ID: 1015299419

View in Genome Browser
Species Human (GRCh38)
Location 6:131635529-131635551
Sequence CTTGTTCTGGACTTTGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015299419_1015299426 17 Left 1015299419 6:131635529-131635551 CCTTACACAAAGTCCAGAACAAG 0: 1
1: 0
2: 2
3: 12
4: 205
Right 1015299426 6:131635569-131635591 GACTCTTTCCCAGGCCTTCCTGG 0: 1
1: 0
2: 5
3: 57
4: 653
1015299419_1015299427 18 Left 1015299419 6:131635529-131635551 CCTTACACAAAGTCCAGAACAAG 0: 1
1: 0
2: 2
3: 12
4: 205
Right 1015299427 6:131635570-131635592 ACTCTTTCCCAGGCCTTCCTGGG 0: 1
1: 0
2: 4
3: 34
4: 320
1015299419_1015299422 8 Left 1015299419 6:131635529-131635551 CCTTACACAAAGTCCAGAACAAG 0: 1
1: 0
2: 2
3: 12
4: 205
Right 1015299422 6:131635560-131635582 GCCCACCAAGACTCTTTCCCAGG 0: 1
1: 0
2: 1
3: 58
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015299419 Original CRISPR CTTGTTCTGGACTTTGTGTA AGG (reversed) Intronic
900710768 1:4112163-4112185 CTTGTTCTTGACTGTGAGAATGG - Intergenic
902658039 1:17882991-17883013 CTTGGGCTGGACTGTGGGTAGGG + Intergenic
906293566 1:44635509-44635531 CTTGTTCTGTGCTTTGTTTTCGG + Intronic
907783459 1:57588905-57588927 TTTGTTCTGGACTATATTTAGGG - Intronic
910162058 1:84283743-84283765 CTTGTGCTGCATTCTGTGTAAGG + Intergenic
911123378 1:94318210-94318232 CTTTTTCTAGACCTTGTGTGCGG + Intergenic
912027514 1:105196825-105196847 CTGGTTCTGGACATTATGTAGGG - Intergenic
914326116 1:146618567-146618589 TTTGTTTTGGACTTTATGTAAGG - Intergenic
915966656 1:160314839-160314861 TTTGTACTAGACTTTGTTTAAGG - Intronic
916711661 1:167415967-167415989 CTTTTTCTGGTATGTGTGTATGG - Exonic
923542179 1:234896524-234896546 CTTGTTTTGGGGTTTGTCTATGG - Intergenic
924674768 1:246164693-246164715 CTTGTTCAGGACTGTGTGCCTGG - Intronic
1066270101 10:33813881-33813903 ATTTTTCTGGTCTTTGTCTAGGG - Intergenic
1068691389 10:59919264-59919286 CTGCTTTTGAACTTTGTGTAAGG - Intergenic
1069892109 10:71658379-71658401 ATTGTCCTGGACCTTGTGTGAGG + Intronic
1071062834 10:81593342-81593364 CTGCTTCTGGACTTTGTTTTTGG - Intergenic
1074217910 10:111405777-111405799 CTTGTTCTGGAAATTCTGTGAGG + Intergenic
1074683088 10:115930403-115930425 CTAGTTCTGAAGCTTGTGTATGG - Intronic
1075155193 10:119970170-119970192 CATTTTTTGGACTTTGTTTATGG + Intergenic
1075186559 10:120264526-120264548 CATGTTTTGCACTTTGTGCAGGG + Intergenic
1075547756 10:123368235-123368257 CTTCTTCAGAACTGTGTGTATGG + Intergenic
1075859425 10:125661846-125661868 CTTCTCCCGGACTTTGTATATGG + Exonic
1078251340 11:9619095-9619117 CTTCTTCTGGACTGGGTGAAGGG + Intergenic
1078540801 11:12211560-12211582 CATGCTGTGTACTTTGTGTAAGG - Intronic
1078941464 11:16011164-16011186 CTTTTTATGGACTTTTCGTATGG - Intronic
1079583480 11:22095612-22095634 ATTGTGATGGCCTTTGTGTATGG + Intergenic
1079623069 11:22578963-22578985 TGTGTTGTAGACTTTGTGTAAGG + Intergenic
1082582564 11:54890972-54890994 CTTGTTCTAGAATCTGTGAAAGG + Intergenic
1085502438 11:77036421-77036443 TTTGTGCTAGACATTGTGTATGG + Intronic
1085646940 11:78230404-78230426 CTTCTTGTGGACTTTGTGTAAGG - Intronic
1086513273 11:87584015-87584037 CTTGTGATGGAGTTTGAGTAGGG + Intergenic
1086537909 11:87870808-87870830 CTTAGTCTGGTGTTTGTGTATGG + Intergenic
1087438113 11:98148816-98148838 CATGATCTTGACTCTGTGTAAGG - Intergenic
1089791772 11:120950669-120950691 CTGCTTCTGGACTCTGTATATGG + Intronic
1091442193 12:519947-519969 CTTGTTATGTCCTCTGTGTAGGG + Intronic
1091557144 12:1582423-1582445 CTTCTTCTTGGCTTTGTGCAGGG + Intronic
1092893849 12:12994522-12994544 CTTGCTGTGGACTTTGTGCCTGG - Intronic
1093009164 12:14085958-14085980 CTTATTCTGGACATTGTACATGG + Intergenic
1097413627 12:59286215-59286237 CTTGTTTTGGACTTTGCCTTAGG + Intergenic
1098697417 12:73577191-73577213 CTTTTTCTGGACTTTCTGGATGG - Intergenic
1098853120 12:75621302-75621324 CTTGGAATGGACTTTGTGTAGGG - Intergenic
1101484480 12:105139296-105139318 CTTGTGCAGGAGTTTTTGTAAGG + Intronic
1101867496 12:108531657-108531679 ATTGGTCTGGATTTTGGGTATGG - Intronic
1103628192 12:122236854-122236876 CTTGCTCTGAAGTCTGTGTATGG + Intronic
1105947448 13:25202004-25202026 CTTCTTCTGTACTTAGTATATGG - Intergenic
1106633308 13:31500251-31500273 CTCTTTCTGCACTTTTTGTAGGG - Intergenic
1109552477 13:63921410-63921432 CTTGTCATGGCCTTTGTGCAAGG + Intergenic
1112191378 13:97181192-97181214 ATTGTTCTGGATTATGTGAATGG - Intergenic
1113974059 13:114213272-114213294 GTGGTTCTGGAGTTTGTGCAGGG - Intergenic
1115196632 14:30807651-30807673 CTTATACTGGACTCTGTATAAGG - Intergenic
1115860304 14:37678625-37678647 CATGTTCTGGAAATTGTGTCAGG + Intronic
1119251072 14:73154632-73154654 TTTGTTTTGGACTTTGTTCATGG - Intronic
1121377419 14:93425891-93425913 CTTGTTTTTCACTTTGTTTATGG - Intronic
1121795484 14:96731846-96731868 TTTCTTCTAGACTTTCTGTAGGG + Intergenic
1121893451 14:97621470-97621492 TTTGCTCTGGCCTCTGTGTATGG - Intergenic
1122120109 14:99548498-99548520 CTTGTGCTGGGCTTTGTCAAGGG - Intronic
1122467049 14:101940925-101940947 CTTCTTATGGACCTTGTGTCAGG - Intergenic
1123217609 14:106826405-106826427 GTTGTGCTGGCCTTTGTGCAAGG + Intergenic
1125003150 15:34792545-34792567 ATTGTTCTGGACTCTGGGGATGG - Exonic
1126595572 15:50381495-50381517 GTTGTGCTAGACTTTGTTTATGG - Intergenic
1126852789 15:52807630-52807652 TTTGTTCTGGTCTGTTTGTAAGG - Intergenic
1127202561 15:56671930-56671952 CTTTTTCTGGCCATTGTGAAGGG + Intronic
1128296758 15:66527362-66527384 CTTGTTCAGGAATTTCTGAATGG + Exonic
1130033084 15:80333423-80333445 CTTGTTTAGGGCTTTGTTTAGGG - Intergenic
1133518010 16:6528662-6528684 CTTGTGCTAGGCTTTGAGTAGGG + Intronic
1133716025 16:8449862-8449884 CTTTTTCAAGATTTTGTGTATGG + Intergenic
1134052746 16:11148341-11148363 CTAGTTGTGGCCTTTTTGTATGG + Intronic
1136626974 16:31467219-31467241 CTTGTTCAGGTCTTTGTGTCTGG + Intergenic
1137529535 16:49269497-49269519 CTTGTGCTGGACTGTGGGTGAGG + Intergenic
1140007451 16:71092379-71092401 TTTGTTTTGGACTTTATGTAAGG + Intronic
1140516173 16:75543599-75543621 CTTTTTTTTGTCTTTGTGTAGGG - Intronic
1144679386 17:17182831-17182853 CTTGTTGGGGACTTTCTGTCAGG - Intronic
1145054588 17:19692700-19692722 CTTGATCTGGCTTTTGTGTAAGG - Intronic
1145837931 17:27968767-27968789 CTTGTCCTGGGCTTTGTGCTAGG - Intergenic
1149200844 17:54184141-54184163 CTTGTTATTGAGTTTGTGTAGGG + Intergenic
1151688200 17:75662277-75662299 CTTGTTCTGGATCCTGTGGAAGG - Intronic
1153759483 18:8316920-8316942 CTTGTTGTGGAATTTGTGCCTGG + Intronic
1154013248 18:10593627-10593649 TTTGTTCTAAACCTTGTGTAGGG - Intergenic
1156290059 18:35740088-35740110 TTTGTTCTTGCCTTTGTGCAAGG + Intergenic
1160546684 18:79661726-79661748 GTTGTGCTGGTCTTTGTGCAAGG - Intergenic
1165259630 19:34601051-34601073 CATGGAATGGACTTTGTGTAAGG + Intronic
927379332 2:22460332-22460354 CTTGGTCAAGACTTTGAGTAGGG - Intergenic
931181884 2:59909751-59909773 CTTGTTCTGCATTTTTGGTAGGG - Intergenic
931903454 2:66817809-66817831 CTTGGTATGGACTTAGTGTATGG + Intergenic
931928782 2:67105586-67105608 CATGTTCTGGACTATGTGTTTGG - Intergenic
933585011 2:84170440-84170462 GTTGTACTTGACTCTGTGTATGG + Intergenic
936416397 2:112317978-112318000 TTTCTTCTGGACTTCGTGTTTGG + Intronic
939665141 2:144942505-144942527 GTTATTCTGGACTTGATGTAAGG - Intergenic
939931752 2:148243575-148243597 CTTGTTTTGGCATTTGTGTGAGG + Intronic
941743926 2:169066202-169066224 CTTGTTCTGGACTTTGTTTTGGG - Intronic
943561967 2:189474498-189474520 TTTGTCCTGGACCTGGTGTAGGG + Intronic
946432081 2:219631377-219631399 TTTGTGCTGGACTTTGAGGATGG + Intronic
1169050291 20:2570981-2571003 CTTGTGCTGATTTTTGTGTATGG - Intronic
1169466124 20:5840936-5840958 CTTGTTCTGGCCTTAGTCAATGG + Intronic
1170461838 20:16584785-16584807 GTTGTTCTGTTCTTGGTGTATGG + Intergenic
1172954016 20:38742530-38742552 CTTGTGCTGGACTTGGTTCAGGG - Intergenic
1177272358 21:18866072-18866094 CTTTTTATGGAATTTGTGAATGG + Intergenic
1177511800 21:22096383-22096405 ACTGTTCTAGATTTTGTGTATGG - Intergenic
1179815159 21:43900970-43900992 CTTCTTCTGGGTTTTCTGTATGG - Intronic
1184369878 22:44075517-44075539 TTGGTGCTGGACATTGTGTAAGG + Intronic
1184974999 22:48054799-48054821 CTTATTGTGGAATTAGTGTAAGG - Intergenic
949256912 3:2059572-2059594 TTTGTTCTAGACTGTGTATATGG + Intergenic
949464602 3:4331465-4331487 TTTGTTCTGGACTTTGCATCTGG - Intronic
951232701 3:20198288-20198310 GTTGTGTTGGACTTTGTTTATGG + Intergenic
951302892 3:21020184-21020206 CTGGTTCTAGACTTCGTGTTTGG - Intergenic
952571343 3:34721373-34721395 CTTCTGCTGGACTTAGTGCATGG - Intergenic
952883867 3:38001280-38001302 CTTGTGCTGGGCTTTGTACAAGG - Intronic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
956044210 3:65177759-65177781 CTTTTTCTTGACTTTGTGGCGGG - Intergenic
957207144 3:77213199-77213221 CTGGTTCTGGACTTTTTTTTTGG + Intronic
957576506 3:82014956-82014978 CCTGGTGGGGACTTTGTGTAGGG - Intergenic
957691919 3:83581644-83581666 GTTGTGGTGGACTTTGTGCAAGG + Intergenic
960146011 3:114203718-114203740 TTTATTCTGGACATTGTGAATGG + Intergenic
961906353 3:130266687-130266709 CTGGTTTTGTACTTTCTGTAGGG + Intergenic
962746781 3:138402614-138402636 CTTGTTTTGTACTTTGTATGTGG - Exonic
964641733 3:158915813-158915835 TTTGCTTTGGACTTTGTGTTTGG - Intergenic
965171927 3:165276690-165276712 CTTTTTCTGGAAATTGTGAATGG + Intergenic
965573096 3:170191310-170191332 CTTATTCTGGGCTGGGTGTAGGG - Intergenic
966442312 3:179959277-179959299 CTTTTTCTGGACTATGATTAGGG + Intronic
970520065 4:16874128-16874150 TTTGGTTTGGAGTTTGTGTAGGG - Intronic
970621727 4:17828194-17828216 CTTTCTCAGGGCTTTGTGTAGGG - Intronic
971645646 4:29198028-29198050 CTTTTTCTGGATTTGGTGTCAGG + Intergenic
971744661 4:30564391-30564413 CTTGATCTGAATTTTGTTTACGG - Intergenic
971978730 4:33725715-33725737 CTTTTTCTGTACTTTTTATAGGG - Intergenic
974687586 4:65250421-65250443 TTTATTCAGGACTTTGAGTATGG + Intergenic
975670215 4:76772981-76773003 CTCTTTCTTGACTTTGTCTATGG - Intronic
977877175 4:102163640-102163662 CTCGTTCCAGCCTTTGTGTAAGG + Intergenic
983152254 4:164299168-164299190 TATGTTCTGGGCTTTGTGCAAGG + Intronic
984030822 4:174601968-174601990 CTAGTTTTAGACTTTGTGTTTGG + Intergenic
984132106 4:175890443-175890465 CTTCTTTTTGACTGTGTGTATGG - Intronic
988226477 5:28418532-28418554 GTTGTAATGGCCTTTGTGTAAGG + Intergenic
989800076 5:45526587-45526609 CTTGTTCTGAACCTTGGGTTTGG + Intronic
992070897 5:73147708-73147730 TTTTTTCTTGACTTTTTGTATGG - Intergenic
992104470 5:73437947-73437969 ATTTTTCTGGACATTGTTTAAGG + Intergenic
992323521 5:75637289-75637311 CTGGTTCTGGATTTGGTGCAGGG + Intronic
993125403 5:83829280-83829302 CTTGTTTTGGACTATGAGTTTGG - Intergenic
993685531 5:90933158-90933180 CTTGTTCTATATTTTGTTTACGG + Intronic
993749057 5:91644235-91644257 CTTGGTATGGGCTTTGTGGATGG + Intergenic
993973762 5:94451519-94451541 CATGTTCTAGTCTTTGTGTTAGG + Intronic
995483680 5:112617644-112617666 CTTGTTCTGGGCTCTCTGTTTGG - Intergenic
996215072 5:120856285-120856307 CATGTTCTTGCCTTCGTGTAAGG - Intergenic
996929641 5:128870467-128870489 CTTGTTCTGGGCTCTGTTTTAGG + Intronic
998566249 5:143218361-143218383 CTTGTTCTGTGCTATGTGCAAGG + Intronic
1000372983 5:160554960-160554982 CTGCTTCTGGACTGTATGTAAGG + Intergenic
1000795566 5:165660492-165660514 CTTTTCCTGGACTTTGTGCTTGG - Intergenic
1001547211 5:172577969-172577991 CTGGTGCTGGACTTTGTGCTGGG - Intergenic
1003345492 6:5261964-5261986 CTTGTTCTGATCTTTGAGCATGG + Intronic
1004893137 6:20121083-20121105 TTTCTTTTGGACTTAGTGTATGG - Intronic
1007025961 6:38574401-38574423 CATGTTTTGGACTGTATGTATGG + Intronic
1008647254 6:53527378-53527400 CTTGTTTAGGAGTTAGTGTAAGG - Intronic
1010334641 6:74666225-74666247 GTTTTTCTGCACTGTGTGTAGGG + Intergenic
1010843771 6:80679790-80679812 AGTGTTCTGTACTTTGTGTTAGG - Intergenic
1011368928 6:86611526-86611548 CTCTTTCAGGACTTTGTGTAAGG - Intergenic
1011952745 6:92987284-92987306 CATTTTCTGCAGTTTGTGTAAGG + Intergenic
1013164125 6:107574710-107574732 TGTGTTCTGGACTTGGGGTATGG - Intronic
1014309937 6:119787259-119787281 TTTCTCCTGGACTTTGTGCATGG + Intergenic
1015299419 6:131635529-131635551 CTTGTTCTGGACTTTGTGTAAGG - Intronic
1015986374 6:138888126-138888148 TTTGGTCTGGACATTTTGTAGGG + Intronic
1019066706 6:169307506-169307528 CTTATTTTGGATTTTGTATAGGG - Intergenic
1020651239 7:10879054-10879076 CTGGTTCTGGACTTTATTTTTGG - Intergenic
1023248241 7:38230430-38230452 CTTGTTTTGCATTATGTGTATGG + Exonic
1023744600 7:43311290-43311312 CTAATTCTGGGCTGTGTGTAGGG + Intronic
1024007141 7:45233065-45233087 GTTGTGATGGACTTTGTGCAAGG + Intergenic
1028019989 7:85758443-85758465 CTTGATTTGACCTTTGTGTATGG - Intergenic
1029579845 7:101428617-101428639 GTTGTGGTGGACTTTGTGCAAGG + Intronic
1030202785 7:106922318-106922340 CTTGTCCTGGACTTTTTTTTTGG - Intergenic
1030854917 7:114543461-114543483 CTTGTATTAGACTTTGTATAAGG - Intronic
1031120812 7:117719636-117719658 GTTTTTCTGAACTTTGTGTTAGG - Exonic
1031599971 7:123695245-123695267 CTTGTGCTGGGCATTGTGCAAGG - Intronic
1033617347 7:143029340-143029362 CTTGTTCTGGCCCCTGTGCATGG - Intergenic
1034393625 7:150803766-150803788 CTTCTTCTGGACTCTGAGTGGGG - Exonic
1034655205 7:152723672-152723694 CTGGTTCTGGATTTTGTGGGGGG - Intergenic
1034909098 7:154978064-154978086 CTTCTCCTGAACTTTGTTTACGG + Intronic
1037282909 8:17263434-17263456 CTTGTTTTGGAATTTGTTGATGG + Intronic
1039176945 8:34819276-34819298 CTTTTCCTGGAGTTTGTGTTAGG - Intergenic
1039417924 8:37411574-37411596 CTTGGGCTGGACTCTGTGCATGG + Intergenic
1040131585 8:43803134-43803156 CTTTTTGTGGAATTTGTGAAGGG + Intergenic
1040332528 8:46395747-46395769 CTTTTTGTGGAATTTGTGAAGGG - Intergenic
1041031034 8:53735414-53735436 CTTTTTCTGAACTTTGTGGCTGG - Intronic
1041648640 8:60280072-60280094 CTAGTCCGGGATTTTGTGTATGG - Intronic
1042124395 8:65523037-65523059 ATTGTGATGGACTTTGTGCAAGG - Intergenic
1042258887 8:66836045-66836067 TTTGTTCTGGATTTTGTTAATGG + Exonic
1042918812 8:73901579-73901601 GTTGTGATGGCCTTTGTGTAGGG + Intergenic
1043921451 8:85988315-85988337 CTTCTTGTGGAGTTTGTGTGCGG + Intronic
1044245000 8:89933453-89933475 CTGTTTCTGGACTTTCTGTTTGG - Exonic
1045855034 8:106755125-106755147 CTTGAGCTGCTCTTTGTGTATGG - Intergenic
1048924022 8:139254662-139254684 CTTGCCCTGGACCTTGTGAATGG + Intergenic
1051329817 9:16012284-16012306 CTTGGTGTGGAAGTTGTGTAGGG + Intronic
1052101467 9:24451394-24451416 CTCATTCTGAACTTTGTCTATGG - Intergenic
1052119939 9:24701903-24701925 TTTGTTGTTGACTTTGTTTATGG + Intergenic
1053026947 9:34738004-34738026 AATCTTCTGGACTTTCTGTATGG - Intergenic
1053531028 9:38881008-38881030 CTTTTTCAGGAATTTCTGTAAGG - Intergenic
1054203252 9:62105440-62105462 CTTTTTCAGGAATTTCTGTAAGG - Intergenic
1054635110 9:67482924-67482946 CTTTTTCAGGAATTTCTGTAAGG + Intergenic
1055071828 9:72174526-72174548 TTGGTTCTGGATTTTGTGTATGG + Intronic
1055163752 9:73165224-73165246 CTTTTTCTGGAATCTGTTTATGG + Intronic
1055441565 9:76341755-76341777 CTTGTTCTGGACTGAGTTTCAGG - Intronic
1056515199 9:87343362-87343384 CTTGTTCTGGGCTTTGATTTAGG - Intergenic
1056517574 9:87369997-87370019 CTTGTTCTTGAAAGTGTGTAGGG - Intergenic
1057051459 9:91927403-91927425 CTGGCTTTGGAGTTTGTGTACGG - Intronic
1061999846 9:134210401-134210423 CTTGGGCTGGACTTGCTGTAGGG - Intergenic
1062000556 9:134213795-134213817 CTGGTTCTGGACTATGTGGGCGG + Intergenic
1062032061 9:134366198-134366220 CATGTTCTGGGCTGTGTGTGGGG + Intronic
1203488579 Un_GL000224v1:82316-82338 GTTGTCATGGACTTTGTGCAAGG - Intergenic
1203501200 Un_KI270741v1:24212-24234 GTTGTCATGGACTTTGTGCAAGG - Intergenic
1186491408 X:9976342-9976364 TTTGTTTTGCACTTTGTTTATGG + Intergenic
1188460054 X:30415071-30415093 CTTGTTCTGCAATTTGTTTCAGG - Intergenic
1189107589 X:38253572-38253594 ATTGTTCTTGTATTTGTGTAAGG - Intronic
1189713357 X:43838795-43838817 AATGATCTGGAATTTGTGTAAGG + Intronic
1191578071 X:62728923-62728945 ATTTTTCTGGACTCTGTGAAGGG - Intergenic
1191948066 X:66557389-66557411 CTGGTTCTGGACTTTTTTTTTGG - Intergenic
1193581613 X:83271359-83271381 TTTGTTTTCTACTTTGTGTAAGG - Intergenic
1195331437 X:103805594-103805616 CTGGTCCTGGACTTTGTGGGAGG + Intergenic
1196006862 X:110845820-110845842 CTTGAGCTGGTTTTTGTGTATGG - Intergenic
1196307743 X:114124442-114124464 CTGGTCCTGGACTTTTTGTTCGG + Intergenic
1198427183 X:136531926-136531948 TTTGTTGTTGACTCTGTGTATGG + Intergenic
1199407132 X:147475291-147475313 GTTATTCAGGGCTTTGTGTATGG + Intergenic
1200779470 Y:7201375-7201397 CTTCTCCTGAACTTTGTGGATGG - Intergenic
1201169549 Y:11244015-11244037 CTTGCTATGGCCTTTGTGCAAGG - Intergenic
1201412197 Y:13710939-13710961 CTTGGTCTGGCCTTAGTATAAGG - Intergenic