ID: 1015287987

View in Genome Browser
Species Human (GRCh38)
Location 6:131507486-131507508
Sequence CCCGAAGCTCGGCGTCCGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015287984_1015287987 -8 Left 1015287984 6:131507471-131507493 CCACTGTGAGAGTTACCCGAAGC 0: 137
1: 233
2: 258
3: 215
4: 123
Right 1015287987 6:131507486-131507508 CCCGAAGCTCGGCGTCCGTGAGG No data
1015287980_1015287987 28 Left 1015287980 6:131507435-131507457 CCTCTGTATTGATTAAGAAGGGG 0: 97
1: 374
2: 284
3: 93
4: 151
Right 1015287987 6:131507486-131507508 CCCGAAGCTCGGCGTCCGTGAGG No data
1015287983_1015287987 -4 Left 1015287983 6:131507467-131507489 CCTTCCACTGTGAGAGTTACCCG 0: 122
1: 261
2: 269
3: 171
4: 121
Right 1015287987 6:131507486-131507508 CCCGAAGCTCGGCGTCCGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015287987 Original CRISPR CCCGAAGCTCGGCGTCCGTG AGG Intergenic
No off target data available for this crispr