 TAGACTGGTCAGAGGGAAGTGGG - Intergenic
1059651627 9:116320845-116320867 TAGAGGCATAAGAGGGAAGCAGG + Intronic
1061298035 9:129687543-129687565 TTGAGTGTGCAGAGGGAAGCCGG - Intronic
1061817635 9:133206269-133206291 CAGACACAGCAGAGGGACACAGG + Intronic
1186184052 X:7002763-7002785 GGAACTCATCAGAGGGAAGCCGG + Intergenic
1186453303 X:9691137-9691159 TAGAATCATCAGAGGTAGGCCGG + Intronic
1187527628 X:20068513-20068535 TAGAGTCAGAAGGTGGAAGCTGG - Intronic
1188794245 X:34442238-34442260 TGCACACAGCACAGGGAAGCTGG + Intergenic
1192789303 X:74365674-74365696 TACAGGCAGCAGAGGGAACCTGG + Intergenic
1192832671 X:74767161-74767183 TAGGCCCAGCAGAGGGTGGCTGG + Intronic
1193992355 X:88323609-88323631 TAGTATCAGAAGAGGGAAGGTGG - Intergenic
1195615069 X:106905674-106905696 GAGAATCAGCAGAAGGAAGGAGG + Intronic
1195960289 X:110378934-110378956 CAGACGCAGCAGTGGGCAGCAGG - Intronic
1198131456 X:133699518-133699540 TAAATTCACCAGAGAGAAGCTGG - Intronic
1198209296 X:134501756-134501778 GAGGTTCAGCAGTGGGAAGCTGG - Intronic
1199600859 X:149540368-149540390 GAGAATCAGCAGGGGGAGGCAGG - Intronic