ID: 1015296041

View in Genome Browser
Species Human (GRCh38)
Location 6:131594210-131594232
Sequence TCTGAAGGATAATCGACCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 16}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015296041_1015296043 -5 Left 1015296041 6:131594210-131594232 CCTGCGGTCGATTATCCTTCAGA 0: 1
1: 0
2: 0
3: 1
4: 16
Right 1015296043 6:131594228-131594250 TCAGAGAGCCAATGATCGCATGG 0: 1
1: 0
2: 0
3: 5
4: 87
1015296041_1015296045 22 Left 1015296041 6:131594210-131594232 CCTGCGGTCGATTATCCTTCAGA 0: 1
1: 0
2: 0
3: 1
4: 16
Right 1015296045 6:131594255-131594277 GTTTTCGTTTGAGAAATGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015296041 Original CRISPR TCTGAAGGATAATCGACCGC AGG (reversed) Exonic
903041593 1:20534800-20534822 TCAGTAGGGGAATCGACCGCTGG + Intergenic
1066222215 10:33346225-33346247 TCTGAAAAATAATATACCGCTGG - Intergenic
1112556520 13:100473291-100473313 GCTGAAGCCTAATCGACTGCAGG - Intronic
1133324254 16:4933924-4933946 TGTGAATGATAAGCGGCCGCAGG - Intronic
1137597040 16:49731076-49731098 TGTCAAGGATAATGGACCCCGGG - Intronic
1142561666 17:813373-813395 TCTGAAGGAGAAACGGCCCCCGG + Intronic
1158742562 18:60160251-60160273 TCTCCAGGATATTCGACCGGGGG + Intergenic
1178242048 21:30914331-30914353 TCTGAAGGAGAAACAACTGCAGG + Intergenic
952504089 3:33991901-33991923 TCTGAAGGCTGATCTACCTCTGG + Intergenic
959126743 3:102299179-102299201 TCTGAAGCATAATGGACTGCAGG - Intronic
970657281 4:18245521-18245543 TCTGAAGGAAAAGCCACCTCTGG + Intergenic
971634402 4:29037921-29037943 TTTGAAGGAAAATGGATCGCAGG - Intergenic
980917282 4:139045394-139045416 TCTGAAGGATAATTGAAGGAAGG - Exonic
1006689506 6:35869095-35869117 TCTGTAGGAAAATCCACGGCTGG - Exonic
1015296041 6:131594210-131594232 TCTGAAGGATAATCGACCGCAGG - Exonic
1015415386 6:132941875-132941897 TCTAAAGAATAATCGGCCGGGGG + Intergenic
1033917266 7:146342175-146342197 TCTGAAGAATAATCTTCCACAGG - Intronic
1193251997 X:79301885-79301907 TATAAATGATAATCGACAGCCGG - Intergenic