ID: 1015304534

View in Genome Browser
Species Human (GRCh38)
Location 6:131692534-131692556
Sequence TTTACTCATATCTACTAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015304534 Original CRISPR TTTACTCATATCTACTAATA TGG Intronic
902487137 1:16756340-16756362 AATAGTGATATCTACTAATAAGG - Intronic
902686742 1:18082268-18082290 GTGAATGATATCTACTAATATGG + Intergenic
905816943 1:40958666-40958688 TTCACTCATAACCACTAATCTGG - Intergenic
906844938 1:49181549-49181571 AATACTAATATCTACTCATAGGG + Intronic
908472551 1:64458414-64458436 TTTTCTCATATGTCCAAATAAGG - Intergenic
908679413 1:66642978-66643000 TTTATTCATCTCTAATATTAGGG - Intronic
909058391 1:70849748-70849770 TTTACTCATAATAACAAATATGG - Intergenic
909996560 1:82287073-82287095 TTTACTCAATCCTAATAATAAGG - Intergenic
910501921 1:87902038-87902060 TATACTTATATTTACTATTATGG - Intergenic
910776163 1:90877516-90877538 TTTACTCAATTCTATTAATATGG + Intergenic
917385909 1:174473863-174473885 TTTTCTCATCTCTACTACAACGG - Intronic
918865261 1:189889380-189889402 TTTATTTATATATTCTAATATGG + Intergenic
919240154 1:194904924-194904946 TTTACTTCTATCTACTCATTAGG + Intergenic
921660042 1:217790402-217790424 TTTACTGATATTTACTACAATGG - Intronic
922119681 1:222652399-222652421 TTTACTCAGATCTATTTTTAGGG + Intronic
922848881 1:228714074-228714096 TCTCCTCAAATCTACTAATATGG + Intergenic
922972369 1:229753618-229753640 ATTACTGGTAACTACTAATATGG + Intergenic
923009000 1:230073509-230073531 CTTAGTCATGTCTACTAGTATGG + Intronic
1065096145 10:22282665-22282687 TTTCCTCATATTTCCTAATGAGG - Intergenic
1065867048 10:29923392-29923414 TTAACTGATATCAACTAATAAGG + Intergenic
1068794889 10:61068659-61068681 TTTTATCATATGTACTAATCAGG - Intergenic
1069094768 10:64245547-64245569 TTTACCTACATCTACTAATAAGG + Intergenic
1073841859 10:107506950-107506972 TGTGCTCATATTTACTAGTATGG + Intergenic
1073948519 10:108780554-108780576 TTCACTCATATACACAAATATGG + Intergenic
1077706044 11:4486523-4486545 TTTTCTCAAATTTTCTAATAAGG + Intergenic
1078305527 11:10181731-10181753 TATACTCATATCTCTTAATTGGG - Intronic
1079635231 11:22729720-22729742 TTTATTCACATCTAGTAATAAGG - Intronic
1080371930 11:31658420-31658442 TTTACTTATTTCTAGTAATATGG + Intronic
1082213768 11:49540788-49540810 TTACATCATATGTACTAATAGGG + Intergenic
1085925532 11:81015570-81015592 TTTACAGATAACAACTAATAGGG - Intergenic
1086635836 11:89083660-89083682 TTACATCATATGTACTAATAGGG - Intergenic
1087153648 11:94880844-94880866 TTCACTCATATCTATTTATTTGG - Intergenic
1088353618 11:108918238-108918260 CATACTCATATCTATTAATAGGG - Intronic
1089577286 11:119454093-119454115 TTTCCCCATATCTGCTAATCCGG - Intergenic
1090021047 11:123128803-123128825 TATACTAATAGCTACTTATATGG + Intronic
1091131302 11:133149301-133149323 TTTCCTCATATCCACAAATCAGG - Intronic
1091176537 11:133563438-133563460 TTTATTCTTAGCAACTAATATGG + Intergenic
1092504340 12:9080570-9080592 TTTACTTATGTATACTTATAGGG - Intronic
1093400930 12:18745826-18745848 TTTACAAATATCTACTAAGTAGG + Intergenic
1093866791 12:24237128-24237150 TTTATTCATACCCACTAACATGG - Intergenic
1095232421 12:39756309-39756331 TTTACTCATAGATACTGAAAAGG + Exonic
1095347986 12:41175052-41175074 TTTATTCATATCTATTAATGTGG + Intergenic
1096268569 12:50144720-50144742 TAGTCTCAGATCTACTAATAAGG + Intronic
1097349833 12:58536598-58536620 TTTACACATATCTTTTTATACGG + Intergenic
1097537557 12:60892468-60892490 TTTACTTATATTTACTAGAAAGG + Intergenic
1098576699 12:72050776-72050798 TTTAGGCAAATCTACTAATTTGG + Intronic
1100663062 12:96721523-96721545 TTTTTTCATATTTAATAATATGG + Intronic
1106961331 13:35001974-35001996 TTTACTCATATTCAGTGATACGG - Intronic
1107022885 13:35769353-35769375 TTTGCTCATACATACTAAAAAGG - Intronic
1107348684 13:39490778-39490800 TTTACTCATTGCTACTTATTTGG + Intronic
1108015703 13:46073409-46073431 TTTTCTCATATGTCATAATAGGG - Intronic
1111780157 13:92713083-92713105 TTTACTAATTTCTTCTTATAAGG - Intronic
1112243779 13:97709059-97709081 TCCATTCATATTTACTAATATGG - Intergenic
1112757370 13:102652658-102652680 TTTACTATTATGTAATAATATGG - Intronic
1116006578 14:39298076-39298098 TCTACTCAAATCTATTAAAATGG - Intronic
1116308255 14:43286922-43286944 TTTTCTCATATTTACAAATGGGG + Intergenic
1119332017 14:73801868-73801890 AATAATAATATCTACTAATACGG + Intergenic
1120244166 14:81986459-81986481 TTTATTCATATATACCTATATGG + Intergenic
1120442489 14:84558236-84558258 TTTACATATACCTACTGATATGG - Intergenic
1122705869 14:103621003-103621025 TTTACTCGTATCAACCAAAATGG + Intronic
1123187384 14:106532849-106532871 TTTACTCATTTCTACAATTATGG + Intergenic
1126300312 15:47187240-47187262 TTTTCTCAGATCTCTTAATAAGG - Intronic
1126885177 15:53141539-53141561 TTCAATCATACCTACTTATATGG + Intergenic
1128719029 15:69932458-69932480 TATATTCATATTTACTCATAAGG + Intergenic
1130144157 15:81260515-81260537 TTTATAAATATCTAATAATAGGG - Intronic
1130920890 15:88343736-88343758 TTCTCACATATCTTCTAATAAGG + Intergenic
1132164770 15:99575136-99575158 TCAACTGATATCTCCTAATAAGG + Intronic
1132425860 15:101716423-101716445 TTTATTCCTATATATTAATATGG - Intronic
1137910246 16:52370739-52370761 TTAACTCATAACTCATAATAAGG + Intergenic
1140075056 16:71690803-71690825 GTTACTTATATCTATAAATAAGG - Intronic
1142107553 16:88313315-88313337 TGTAATCATATCAACTAAAATGG + Intergenic
1145021075 17:19431409-19431431 TTTTCTCATAAATACAAATAAGG + Intergenic
1153468914 18:5420568-5420590 TTTACTCATCTCTAATATTTTGG + Intronic
1157426277 18:47587008-47587030 TTTCCTCATGTCTAATATTAAGG + Intergenic
1158116230 18:53999025-53999047 TTTAATCTTATCTATTAATGAGG + Intergenic
1158801764 18:60919613-60919635 ATTACTAATCTCTATTAATATGG - Intergenic
1159909454 18:74131559-74131581 TCCACTCATCTCTACTAAGAGGG + Intronic
1160114598 18:76065420-76065442 TTTACTGATTTATACTATTATGG + Intergenic
1160126268 18:76175232-76175254 TTTACTCATATCTAAAAAGGGGG - Intergenic
1161149441 19:2700023-2700045 TTTACTCACTTTTAATAATATGG + Intronic
1164952768 19:32352085-32352107 ATTACTCATATCCACATATATGG - Intronic
1166497206 19:43312474-43312496 TCTACTTTTTTCTACTAATATGG + Intergenic
1202704071 1_KI270713v1_random:7900-7922 AATAGTGATATCTACTAATAAGG + Intergenic
928858313 2:35827048-35827070 TTTACTGATATCAACTATTACGG - Intergenic
929352704 2:40978758-40978780 ATTTCTCTTATCTACTATTAAGG - Intergenic
933034387 2:77374522-77374544 TTTCATCATCTCTTCTAATATGG + Intronic
933113322 2:78432412-78432434 TATACACATATTTTCTAATATGG - Intergenic
935042826 2:99449947-99449969 GTTACTCATATTTACTAAAAAGG + Intronic
935806450 2:106753425-106753447 TTTACACCTATCTACCATTATGG - Intergenic
937724664 2:125148319-125148341 TTTATTCAAATGTATTAATATGG - Intergenic
938448631 2:131396364-131396386 TTAACACATATTTAATAATATGG - Intergenic
939893470 2:147764661-147764683 TTTAAGCATACCTATTAATAAGG - Intergenic
941236239 2:162978038-162978060 GTTCCTCATATCTAAAAATAGGG - Intergenic
942195242 2:173511119-173511141 GTTACTAATAGTTACTAATAGGG - Intergenic
944672103 2:202003599-202003621 TTAACTCATATTTACTTATTAGG + Intergenic
946668504 2:222076714-222076736 TTTACTCTTATCAATTATTAAGG - Intergenic
947801548 2:232931540-232931562 TTTTCTCATAGCTTGTAATACGG - Intronic
1168924641 20:1569326-1569348 TTTCCTCATATCATCTAAAATGG - Intronic
1169966574 20:11224459-11224481 ATTACTCCTAACTAATAATATGG - Intergenic
1173129799 20:40380783-40380805 TTTGCTAATGTCTACTTATATGG + Intergenic
1173465258 20:43275924-43275946 TTTCCTCATTTGTACTCATAGGG - Intergenic
1176893650 21:14350011-14350033 TATTCTAATATCTACTATTATGG + Intergenic
1176906973 21:14513020-14513042 TTTATTCATATCTAGTGATCTGG - Intronic
1177374803 21:20255620-20255642 GTTTTTCATATCTACTAATTAGG - Intergenic
1182380922 22:29886526-29886548 TTTTCTCATATATACAATTAAGG + Intronic
1183773159 22:39944352-39944374 TTTACTATTCTCTACTACTAGGG + Intronic
949134483 3:546570-546592 TTTCCTCATATATAATATTATGG - Intergenic
950274780 3:11650566-11650588 GTTACTCATATTTTCTAATGTGG - Intronic
951154292 3:19330665-19330687 TTTATTCTTAACCACTAATAGGG + Intronic
951388442 3:22072083-22072105 TTTCATCATAGTTACTAATATGG - Intronic
955904518 3:63792844-63792866 TTTTCTCATATTTATTAAAAAGG - Intergenic
956427276 3:69149296-69149318 GTTATTAATTTCTACTAATAAGG + Intergenic
957683524 3:83470542-83470564 TTGAATCATATCTATTAATTAGG + Intergenic
957774169 3:84734228-84734250 TTTGATCATACCTACTGATATGG - Intergenic
959426762 3:106199519-106199541 ATTACTCCAATCTACTAATTAGG + Intergenic
960166539 3:114409088-114409110 TTTATTCAAATCTTCTAAGAGGG + Intronic
963393629 3:144703219-144703241 TTTCCTCATATTTCCTACTAAGG + Intergenic
964045212 3:152315382-152315404 TTTTCTTATATCCAGTAATAGGG - Intronic
964777997 3:160300380-160300402 TTTATTTATAACTACTAATGTGG + Intronic
965054194 3:163693954-163693976 TTTATTCAAATATATTAATATGG + Intergenic
966122068 3:176533113-176533135 TTTATTCTTTTCTACTAATTTGG - Intergenic
970036628 4:11742779-11742801 TTTACTCAGAGCAAATAATATGG - Intergenic
971011431 4:22440888-22440910 ATTAATCGTATCTCCTAATAAGG + Intronic
971821165 4:31557075-31557097 TTTAATAGTATCTACCAATAAGG - Intergenic
972356718 4:38286171-38286193 TTGACTGATACCTACTGATAGGG - Intergenic
973311982 4:48719791-48719813 TTCACTGATATCTACCAAAATGG + Intronic
974690079 4:65287249-65287271 TTTACTCATATCACGTGATATGG - Intergenic
976062834 4:81149994-81150016 TTCACTGATATCTTCTAACAAGG - Intronic
978977779 4:114899577-114899599 TTTATTTACGTCTACTAATATGG + Intronic
979339737 4:119508048-119508070 TTTCTTCATATCCATTAATATGG - Intronic
982429493 4:155306105-155306127 TTTTCTCATATCTACAAGGAAGG - Intergenic
982724103 4:158887338-158887360 TTTACTAACTTCTACTATTAAGG + Intronic
983832287 4:172341893-172341915 TTTAGTCAAATGTACTAATAAGG - Intronic
983973829 4:173907885-173907907 GTTACTCAGATCTAAGAATAGGG + Intergenic
984082604 4:175266818-175266840 TTTACTCTCTGCTACTAATATGG - Intergenic
984526991 4:180869214-180869236 TATTCTCATATCTAGAAATATGG - Intergenic
986701247 5:10411241-10411263 TTTCTTCATATTTACTACTAAGG - Intronic
988105108 5:26735422-26735444 TTTCCTTTTCTCTACTAATAAGG + Intergenic
990115503 5:52385432-52385454 AATACTAATATCTAATAATAGGG - Intergenic
993224713 5:85152963-85152985 TTTAATCCTATCTAATAACATGG - Intergenic
993579144 5:89637694-89637716 CTTAATGATATCTTCTAATATGG - Intergenic
993659398 5:90612802-90612824 TTAACTCATAACTACAAATTTGG + Intronic
994454862 5:99992953-99992975 TATACTCATATTTACTAGTCAGG + Intergenic
994514051 5:100747486-100747508 TTTACTCAGATCTCCTAAGAAGG - Intergenic
994872638 5:105372631-105372653 TTTACTCAAAAATACTGATAAGG + Intergenic
995306611 5:110658429-110658451 TTTATTCATAACTACCAAGAAGG - Intronic
995426825 5:112033684-112033706 TTTATACATATATGCTAATATGG - Intergenic
997460005 5:134045568-134045590 TTGTCTCATCTCTTCTAATATGG + Intergenic
1000383329 5:160648461-160648483 TTTACTCACATCTGTTACTATGG + Intronic
1001721893 5:173863753-173863775 TTTACTCATTTTTACAAATAAGG - Intergenic
1003074260 6:2970179-2970201 TTTCCACATATGTAATAATAAGG - Intronic
1008153254 6:47982402-47982424 TTTACACATATGAACAAATAAGG - Intronic
1008415342 6:51233399-51233421 TTGACTCATATCTAGGGATATGG + Intergenic
1008949134 6:57135809-57135831 TTTACTCAAATATCCAAATATGG - Intronic
1008957111 6:57227723-57227745 TTTATTTATATGTACAAATAAGG - Intergenic
1009721259 6:67472714-67472736 TGTATTCATATTTACTAATATGG - Intergenic
1010508560 6:76689463-76689485 TTTACTCATGCCTTCTTATAGGG + Intergenic
1011096406 6:83669956-83669978 TTTACATATATCTATTTATACGG + Intronic
1011910541 6:92431775-92431797 TTTATTCATATTTTTTAATATGG + Intergenic
1012304462 6:97635162-97635184 TTTTCTTATATTTACTAATATGG + Intergenic
1012600128 6:101086349-101086371 TATAGTCATATCTAGTAATCAGG + Intergenic
1012819239 6:104064110-104064132 TTTACGCACATCTATTAATGGGG + Intergenic
1015227822 6:130878398-130878420 CTTACTCATAGATAATAATATGG - Intronic
1015304534 6:131692534-131692556 TTTACTCATATCTACTAATATGG + Intronic
1016549973 6:145268913-145268935 TTTACTCATATATAAAAATTGGG + Intergenic
1018375933 6:163212645-163212667 TTTATTCATTTATATTAATATGG - Intronic
1020545699 7:9527325-9527347 TGTACTAATATCTTCTTATAAGG - Intergenic
1020954010 7:14716815-14716837 TTTTCTCCTATCTTCTAATCTGG - Intronic
1021073959 7:16277655-16277677 TAAACTCATATCTAATATTAGGG - Intronic
1022065532 7:26851867-26851889 TTTATTCATATCTAATAAGTCGG - Intronic
1022147647 7:27561905-27561927 TTTACTAATATCTAATAAATGGG - Intronic
1023226641 7:37976382-37976404 TCTACTCTCATCTACTTATAAGG - Intronic
1025015016 7:55432365-55432387 GTTTCTCATATCTATAAATAAGG - Exonic
1026539270 7:71266228-71266250 TTTACTCACATCTGCCGATATGG + Intronic
1027468412 7:78543354-78543376 TTTAGACAGATCTGCTAATAGGG - Intronic
1028309375 7:89311491-89311513 TAGACTAATATTTACTAATAAGG - Intronic
1028698507 7:93746619-93746641 TTCACAAATATCAACTAATAGGG - Intronic
1028791529 7:94858921-94858943 TTTACTCATAGCAACCAAGAGGG - Intergenic
1029465900 7:100724438-100724460 TTTAGTCACATCTACTCATGAGG - Intergenic
1031109484 7:117589520-117589542 TTATCTCATTTCTATTAATATGG + Intronic
1031116506 7:117674682-117674704 TTTTCTCTTATCTCCTAATTGGG + Intronic
1031222765 7:118992953-118992975 ATTGTTCATATCTATTAATATGG + Intergenic
1032675190 7:134123679-134123701 ATTACTCATAAATATTAATATGG + Intergenic
1033970760 7:147035849-147035871 TTTTCTCAAATTTACTATTATGG - Intronic
1035827297 8:2658349-2658371 ATTCCTCATAACTATTAATAGGG + Intergenic
1038914927 8:32010416-32010438 TTTTCTTATATCTAGAAATAGGG + Intronic
1039666315 8:39534513-39534535 CTTACTTATACCTAATAATATGG - Intergenic
1040088747 8:43372933-43372955 TTTACTCATTTCCAATAAGAAGG + Intergenic
1040563863 8:48548551-48548573 TTTCCTCATTTGTACTCATAGGG + Intergenic
1043507816 8:80920059-80920081 TTTACTCATATTTAGGAATGAGG + Intergenic
1043669786 8:82868859-82868881 TATTTTCATATATACTAATATGG - Intergenic
1043739726 8:83795669-83795691 TTTTCTAATGTCTAATAATATGG + Intergenic
1044267276 8:90197488-90197510 TGTACTCTTATCTATTAATGCGG + Intergenic
1044334295 8:90960625-90960647 ATTACTTATATCTTATAATAAGG + Intronic
1046243980 8:111534192-111534214 TTTATTCATATCTTATAATCTGG + Intergenic
1054954542 9:70893629-70893651 TATACTCCTATCTACTGAAAAGG + Intronic
1055535779 9:77242211-77242233 ATATCTCATATCTACCAATAAGG - Intronic
1056015467 9:82381665-82381687 TTTTTTAATATCTAATAATAAGG - Intergenic
1059172714 9:112141359-112141381 TCTAATCATGTCTACTCATATGG - Intronic
1188660286 X:32750748-32750770 TTTACTTATACCTACTGATATGG + Intronic
1189208899 X:39266118-39266140 TTTACTCATGTCTCCTATTATGG - Intergenic
1189399490 X:40653613-40653635 TTTGCTCATTTCTAATATTAAGG - Intronic
1189636355 X:43014414-43014436 TTTCCCCAAATCTAATAATATGG - Intergenic
1189756796 X:44280301-44280323 TTTGCTCATATTTCCTAATTGGG - Intronic
1194027119 X:88765971-88765993 TATACTCATATCAAATAAAATGG + Intergenic
1194656412 X:96579381-96579403 TTTACTCACATCTACAAGTTAGG + Intergenic
1196069130 X:111499960-111499982 TTTACTTATGGCTTCTAATATGG + Intergenic
1199116866 X:144002742-144002764 TTGACTGATAGCTACTATTAGGG + Intergenic
1199570163 X:149259354-149259376 TCTACTCATATCTTCTAGTTTGG - Intergenic
1199589582 X:149454766-149454788 TTGACTCATATAATCTAATACGG - Intergenic