ID: 1015284679

View in Genome Browser
Species Human (GRCh38)
Location 6:131472070-131472092
Sequence CATTGATACTAGAAGTAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015284678_1015284679 25 Left 1015284678 6:131472022-131472044 CCACTGAAATCTTGGGTTTATTA No data
Right 1015284679 6:131472070-131472092 CATTGATACTAGAAGTAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015284679 Original CRISPR CATTGATACTAGAAGTAAGA TGG Intergenic
No off target data available for this crispr