ID: 1015284451

View in Genome Browser
Species Human (GRCh38)
Location 6:131469352-131469374
Sequence CAGGAAATGATCTCAGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 257}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015284451_1015284454 2 Left 1015284451 6:131469352-131469374 CCAGGAGCTGAGATCATTTCCTG 0: 1
1: 0
2: 2
3: 27
4: 257
Right 1015284454 6:131469377-131469399 ATGTGTGAAGGAAAATAATCTGG 0: 1
1: 1
2: 3
3: 34
4: 372
1015284451_1015284456 15 Left 1015284451 6:131469352-131469374 CCAGGAGCTGAGATCATTTCCTG 0: 1
1: 0
2: 2
3: 27
4: 257
Right 1015284456 6:131469390-131469412 AATAATCTGGAAAAGAAGGAAGG 0: 1
1: 0
2: 2
3: 71
4: 651
1015284451_1015284452 -10 Left 1015284451 6:131469352-131469374 CCAGGAGCTGAGATCATTTCCTG 0: 1
1: 0
2: 2
3: 27
4: 257
Right 1015284452 6:131469365-131469387 TCATTTCCTGAAATGTGTGAAGG 0: 1
1: 1
2: 0
3: 34
4: 330
1015284451_1015284457 27 Left 1015284451 6:131469352-131469374 CCAGGAGCTGAGATCATTTCCTG 0: 1
1: 0
2: 2
3: 27
4: 257
Right 1015284457 6:131469402-131469424 AAGAAGGAAGGCAAAGAGAAAGG 0: 1
1: 17
2: 114
3: 669
4: 5033
1015284451_1015284455 11 Left 1015284451 6:131469352-131469374 CCAGGAGCTGAGATCATTTCCTG 0: 1
1: 0
2: 2
3: 27
4: 257
Right 1015284455 6:131469386-131469408 GGAAAATAATCTGGAAAAGAAGG 0: 1
1: 0
2: 8
3: 84
4: 625

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015284451 Original CRISPR CAGGAAATGATCTCAGCTCC TGG (reversed) Intergenic
901441650 1:9281824-9281846 CAGGAGATCCTCTCAGCTCCTGG - Intergenic
903884072 1:26530969-26530991 GAGAAAGTCATCTCAGCTCCTGG - Intronic
904763063 1:32818908-32818930 CTGGAAATAATCTCTGCTCTTGG + Intronic
906790503 1:48654967-48654989 CAGTAATTGACCCCAGCTCCCGG + Intronic
907661593 1:56398047-56398069 CAGAAAATGATCTTGGCACCAGG - Intergenic
907678275 1:56538748-56538770 TAGGAAGTTATCTCAGCTCTTGG - Intronic
910193603 1:84619473-84619495 CAGGGAACGTTCTCTGCTCCTGG + Intergenic
910448231 1:87320339-87320361 CAGGGACCGCTCTCAGCTCCTGG + Intergenic
913613992 1:120538004-120538026 CAGGAAAAGGTGTCAGCTCATGG + Intergenic
914576275 1:148972889-148972911 CAGGAAAAGGTGTCAGCTCATGG - Intronic
915384168 1:155474294-155474316 GAGGAAATGCTCTTATCTCCAGG + Intronic
915978540 1:160406393-160406415 CAGAGAACGATCTCATCTCCAGG + Intronic
917731997 1:177883626-177883648 CACCAAATGATCTCTGCTTCTGG - Intergenic
917838276 1:178957891-178957913 CAGGACATGAGCCCAGCTCCAGG - Intergenic
920102740 1:203528011-203528033 CATGGCATGATCTCAGCTCACGG - Intergenic
920378143 1:205520228-205520250 CAGGAAAACATCTAAGGTCCAGG - Intronic
921262912 1:213399694-213399716 CAGGCAGTTAGCTCAGCTCCTGG - Intergenic
924460507 1:244254562-244254584 CTGGACATGAGCTCAGATCCTGG - Intergenic
924725833 1:246669679-246669701 CAAGAAATGGTACCAGCTCCAGG + Intergenic
1062810681 10:461650-461672 CAGGACTTGAACTCAGCTCTGGG + Intronic
1062999035 10:1897055-1897077 CGGGAAATGATATCAGCACATGG - Intergenic
1063240425 10:4163747-4163769 CAGGTAATGATCGCTGCTCTCGG - Intergenic
1063510211 10:6637398-6637420 CAGGCACTGCTCTTAGCTCCTGG + Intergenic
1063949580 10:11209445-11209467 CAGGACATGATATGAGATCCTGG - Intronic
1064424596 10:15219222-15219244 CATGGCATGATCTCAGCTCATGG - Intronic
1068628194 10:59272026-59272048 CAGGGAAAGATCTCAGTTTCTGG + Intronic
1069879458 10:71582777-71582799 CAGGACATTAGCACAGCTCCTGG - Intronic
1070661888 10:78312609-78312631 AAGGACATGACCTCAGCTACAGG + Intergenic
1071483608 10:86082916-86082938 CAGCTGATGATCTCAGCTCTGGG + Intronic
1073097897 10:100991209-100991231 CAGGAGAGGATGTGAGCTCCTGG - Intronic
1075146097 10:119884373-119884395 CAGGAAAGCCACTCAGCTCCAGG + Intronic
1077236127 11:1482791-1482813 CAGGACATGGCCTCTGCTCCAGG + Intronic
1077353261 11:2102793-2102815 AAGGAACTGACTTCAGCTCCGGG - Intergenic
1078204382 11:9215455-9215477 CAGGAAATAATGTGAGTTCCAGG - Intronic
1078685936 11:13532196-13532218 CAGGACTTGAACTCAGCTCTGGG - Intergenic
1079837499 11:25351659-25351681 CAGGAGATCATCTGGGCTCCGGG + Intergenic
1080262028 11:30359830-30359852 CATGAAAGGATCTCAGCAACAGG - Intergenic
1081917728 11:46744163-46744185 CAGCAAACTCTCTCAGCTCCGGG - Exonic
1082266087 11:50120151-50120173 CAGAAAGTCTTCTCAGCTCCAGG + Intergenic
1082290002 11:50358421-50358443 CAGAAAGTCTTCTCAGCTCCAGG - Intergenic
1082924878 11:58534141-58534163 CAGGACTTGAACTCAGCTCTTGG + Intronic
1084266430 11:68007777-68007799 CAGGCATGGATCTCAGCACCTGG - Intergenic
1085027171 11:73243035-73243057 CAGGGAATGATCTCTACCCCTGG - Intergenic
1085130094 11:74030840-74030862 CAGTAAATGATATCACCTGCCGG + Intronic
1085842940 11:80034268-80034290 CAGGAGTTGACCTCAGCTACTGG - Intergenic
1089882143 11:121784949-121784971 CAGGACTTGAACTCAGCTCTCGG - Intergenic
1093151312 12:15625093-15625115 TAGGAAATGAGATCAGCTCAAGG - Intronic
1093335785 12:17903591-17903613 CAGGACTTGAACTCAGCTCTGGG - Intergenic
1093522759 12:20069392-20069414 CAGGACTTGAACTCAGCTCTGGG + Intergenic
1096756688 12:53805346-53805368 CAGGGAATGATCTTAACTTCAGG - Intergenic
1098674266 12:73268847-73268869 CAGGACCTGAACTCAGCTCTAGG + Intergenic
1100312070 12:93405445-93405467 CATGAAATGAGATCAGCTCAAGG + Exonic
1101774000 12:107777248-107777270 CGGGACTTGATCTCAGCTCAAGG - Intergenic
1101963147 12:109264991-109265013 CTGGGAATGATCTCAGAGCCTGG + Intronic
1102614941 12:114145424-114145446 CAGCTACTGATCTTAGCTCCAGG + Intergenic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1104932584 12:132347650-132347672 CATGAAATGAACTCAGCAGCGGG - Intergenic
1105672438 13:22634571-22634593 CAGGACTTGAACTCAGCTCTGGG - Intergenic
1106040360 13:26084441-26084463 GAGGAAATGATCTGAGCAGCTGG + Intergenic
1106538701 13:30671271-30671293 GGGGAAATGTTCTTAGCTCCTGG - Intergenic
1107243932 13:38269608-38269630 CAGGACTTGAACTCAGCTCTAGG + Intergenic
1107477037 13:40747390-40747412 GAGGAAATTATTTAAGCTCCTGG - Intronic
1107675094 13:42787599-42787621 CAGGAAATGCTTTCAGTTGCTGG + Intronic
1108901235 13:55410904-55410926 CTCTAAATGGTCTCAGCTCCAGG + Intergenic
1109869877 13:68320952-68320974 CAGGAAAAGAAGCCAGCTCCTGG - Intergenic
1111412527 13:87895274-87895296 CAAGAAAGAATCTCAGCTGCAGG + Intergenic
1112388722 13:98963331-98963353 CAGGAAATGTTCTTAGTGCCAGG + Intronic
1115818696 14:37190405-37190427 CAGGACTTGAACTCAGCTCTGGG + Intergenic
1115866920 14:37758204-37758226 CAGGACTTGAACTCAGCTCTGGG - Intronic
1116351458 14:43868849-43868871 AAGGACATGTTCTCAGCACCTGG - Intergenic
1117784906 14:59272883-59272905 CAGAAGATGATCTCACATCCAGG + Intronic
1119640568 14:76311378-76311400 CAGGTAATGATGGGAGCTCCTGG + Intronic
1120068092 14:80069476-80069498 CTGGAAAAGCTCTCAGTTCCAGG - Intergenic
1122291374 14:100682014-100682036 TGGGGAATGAACTCAGCTCCGGG - Intergenic
1124161796 15:27277077-27277099 CAGGCAAGGATGTCAGCCCCTGG - Intronic
1124268451 15:28258412-28258434 AATGACATGATCTCAGCTCACGG - Intronic
1124867480 15:33507369-33507391 CACAAAATGTTCTCTGCTCCAGG - Intronic
1125604868 15:40934491-40934513 CAGGGAATGCACTCACCTCCAGG - Intronic
1126876857 15:53052255-53052277 CAGGACTTGAACTCAGCTCTGGG + Intergenic
1127242982 15:57138954-57138976 AGGTAAATGATCTCAGCTACTGG - Intronic
1127827513 15:62718049-62718071 CAGGAAATGAACCCTGCTCCAGG - Intronic
1127869286 15:63057217-63057239 GAGGAAATGATCCCACCACCAGG - Intronic
1128925197 15:71648955-71648977 CAGAAAATGATGTCACCTGCGGG + Intronic
1129564048 15:76602815-76602837 GAGGAAATAATCTCAGCTTGAGG - Intronic
1130161071 15:81400798-81400820 CTGGAAAACATCTCAGCACCTGG - Intergenic
1130541759 15:84825551-84825573 AAGGAAATCATTTCAGCTACTGG - Intronic
1131455924 15:92582573-92582595 CAAGAAATGATCCCAACTCAGGG - Intergenic
1133459242 16:5972644-5972666 CAGGACATGTTCCCATCTCCTGG - Intergenic
1134219646 16:12343755-12343777 CAGGCACTGATCTGAGCTCTGGG - Intronic
1134654136 16:15934268-15934290 AATGGCATGATCTCAGCTCCGGG - Intergenic
1135589468 16:23694887-23694909 CAGGAAATATTCTCATCACCGGG - Exonic
1137439353 16:48484803-48484825 CAGGTACTGGGCTCAGCTCCAGG - Intergenic
1138103959 16:54277079-54277101 CAGGAAATCTTGTCACCTCCAGG - Intergenic
1139335236 16:66226673-66226695 GGGGAAAGGATCTCAGGTCCAGG - Intergenic
1140845166 16:78879817-78879839 AATGACATGATCTCAGCTCACGG - Intronic
1141281588 16:82634181-82634203 CCGGAAATGAGCTCAGCCTCTGG + Intronic
1142181313 16:88672175-88672197 CAGAAAACAATCACAGCTCCGGG - Intergenic
1147510054 17:41060168-41060190 CAGGAAATGACCTCATGTCCTGG - Intergenic
1147525587 17:41219121-41219143 CAGGACTTGAACTCAGCTCTGGG + Intronic
1147675250 17:42200867-42200889 CAGGCAACAATCTCAGCGCCTGG + Exonic
1147701707 17:42400272-42400294 GAGGAGAGTATCTCAGCTCCAGG - Intergenic
1149093602 17:52814948-52814970 CAGGACTTGAACTCAGCTCTGGG - Intergenic
1149621414 17:58048046-58048068 CTGGAAATGCTCTCAGTCCCTGG - Intergenic
1149642504 17:58212914-58212936 TCAGAAATGGTCTCAGCTCCAGG + Intronic
1150720115 17:67607283-67607305 CAGGAAAGGATGCCAGCCCCAGG + Intronic
1150857287 17:68765298-68765320 CAGGAATTGTTCTCTGCACCTGG - Intergenic
1153596310 18:6729123-6729145 CAGGAAATGTTCCCAGCCACAGG + Intergenic
1153772357 18:8426087-8426109 CAGGGGATGAGCTCAGCTGCTGG - Intergenic
1154358418 18:13640414-13640436 CAGGAAAAGTTCCCATCTCCAGG + Intronic
1156353248 18:36319604-36319626 CAGGACTTGAACTCAGCTCTGGG + Intronic
1157339266 18:46764827-46764849 CTGGACTTGATCCCAGCTCCTGG - Intergenic
1157660622 18:49439050-49439072 CAGTAACTGATCCCATCTCCTGG + Intronic
1158719383 18:59910437-59910459 CTGGAAATGCTCTCATTTCCAGG + Intergenic
1161054675 19:2184403-2184425 CAGGACCTGACCTCAGGTCCGGG - Intronic
1161310680 19:3592468-3592490 CTGGAAACCAGCTCAGCTCCGGG + Exonic
1162284725 19:9729650-9729672 CAGGAAATGATCTGGGTGCCTGG + Intergenic
1163963604 19:20722157-20722179 CAGGACTTGAACTCAGCTCTGGG - Intronic
1167508254 19:49882377-49882399 CAGGAAATGACCTCGAATCCAGG - Exonic
1168385515 19:55959921-55959943 AAGGTAATGACCTCAGCACCTGG - Intronic
925332516 2:3069841-3069863 CATGAAATGAACTGAGTTCCTGG + Intergenic
925460615 2:4059654-4059676 GAGCAAATGAACTCATCTCCTGG + Intergenic
925891645 2:8439477-8439499 CTGAAAATGAGCTCAGCTCCAGG - Intergenic
926181385 2:10647118-10647140 AAGGAAAAGATATCAGCACCTGG + Intronic
928194251 2:29203280-29203302 TATGACATGATCTCAGCTCCAGG + Intronic
928728880 2:34207499-34207521 CAGGACTTGAACTCAGCTCTGGG + Intergenic
929186444 2:39100317-39100339 AAGGAAATGAAATCAGCACCTGG + Intronic
929619873 2:43343573-43343595 CAGTAAATGTTCTAAGTTCCAGG + Intronic
930025143 2:47025133-47025155 CAGGAAATGGGCTGAGCTCCAGG + Intronic
930764749 2:55073869-55073891 CAGAAACTGAGCTCAGGTCCTGG - Intronic
931069303 2:58626572-58626594 CAGGCAGTCATCTCAGCTCCCGG + Intergenic
932420035 2:71596209-71596231 CAGGCAATGAGCTCAGCGCTGGG - Intronic
932646519 2:73508745-73508767 CAGGACTTGAACTCAGCTCAAGG - Intronic
935064130 2:99633465-99633487 CAGGAAAGGAAAACAGCTCCAGG + Intronic
935399687 2:102646932-102646954 CAGGACTTGAACTCAGCTCTGGG + Intronic
936802401 2:116284725-116284747 AAGGAAAGGATCTCACCTTCTGG + Intergenic
936911410 2:117597453-117597475 CTCTAAATTATCTCAGCTCCAGG + Intergenic
936958750 2:118050593-118050615 GAGGAAATGACCTCAGCTTTTGG - Intergenic
941765545 2:169292569-169292591 CAGGAAATGAACTCAGGTGCCGG + Intronic
942314183 2:174682870-174682892 CAGGAAAAGCGCTCAGCGCCGGG + Intronic
945193846 2:207219257-207219279 CAGGAAATGCTCTCAGCTTTAGG + Intergenic
946490691 2:220146282-220146304 TGGGAAATGATCTTAGCTACAGG - Intergenic
1169153931 20:3313228-3313250 CAGCAAATGTTCTTAACTCCTGG + Intronic
1170393958 20:15905893-15905915 TAGGAAATGATTTCATCTCCAGG + Intronic
1170492393 20:16891253-16891275 CAGGACCTGAACTCAGCTCTGGG + Intergenic
1170598652 20:17824048-17824070 CAGGAAATGCTCTCAAGTTCAGG - Intergenic
1170625311 20:18025810-18025832 CAGTGACTGACCTCAGCTCCTGG - Intronic
1170756369 20:19210543-19210565 TTGGAAATTATCTCAGCACCAGG - Intergenic
1171411536 20:24951423-24951445 CCAGAAATGATCACAGCGCCTGG - Intronic
1172427309 20:34863825-34863847 CAGGAAGTGTTCTCAGCCCTGGG - Intronic
1174764121 20:53235468-53235490 CAGGATATGAACTCAAGTCCTGG - Intronic
1175054800 20:56188524-56188546 CAGGAAATGATTTGAGGTTCTGG - Intergenic
1177042422 21:16130725-16130747 CAGGACTTGAACTCAGCTCTGGG - Intergenic
1178811232 21:35883468-35883490 CAGGACCTGAACTCAGCTCTGGG + Intronic
1179958268 21:44753151-44753173 AAGGAAATGATTGCATCTCCAGG + Intergenic
1180176938 21:46095445-46095467 CAGGAAATTAGCTCAAGTCCAGG + Intergenic
1181922273 22:26329556-26329578 CAAGAAACCATGTCAGCTCCAGG - Intronic
1182731839 22:32502326-32502348 CAGGCAATGAGCTCTGCTCCAGG + Intergenic
1183716577 22:39536709-39536731 CATGAAATGTGCTCAGCACCAGG + Intergenic
1184244234 22:43227808-43227830 CAGGGAATGAGCACTGCTCCAGG + Intronic
1184896540 22:47410425-47410447 CAGGTAATGATGTGAGCTCATGG + Intergenic
949222445 3:1652102-1652124 CAGGACTTGAACTCAGCTCTGGG - Intergenic
949356645 3:3187980-3188002 CAGGAATGGATCTCAGGTCCAGG - Intergenic
949941430 3:9157876-9157898 CAGGAAAAGTTTTCAGCTCGAGG + Intronic
951336936 3:21434786-21434808 CAGAAAAAGATCTCAGATGCAGG + Intronic
951631482 3:24726082-24726104 CTGGGCATGATCTCAGCTTCAGG + Intergenic
951789716 3:26466629-26466651 CAGGACTTGAACTCAGCTCTGGG + Intergenic
952503471 3:33986701-33986723 CAGGACTTGAACTCAGCTCTGGG - Intergenic
954177663 3:48857294-48857316 CTGAAGAAGATCTCAGCTCCTGG + Exonic
954574159 3:51665909-51665931 CAGGGAATGGTTTCAGTTCCCGG - Exonic
959353209 3:105294917-105294939 CAGGAAATCCTTTCAACTCCTGG + Intergenic
960166218 3:114404738-114404760 CAGGATATGATATAAGCTCCGGG - Intronic
961082175 3:124035603-124035625 CAGGAACTGAGCTCTGCTACGGG - Intergenic
961266294 3:125645642-125645664 CAGAAAATGATCTTGGCTCTGGG + Intergenic
961755333 3:129123555-129123577 CAGGAAATAACCTCCACTCCAGG + Intronic
961818846 3:129565013-129565035 CAGGAGATGAAATCAGCCCCTGG - Intronic
962413930 3:135165695-135165717 TTGGAAATCATCTCTGCTCCAGG + Intronic
963416029 3:144996791-144996813 CAGGACTTGAACTCAGCTCTGGG - Intergenic
964081567 3:152764881-152764903 CAGGACTTGAACTCAGCTCTGGG + Intergenic
964292809 3:155200088-155200110 CAGAAAATTATCTCAGGTTCTGG - Intergenic
966251335 3:177868304-177868326 CAGGACTTGAACTCAGCTCTGGG + Intergenic
966449444 3:180041213-180041235 AGGGAAATGAACTCAGCTCCAGG + Intergenic
966807511 3:183818607-183818629 GAGGAAATGCCCTCAGCACCGGG + Intronic
967200617 3:187069463-187069485 CAGGAAATGGCCTGAGGTCCAGG + Intronic
970422678 4:15919953-15919975 CAGGAAATGATCTCTGTCTCTGG - Intergenic
970556692 4:17240964-17240986 CAGGAAATGAGCTAAACTCTGGG + Intergenic
970798785 4:19947202-19947224 CAGGAAATGGTCACACCTCCAGG - Intergenic
970869357 4:20797728-20797750 CAGGGACTGCTCTTAGCTCCTGG - Intronic
972393857 4:38640315-38640337 GATGAAATTATTTCAGCTCCTGG + Intergenic
973573219 4:52261306-52261328 CAGGAAAAGAGCTCAGCTTCGGG - Intergenic
973633306 4:52839364-52839386 CTGGAAATGCTATCAGTTCCTGG + Intergenic
974781179 4:66555646-66555668 CAGTAAATAATTTCAGCTCTGGG + Intergenic
975150898 4:71019842-71019864 CAGTGCATGATCTCAGCTCACGG + Intronic
977592170 4:98839478-98839500 CAGGGACTGCTCTCAGCTCCTGG - Intergenic
977987089 4:103395646-103395668 CAGGACTTGAACTCAGCTCTGGG + Intergenic
978090562 4:104709490-104709512 CAGGACTTGAACTCAGCTCTGGG + Intergenic
978506598 4:109464338-109464360 CTGGGCATGATCTCAGCTCACGG + Intronic
981231310 4:142359054-142359076 CAGGAAATGATCCCAGCCTGTGG + Intronic
981260754 4:142715853-142715875 CTTCAAATGGTCTCAGCTCCTGG - Intronic
981855538 4:149286316-149286338 CAAGAAATGATCACAGTTGCAGG + Intergenic
982584872 4:157222927-157222949 CAGGAAATGATGGCAGCTGCTGG - Intronic
983026955 4:162749896-162749918 CAGGAAATGTGCACAGCTCCAGG + Intergenic
983035790 4:162864603-162864625 CTCTAAATTATCTCAGCTCCAGG - Intergenic
985694082 5:1330203-1330225 CAGGAAAGGCTTTCAGCCCCGGG - Intronic
986422074 5:7595434-7595456 CATGAAATGATATTAGTTCCTGG + Intronic
988704052 5:33706224-33706246 CAGGACTTGAACTCAGCTCTGGG - Intronic
989303141 5:39917863-39917885 AATGAAGTGATCTCAGCTCATGG - Intergenic
990544412 5:56808015-56808037 AACGAAATGGTCTCTGCTCCAGG + Intergenic
990835845 5:60018951-60018973 CAGGACCTGAACTCAGCTCTAGG + Intronic
993285302 5:85988659-85988681 CAGCAAATGGTCTCAGCTCTAGG - Intergenic
994825509 5:104708951-104708973 CAGGAAATGATCTCAGGTTTAGG + Intergenic
995221667 5:109655159-109655181 CAGGAAATTTTCTCAGAGCCTGG + Intergenic
995343011 5:111081572-111081594 TAGGGATTGATCCCAGCTCCTGG + Intergenic
996427643 5:123332876-123332898 CAGGACTTGAACTCAGCTCTGGG - Intergenic
997213848 5:132094588-132094610 CAGGAACTGTACTCAGGTCCAGG + Intergenic
997720864 5:136077530-136077552 AAGGAAATGCTCAAAGCTCCTGG - Intergenic
998691353 5:144592255-144592277 CAGGACTTGAACTCAGCTCTGGG - Intergenic
999142096 5:149369126-149369148 TAAGAAATGATCATAGCTCCTGG + Exonic
999419919 5:151431890-151431912 CAAAATATGATCTCAGCTCTTGG + Intergenic
999619910 5:153462392-153462414 GAGGAAATGATTTCAGCTGGAGG - Intergenic
1001104333 5:168840211-168840233 CTGAAAATGCTCTCATCTCCTGG - Intronic
1001571579 5:172733649-172733671 CCGGAAAGCACCTCAGCTCCAGG + Intergenic
1004449028 6:15727537-15727559 CAGGAGGTGATTTCAGCACCAGG + Intergenic
1006083657 6:31581581-31581603 CAGAAACAGATCTCAGCCCCGGG - Exonic
1009794809 6:68453789-68453811 CAGGACTTGAACTCAGCTCTGGG - Intergenic
1010446742 6:75957433-75957455 CAGGACTTGAACTCAGCTCTGGG - Intronic
1010633820 6:78231988-78232010 CTCTAAATTATCTCAGCTCCAGG + Intergenic
1012625047 6:101394127-101394149 CAGGAAGTGGCCTCAGCTACGGG + Intergenic
1014544603 6:122718857-122718879 CAGGATCTGGTCACAGCTCCTGG - Intronic
1015284451 6:131469352-131469374 CAGGAAATGATCTCAGCTCCTGG - Intergenic
1018768066 6:166949719-166949741 CAGGAAAGGAGCCCAGCTTCTGG - Intronic
1021999692 7:26214533-26214555 CAGCTAAAGATCTAAGCTCCAGG - Intergenic
1023626995 7:42125564-42125586 CATAAAAGGATCTCAGCTCAAGG - Intronic
1024770551 7:52716656-52716678 CAGAAACTGATTTCAACTCCTGG + Intergenic
1026634733 7:72071364-72071386 CTGGAAATCATTTCAGCTGCAGG - Intronic
1027563067 7:79756951-79756973 CACAAAATGATCACAACTCCTGG - Intergenic
1028216005 7:88134086-88134108 CAGGAAATAATCACAGCTTTTGG - Intronic
1030882345 7:114895813-114895835 CAGGACTTGAACTCAGCTCTGGG - Intergenic
1031685123 7:124723994-124724016 CAGGAAATGCACTTATCTCCAGG - Intergenic
1032914232 7:136469950-136469972 CAGGATCTGAACTCAGCTCTGGG - Intergenic
1035950284 8:4012526-4012548 CAGGTAGTGATCACAGCACCTGG + Intronic
1036993718 8:13630180-13630202 CAGGAAATGCCCTCAGCTAAAGG - Intergenic
1037957679 8:23071571-23071593 CCGGAACTGAGCTCAGCTCCAGG - Intergenic
1037962024 8:23104982-23105004 CAGGAACTGAACTCAGCTCCAGG - Intronic
1037969430 8:23161427-23161449 CAGGAACTGAGCTCAGCTCCAGG + Intronic
1037977106 8:23221526-23221548 GAGAAACTGAGCTCAGCTCCAGG + Intronic
1042548187 8:69969889-69969911 CATGAGATGAAATCAGCTCCTGG + Intergenic
1043739410 8:83791134-83791156 CAACAAATGATCTCAACTCTAGG - Intergenic
1045657293 8:104400053-104400075 CAGGAATTGGTCTGAGCTCAGGG - Intronic
1045921799 8:107538782-107538804 CAGGAAATGATGCCAGCTCTTGG + Intergenic
1046656722 8:116902916-116902938 CAAGATATTGTCTCAGCTCCTGG + Intergenic
1047765579 8:127987342-127987364 CATCAAAGGTTCTCAGCTCCAGG - Intergenic
1048467313 8:134676563-134676585 CAGGACTTGAACTCAGCTCTGGG + Intronic
1048799625 8:138184070-138184092 CAGGAAACCATCTGAGATCCTGG - Intronic
1048913794 8:139162941-139162963 CAGGACTTGAACTCAGCTCTGGG - Intergenic
1049548448 8:143245709-143245731 CAGGAGCTGCTCTCAGCTCCCGG - Intergenic
1049836214 8:144737153-144737175 CAGTGGATGATCTCAGCTCATGG + Intronic
1050235250 9:3571287-3571309 CTGGAAGTCATCACAGCTCCAGG - Intergenic
1050742211 9:8835155-8835177 AACGAAATGACCCCAGCTCCTGG + Intronic
1051218494 9:14824027-14824049 GAGTGAATGACCTCAGCTCCAGG + Exonic
1054710655 9:68507872-68507894 CAAGGAGTGTTCTCAGCTCCAGG - Intronic
1055172435 9:73275430-73275452 ACCGAAATCATCTCAGCTCCTGG + Intergenic
1055812694 9:80168160-80168182 CTTGAAATGAAATCAGCTCCTGG - Intergenic
1056115950 9:83441407-83441429 AAATAAATAATCTCAGCTCCTGG + Intronic
1056791273 9:89626908-89626930 CAGGGAGTGAACACAGCTCCCGG + Intergenic
1056844941 9:90029593-90029615 CAGGGGCTGCTCTCAGCTCCTGG + Intergenic
1060410311 9:123395687-123395709 CAGGAACTGTGCTCAGCCCCAGG - Intronic
1061826749 9:133262580-133262602 CAGGAACTGGTCTGGGCTCCTGG - Intronic
1062357443 9:136171495-136171517 CAGGAAGCGCTCTCAGCACCTGG + Intergenic
1062725202 9:138069088-138069110 CAGGAGATGACCTGGGCTCCAGG - Intronic
1186317434 X:8386144-8386166 CAGGGATTGCTGTCAGCTCCTGG - Intergenic
1186690587 X:11971073-11971095 CAGGTCATGATCTGATCTCCAGG + Intergenic
1189205372 X:39233772-39233794 CAGGAATTGCTCACAGCTCCTGG + Intergenic
1192915798 X:75649978-75650000 CAGGACTTGACCTCAGCTCTGGG - Intergenic
1193001798 X:76570649-76570671 CAGGACTTGAACTCAGCTCAGGG + Intergenic
1193614281 X:83668688-83668710 CAGGAAATAATCTCAGAGCATGG + Intergenic
1194642901 X:96424744-96424766 CAGGAAAAGACCTCAGTTCTGGG + Intergenic
1195774558 X:108389240-108389262 CAGGACTTGAACTCAGCTCTGGG - Intronic
1195979094 X:110558950-110558972 CAGGACTTGAACTCAGCTCTGGG - Intergenic
1197098077 X:122619349-122619371 CAGGAGTTGAACTCAGCTCTGGG - Intergenic
1197156202 X:123272865-123272887 CAGGATAAGATCTCAGAGCCAGG - Intronic
1197395344 X:125920850-125920872 CAGGACTTGAACTCAGCTCTGGG - Intergenic
1197614035 X:128672539-128672561 CAGGACTTGAACTCAGCTCTGGG - Intergenic
1198778349 X:140205808-140205830 CAGGAAGTGTTCTTTGCTCCTGG + Intergenic
1198801430 X:140451832-140451854 CACTAAATGGTGTCAGCTCCTGG - Intergenic
1199494974 X:148442584-148442606 CAGGAAATGAACTTGGCTCAGGG + Intergenic
1199612514 X:149630747-149630769 CAGGAGATGGTCTCAGCTTCAGG + Intronic
1200888022 Y:8291283-8291305 GAAGAAATGGTATCAGCTCCTGG + Intergenic