ID: 1015293158

View in Genome Browser
Species Human (GRCh38)
Location 6:131561100-131561122
Sequence CTTTGGAAGGCCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015293158_1015293164 -8 Left 1015293158 6:131561100-131561122 CCTTCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1015293164 6:131561115-131561137 TTCCAAAGTGCTGGGATTACAGG 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705
1015293158_1015293167 23 Left 1015293158 6:131561100-131561122 CCTTCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1015293167 6:131561146-131561168 ACCATGCTCAGCCCAACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015293158 Original CRISPR CTTTGGAAGGCCAAGGTGGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr