ID: 1015291744

View in Genome Browser
Species Human (GRCh38)
Location 6:131545380-131545402
Sequence CTTTGAACACAGGTGGTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015291740_1015291744 -10 Left 1015291740 6:131545367-131545389 CCCTGGTTCATTACTTTGAACAC No data
Right 1015291744 6:131545380-131545402 CTTTGAACACAGGTGGTACAAGG No data
1015291739_1015291744 -9 Left 1015291739 6:131545366-131545388 CCCCTGGTTCATTACTTTGAACA No data
Right 1015291744 6:131545380-131545402 CTTTGAACACAGGTGGTACAAGG No data
1015291735_1015291744 25 Left 1015291735 6:131545332-131545354 CCTTATCTATGAAGATCTATGAA No data
Right 1015291744 6:131545380-131545402 CTTTGAACACAGGTGGTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015291744 Original CRISPR CTTTGAACACAGGTGGTACA AGG Intergenic
No off target data available for this crispr