ID: 1015304956

View in Genome Browser
Species Human (GRCh38)
Location 6:131697106-131697128
Sequence AAGGGTAAAGAGAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1232
Summary {0: 1, 1: 1, 2: 5, 3: 108, 4: 1117}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015304950_1015304956 0 Left 1015304950 6:131697083-131697105 CCAGCAGTAGCTCTAGGGCAAGG 0: 1
1: 0
2: 0
3: 12
4: 136
Right 1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG 0: 1
1: 1
2: 5
3: 108
4: 1117
1015304945_1015304956 23 Left 1015304945 6:131697060-131697082 CCGGCCTGAGCACCTTTTTAAAG 0: 1
1: 1
2: 2
3: 32
4: 322
Right 1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG 0: 1
1: 1
2: 5
3: 108
4: 1117
1015304946_1015304956 19 Left 1015304946 6:131697064-131697086 CCTGAGCACCTTTTTAAAGCCAG 0: 1
1: 0
2: 3
3: 14
4: 186
Right 1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG 0: 1
1: 1
2: 5
3: 108
4: 1117
1015304947_1015304956 11 Left 1015304947 6:131697072-131697094 CCTTTTTAAAGCCAGCAGTAGCT 0: 1
1: 0
2: 3
3: 20
4: 193
Right 1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG 0: 1
1: 1
2: 5
3: 108
4: 1117
1015304944_1015304956 28 Left 1015304944 6:131697055-131697077 CCGTGCCGGCCTGAGCACCTTTT 0: 1
1: 0
2: 0
3: 9
4: 186
Right 1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG 0: 1
1: 1
2: 5
3: 108
4: 1117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015304956 Original CRISPR AAGGGTAAAGAGAAGGAGGC AGG Intronic
900409776 1:2507344-2507366 AAGGCTACAGAGATGCAGGCTGG + Intergenic
900704730 1:4073251-4073273 AAGGGGAAAAAGAAGGAGAGTGG + Intergenic
900932906 1:5747861-5747883 AAGGGAAAGGGGAGGGAGGCAGG + Intergenic
901560836 1:10068980-10069002 AAGAGTTAAGAGACAGAGGCAGG - Intronic
902797657 1:18809902-18809924 AAGGGAAGAAAGAAGAAGGCAGG + Intergenic
902837808 1:19058165-19058187 GAGGGGGAAGAGAAAGAGGCTGG + Intergenic
902960615 1:19960685-19960707 AAGGGCAAGAAGAAGGCGGCAGG - Intergenic
903165597 1:21518204-21518226 AAGAGTGACGAGAAAGAGGCTGG + Intronic
904224890 1:29008492-29008514 AATGGTAGAGAGGATGAGGCAGG + Intronic
904240682 1:29142833-29142855 AAGAGTGAAGAGAAGGAGGTTGG - Intergenic
904389402 1:30171916-30171938 AAGGGAAAGGGGAAGAAGGCTGG + Intergenic
904512114 1:31020055-31020077 AAAGGGAAAGGGAAGGAGGGAGG - Intronic
904900051 1:33849980-33850002 AAGGGTAAAGAGGAGGAGGCAGG - Intronic
904967827 1:34392463-34392485 AAAGGTAGAGAGAAAGAAGCAGG - Intergenic
905069914 1:35216579-35216601 AAGAGAAAAGAGAAAGAGGCGGG - Intergenic
905078438 1:35295327-35295349 AAGGGCAAAGATTATGAGGCAGG + Intronic
905269752 1:36779826-36779848 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
905543062 1:38775467-38775489 TAGGGTAAAGAAGAGGAGGAAGG - Intergenic
905704358 1:40043077-40043099 AAGAGTAAAGATACGGAGGCAGG + Intronic
905835816 1:41119841-41119863 GAGGGAAAAAAGGAGGAGGCAGG - Intronic
905906634 1:41622778-41622800 CAGGGGAAAGGGAAGGTGGCTGG + Intronic
906340305 1:44973862-44973884 AAGGTTATAGAGATGGAGGGTGG + Intronic
906615280 1:47229385-47229407 AGGGGTGGAGAGAAAGAGGCAGG + Exonic
907307415 1:53521046-53521068 AAGGACTGAGAGAAGGAGGCAGG + Intronic
907357856 1:53891127-53891149 AAGGGGAGAGAGAAGGAGGGGGG + Intergenic
907393733 1:54175442-54175464 AAGGGCAGAGAGAAGGATCCTGG - Intronic
907706815 1:56839612-56839634 ATGGGTACAGAGTGGGAGGCTGG + Intergenic
907835734 1:58106865-58106887 AAGGAGAAAGGGAAGGAGGAAGG - Intronic
908245926 1:62227760-62227782 AAGGGGACAGAGAGGCAGGCGGG - Intergenic
908290028 1:62656640-62656662 AAAGGTATAGAGAAAAAGGCTGG + Intronic
908528265 1:65008670-65008692 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
908555852 1:65255502-65255524 AAGGGGAAAGAGAGGGATGCAGG + Intronic
909356776 1:74718638-74718660 AAGGGTAACTAGAAGGAGAGAGG - Intronic
909813653 1:79962762-79962784 AAAGGAAAAGAGAAGGAGAAAGG + Intergenic
910283421 1:85526867-85526889 AAGTGAGAAGAGAAGGAGGGAGG + Intronic
911480912 1:98439355-98439377 AAAAGTGAAGAGAAGAAGGCAGG + Intergenic
911757485 1:101575892-101575914 AAGAGTAAACAGCCGGAGGCAGG + Intergenic
912155344 1:106911845-106911867 AAGGGAAAAGAGAAGAAGGCAGG - Intergenic
912157375 1:106938434-106938456 ATGGGAAAAGAGAAGGATGCTGG - Intergenic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
912323053 1:108732715-108732737 AAGAGAAAAGAGAGGGAGGGAGG - Intronic
912643499 1:111369539-111369561 TAGGGTGAGGAGAAGGGGGCAGG - Intergenic
912667395 1:111594519-111594541 AAGGGGAAAGGGAAGAAGGAAGG + Intronic
912735648 1:112147194-112147216 AAGGAGAAAGAGAGGGAGGGAGG - Intergenic
912782426 1:112564217-112564239 AAGGGAAAAGGAAAGGAGGCTGG + Intronic
912881583 1:113422041-113422063 AAGGGTAAAGAGAGAGAGATGGG - Intronic
912918023 1:113837149-113837171 AAGAAGAAAGAGAAGGAAGCAGG + Intronic
912957154 1:114163329-114163351 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
913653492 1:120940154-120940176 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
913673109 1:121116553-121116575 AAGGATGGAGGGAAGGAGGCGGG - Intergenic
913988343 1:143585716-143585738 AAGGGAGGAGAGAAGGAGGGAGG + Intergenic
914087365 1:144465223-144465245 AAGGGCAAAGAGAAGGTAGGAGG + Intergenic
914167605 1:145188874-145188896 AAGGGTAAAAAGAAAAAGGAGGG + Intergenic
914206594 1:145536121-145536143 AAGTGAGAAGAGAAGGAGGGAGG - Intergenic
914311246 1:146468980-146469002 AAGGGCAAAGAGAAGGTAGGAGG - Intergenic
914519183 1:148400278-148400300 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
914643676 1:149634313-149634335 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
914678769 1:149924136-149924158 AAGGGTATAGAAAATAAGGCTGG + Intronic
914788489 1:150854881-150854903 AAGGGGAAAGAGAGGGAAGGAGG + Intronic
914916639 1:151823099-151823121 ACGGGGAAAGAGAAGGGTGCTGG + Intronic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915720225 1:157979135-157979157 AAGGGGACAGGGAAGCAGGCTGG - Intergenic
915929340 1:160049433-160049455 ATAGGTAAAGACAAGGAGGAAGG - Intronic
915974246 1:160374786-160374808 AAGAGACAAGAGAGGGAGGCAGG - Intergenic
915977122 1:160398901-160398923 AAGGGTTAAGGGAAGTAGGGAGG - Intergenic
916160627 1:161909300-161909322 AAGGAGAAAGGGAAGGAGGAGGG + Intronic
916324198 1:163538906-163538928 AAGGGAATAAAGAAGGAGGCTGG + Intergenic
917104277 1:171476732-171476754 AGGGGTTGAGAGAAGTAGGCAGG - Intergenic
917177005 1:172246430-172246452 ATGGGAAAAGACAAGAAGGCTGG + Intronic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917452885 1:175161862-175161884 AAGGGTAATGAGGAAGAGGAAGG - Intronic
917487769 1:175470277-175470299 AAGTGAAAAGAAAAGAAGGCAGG + Intronic
917600277 1:176566733-176566755 AAGTGCAAAAAGGAGGAGGCAGG - Intronic
917830639 1:178881325-178881347 AAGGGTAAGGAAAAGTATGCTGG + Intronic
917856917 1:179108580-179108602 AAGGGTAAAGAGAAGAATGGTGG - Exonic
917881328 1:179339488-179339510 GAGGATAAAGAGAATGAGGAGGG - Exonic
917940610 1:179916985-179917007 AGGGATAAAGAAAAGGATGCAGG - Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918002679 1:180512476-180512498 AAGGGCAAGAAGAAGGGGGCAGG + Intergenic
918057047 1:181031174-181031196 AAGGAGAGAGAGAAGGAGGGAGG - Intergenic
918132267 1:181639875-181639897 ATGAGTAAAGAGAAGGGGGTTGG + Intronic
918187211 1:182138670-182138692 TAGGGCACAGAGAAGGTGGCAGG + Intergenic
918460308 1:184769730-184769752 AAGTGGAAAGAGAAAGAGGAAGG + Intergenic
918540615 1:185627986-185628008 AAGGCTAAAAAGAGGGAGGCTGG - Intergenic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
919741046 1:200981824-200981846 TAGGGGAGCGAGAAGGAGGCTGG + Intronic
919867441 1:201793038-201793060 CAAGGTAAAGGGAATGAGGCCGG - Intronic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920110500 1:203583857-203583879 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920110526 1:203583962-203583984 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920654711 1:207867081-207867103 AAGGGTAACTAGAAGGATGGTGG - Intergenic
920805039 1:209224968-209224990 AAAGGGAAAGAGAAGGAGAATGG - Intergenic
920843607 1:209575544-209575566 AATGGAAGAGAGAAGGAGGGTGG + Intergenic
921165290 1:212502562-212502584 AAGGGTGAGGAGAAGAAGGAGGG + Intergenic
921593465 1:217029793-217029815 AAGTGAAAAGAAAAGGAGTCAGG + Intronic
921599110 1:217088755-217088777 AAGGGAAAAGAAAGGGAGGAGGG + Intronic
921945641 1:220884258-220884280 AAGGACAAGGACAAGGAGGCTGG + Exonic
922334456 1:224607366-224607388 AAGGGAAAAGAGCAGGCAGCAGG + Intronic
922653820 1:227363705-227363727 AAGTGGAAAAAGAATGAGGCCGG + Intergenic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922717654 1:227885647-227885669 ATGGGTAAAGAGAGGGCAGCAGG + Intergenic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
923112467 1:230902875-230902897 AAGGGCGAAGGCAAGGAGGCTGG + Intergenic
923509794 1:234640625-234640647 AGGGGGAGAGAGAAGGAGGGAGG + Intergenic
923946994 1:238899176-238899198 AATGGGAGAAAGAAGGAGGCTGG + Intergenic
924196805 1:241616164-241616186 AAGGGAATAGAGGAAGAGGCAGG - Intronic
924202567 1:241675070-241675092 AAGGATGAAGGGAGGGAGGCAGG - Intronic
924350001 1:243105707-243105729 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
1063112338 10:3047897-3047919 GAGGGGAGAGAGAAGCAGGCAGG - Intergenic
1063250011 10:4264037-4264059 AAGGGTCAAGAGAGGGAAGCAGG - Intergenic
1063480053 10:6367507-6367529 AAGGGAGAAGAGAAGGGTGCAGG + Intergenic
1063534224 10:6867065-6867087 AAAGAGAAAGAGAAGGAGGGAGG - Intergenic
1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG + Intergenic
1065666739 10:28071272-28071294 AGGTGTAAAGAGAAGTAGGGTGG + Intronic
1065881390 10:30040483-30040505 AAGGCAAATGAGAACGAGGCTGG - Intronic
1065882676 10:30050018-30050040 AAGGGTAAAGAAATGGGGCCAGG + Intronic
1066409216 10:35149739-35149761 AAGAGGAAAGAAAAGCAGGCTGG - Intronic
1066549383 10:36538537-36538559 AAGAGAGAAGGGAAGGAGGCAGG + Intergenic
1066601366 10:37110957-37110979 AAGGGTAGAGAGGAAGAGGCAGG + Intergenic
1067460406 10:46454056-46454078 AAGGGAAGAGAGAGGGAGGATGG + Intergenic
1067626786 10:47930547-47930569 AAGGGAAGAGAGAGGGAGGATGG - Intergenic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068590589 10:58849009-58849031 GGGAGTACAGAGAAGGAGGCTGG - Intergenic
1068762107 10:60723912-60723934 TAAGGTAAAGAAATGGAGGCTGG + Intronic
1069250943 10:66266064-66266086 AAGGGAAAAGAGAGAGAGGAAGG + Intronic
1069344381 10:67450630-67450652 GAGGGTAGAGAGTAGGAGGAGGG + Intronic
1069821335 10:71230534-71230556 GAGGGCAGAGAGAAGGTGGCTGG - Intronic
1069914229 10:71777550-71777572 AAGGGCAAGGAGAAGAAAGCAGG - Intronic
1070148254 10:73789930-73789952 AGGGAGAAAGAGACGGAGGCAGG - Intronic
1070429084 10:76318270-76318292 AAGGAAAAAGAAAAGGAGGGAGG - Intronic
1070586345 10:77769735-77769757 AAGTGGAAAGAGCAGGAGCCAGG - Intergenic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1071736417 10:88305502-88305524 AATGGAAAAGAGAAGAAAGCAGG + Intronic
1072085638 10:92076794-92076816 AAGGAGAAAGAGGAGGAGGAGGG + Intronic
1072276587 10:93829284-93829306 AAGGGGAAAGAGAAAGAGAGTGG - Intergenic
1072443361 10:95477123-95477145 AAGGGAAAAGAGGAGGAGGTCGG - Intronic
1072657831 10:97342780-97342802 AATGGTAAAGAGAAGGCATCAGG - Intergenic
1073050580 10:100664559-100664581 AGGGGAGAAGAGAAGGGGGCAGG + Intergenic
1073433279 10:103500654-103500676 AAGCGTAAGGGGGAGGAGGCTGG - Intronic
1073547196 10:104360624-104360646 GAGGGTGAAGAGTAGGAGGAGGG - Intronic
1073840547 10:107494396-107494418 AAGGGAAAAGAGAATGAAGGTGG - Intergenic
1073886838 10:108049350-108049372 TAGGGTAAAGAGATCAAGGCTGG + Intergenic
1074672200 10:115804455-115804477 AAGAGCAAAGAGCAGGAGCCAGG - Intronic
1074813929 10:117130893-117130915 AAGGAGAAAGAGCAGGAAGCTGG + Intronic
1074829452 10:117238674-117238696 AAGGGGAAAGGGAGGGAGGGGGG - Intergenic
1075212405 10:120502345-120502367 AAGGGGGAAGAGAAGGAGGGAGG + Intronic
1075575069 10:123572057-123572079 AAGGGAAAAGGGAAAGTGGCAGG + Intergenic
1075596506 10:123734117-123734139 AAAGGGAAAGAGATGGAGGAAGG - Intronic
1075987893 10:126803809-126803831 GAGGGGAAAGGGAAGGAGGCAGG - Intergenic
1076077507 10:127547154-127547176 GAAGGTAAAGAGAAGGAATCAGG - Intergenic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076304856 10:129458806-129458828 AAGGACAAAGAGAGGGAGACAGG - Intergenic
1076493610 10:130881783-130881805 AAGGGTGAAGACAAGCAGGAAGG - Intergenic
1076819042 10:132929492-132929514 AAAGGTAAAGAGAAACGGGCAGG + Intronic
1076833720 10:133009573-133009595 AGGAGGAAAGAGAAGGAGGTGGG + Intergenic
1077013474 11:390104-390126 AGGGGTCAAGGGAAGGAGGATGG + Intergenic
1077209179 11:1360531-1360553 AAGGTTGATGACAAGGAGGCTGG - Intergenic
1077359041 11:2132464-2132486 AAGGGAGAAGAGAAAGAGGGGGG + Intronic
1077871431 11:6265535-6265557 AAGATTAAAGAGGTGGAGGCTGG + Intronic
1078095288 11:8292662-8292684 AGGGCCCAAGAGAAGGAGGCAGG + Intergenic
1078108206 11:8371862-8371884 AAAAATAAAGAGAAGGAGGGAGG - Intergenic
1078173047 11:8944419-8944441 AAGGGGTTAGAGAAGGAGGAGGG - Intergenic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1078697015 11:13644546-13644568 AAGGCAAAAAGGAAGGAGGCAGG + Intergenic
1078839857 11:15068536-15068558 AAGGGTACAGAGAAGCAGGCTGG + Intronic
1079035335 11:17014901-17014923 ACAGGGGAAGAGAAGGAGGCTGG - Intergenic
1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG + Intronic
1079292436 11:19200477-19200499 AAGGAAAGAGAGAAGGAGGGAGG - Intronic
1079465006 11:20721783-20721805 AAGGGTAAAGAGAAGGACTTTGG + Intronic
1079492403 11:21003586-21003608 CAGAGTATAGAGAAGGAGACAGG - Intronic
1079549769 11:21680431-21680453 AAGGGTAAAGAAGAGGAGAAAGG + Intergenic
1079602871 11:22331029-22331051 TTGGGTAGAGAGATGGAGGCAGG - Intergenic
1079826421 11:25201034-25201056 AAGGAGAAAGAGAGGGAGGGAGG + Intergenic
1080036856 11:27719772-27719794 AGGGGGAAAGAGAGGGAGGGAGG + Intronic
1080157406 11:29127913-29127935 AAGGGGAAAGGGAAGGAGAAGGG + Intergenic
1080159778 11:29159912-29159934 AAGAGAAAAGAGGAGGAGGATGG + Intergenic
1080232922 11:30037868-30037890 AAGAGACAAGAGAAGGAGGGAGG + Intergenic
1081019158 11:37921823-37921845 GAAGGTAAACAGAAAGAGGCAGG - Intergenic
1081394531 11:42569873-42569895 AAGGGTAAAGGGATGGAGAGTGG - Intergenic
1081611341 11:44565258-44565280 AAGGAGAAAGTGAAGGAGGCGGG + Intronic
1081634367 11:44711163-44711185 CAGGGTAGAGAGGAGGAGGGAGG + Intergenic
1081686664 11:45047799-45047821 AAGGGTAAAGTTCTGGAGGCAGG - Intergenic
1081701083 11:45153251-45153273 AAGGGAACTGAGAAGGAGCCAGG + Intronic
1081760975 11:45576328-45576350 ACAAGCAAAGAGAAGGAGGCTGG + Intergenic
1081884578 11:46483902-46483924 AAAGGTAAAAAGAAGGAGGTAGG + Intronic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1082892430 11:58154195-58154217 AAGGGGGAGGAGAAGGAGGAAGG + Intronic
1083477022 11:62921403-62921425 AAAGGGAAAGAGAGGGAGGGAGG + Exonic
1084347671 11:68566313-68566335 AGGAGGAAAGAGAAGGAGGAAGG - Intronic
1084695036 11:70747973-70747995 AAGAGGAGAGGGAAGGAGGCAGG + Intronic
1084724434 11:70931654-70931676 AAGGGGCAAGAGAAGGTGTCTGG + Intronic
1085295046 11:75426731-75426753 AAGGGTTAAGGGAAGGCAGCAGG + Intronic
1085326604 11:75611132-75611154 AAGGATAGAGGGAAGGAGGGAGG - Intronic
1085935236 11:81133712-81133734 AAGAGGAAAGAGAATGAGTCTGG + Intergenic
1086314705 11:85579232-85579254 AAGGGTGAAGGGTAGGAGGAGGG + Intronic
1086610125 11:88745500-88745522 AAGAGTAAAGAGTATCAGGCTGG - Intronic
1086644265 11:89199707-89199729 AAGATTACAGAGAAGGTGGCAGG - Intronic
1086846024 11:91750700-91750722 AAGGGGAAAGGGAAGGAAGGGGG - Intergenic
1087037277 11:93768050-93768072 AAAGGCAAAGGGAAGCAGGCAGG - Intronic
1087078446 11:94147584-94147606 AACAGAAACGAGAAGGAGGCTGG - Intronic
1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG + Exonic
1087728128 11:101746447-101746469 AAGGGTGAAAAGGAGGAGGGAGG - Intronic
1088563913 11:111147215-111147237 AAGAGTAAAGAGATCAAGGCTGG + Intergenic
1088618795 11:111661345-111661367 GAGGGAAAAGAAAAGGAAGCAGG + Intronic
1088735329 11:112723738-112723760 AAGGGTAAGGGGAGGGAGGATGG + Intergenic
1088736498 11:112732066-112732088 AGGTGTAAAGAGAAGGAAGCTGG + Intergenic
1089028605 11:115298376-115298398 AAGAAGAAAGGGAAGGAGGCAGG + Intronic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1089333707 11:117708082-117708104 TAGGGCACAGAGAGGGAGGCAGG - Intronic
1089385797 11:118066989-118067011 AGGGATTAAGAGAAGGATGCAGG - Intergenic
1089459030 11:118641970-118641992 AAGGGCAAAGAGAAACAGTCAGG - Intronic
1089528665 11:119112871-119112893 TTAGGTAAAGAGAAGGAGCCTGG + Exonic
1089668359 11:120034510-120034532 ATGGGGAGAGAGAAGGAGGCAGG - Intergenic
1090854600 11:130600657-130600679 AAGGCGAAAGAGAAGCAGGCAGG + Intergenic
1090952262 11:131484050-131484072 AAAGGTAATGAGCAGGAGGAGGG + Intronic
1091061591 11:132468099-132468121 AAGCAGAAAGAGAGGGAGGCTGG - Intronic
1091192573 11:133707356-133707378 AAGGGGAAAGAGAAGGGGAAAGG + Intergenic
1091217658 11:133913075-133913097 AAGGGGAAAGAGAAAAAGACAGG + Intronic
1091406837 12:214433-214455 AAGGGCAAGGAGGAGGAGGAGGG - Intronic
1091618874 12:2070919-2070941 AAGGGGAAAGGGAAGGAAGGAGG - Intronic
1091618904 12:2071026-2071048 AAGGGGAAAGGGAAGGAAGGAGG - Intronic
1091618926 12:2071098-2071120 AAGGGGAAAGGGAAGGAAGGAGG - Intronic
1092231586 12:6778558-6778580 AAGGGGAAGGTGAGGGAGGCTGG - Intergenic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092560408 12:9607239-9607261 AAAGAAAAAGAGAAGGAGGAAGG - Intronic
1092617393 12:10227693-10227715 AAAGGAAAAGAAAATGAGGCAGG - Intergenic
1092873921 12:12831999-12832021 AGGAGTAAAGAGTAGGAGGCAGG + Intergenic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1092961135 12:13597894-13597916 AAGGGCAGAGAGAAATAGGCAGG + Intronic
1093017652 12:14170979-14171001 AAGGGTAAAGGGAAGGGGGAGGG + Intergenic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1093318288 12:17678938-17678960 AAAAGAAAAGAGAAGGAGGGAGG + Intergenic
1093461101 12:19407596-19407618 AAGAAAAAAGAGATGGAGGCTGG - Intronic
1094004752 12:25737667-25737689 AAGGGTACAGAGATGGTGCCAGG - Intergenic
1094171261 12:27494813-27494835 AAGGCCAAAGGGAAGGAGGAAGG - Intronic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094404834 12:30106433-30106455 GAGGCTACAGAGAAGGAAGCTGG - Intergenic
1094727383 12:33133999-33134021 AAGGGTAAGAAGAAGAGGGCAGG + Intergenic
1095114147 12:38332005-38332027 AAGAGTAAACAAAAGAAGGCAGG - Intergenic
1095232983 12:39764100-39764122 AATGGTAAAAAGATGTAGGCAGG - Intronic
1095326779 12:40904311-40904333 AAGGAAAAAGAGAAGAGGGCTGG - Intronic
1095540125 12:43299919-43299941 AAGGGGAAGGAGGAGGAGGTGGG + Intergenic
1095547449 12:43388326-43388348 GAGGGTGAACAGAAGCAGGCAGG - Intronic
1095619804 12:44238372-44238394 AAGGGAAAATAGAAGGAAGGAGG + Intronic
1095650581 12:44604189-44604211 AAGAAGAAAGAGAAGGAGGGAGG + Intronic
1095694476 12:45129192-45129214 AAGAAAAAAGAAAAGGAGGCCGG + Intergenic
1096046663 12:48568466-48568488 TGGGGTAAGGAGAAGGAGGATGG + Intronic
1096509977 12:52122263-52122285 AAGGTGAAGGTGAAGGAGGCTGG + Intergenic
1096732455 12:53625740-53625762 AAGGGTAATAGGAAGGAGGTAGG - Intronic
1097006826 12:55925827-55925849 AAGAGTAAAGAGAAGTATACTGG + Intronic
1097705235 12:62861636-62861658 ATGGTTATAGAGAAAGAGGCAGG + Intronic
1098840470 12:75471530-75471552 AAGGGCAAAGAGAAGCAGCATGG + Intergenic
1098908493 12:76185860-76185882 GGGGGTGAAGAGAAGGTGGCAGG - Intergenic
1099157900 12:79202521-79202543 AAGAAGAAAGAGAAGGAGTCAGG + Intronic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1099924156 12:88997016-88997038 AAGGGAAAAGAGAGGGAGGGTGG + Intergenic
1099942836 12:89210438-89210460 AAAGGAGAAGAGAAGGAGACAGG + Intergenic
1100593384 12:96050543-96050565 AAGGGGAAAGGGAAGGAGGGAGG + Intergenic
1101124481 12:101617204-101617226 CCAAGTAAAGAGAAGGAGGCCGG + Exonic
1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG + Intronic
1101693578 12:107103484-107103506 AAGGGAATAGAGAAGGATGAGGG - Intergenic
1102090660 12:110184592-110184614 AAGGGTAAAGGGAAGGGAGCAGG + Intronic
1102143648 12:110637646-110637668 AAGAGGAGAGAGAAGGAGACTGG - Intronic
1102641951 12:114374584-114374606 TCTGGTGAAGAGAAGGAGGCAGG + Intronic
1102737864 12:115179170-115179192 AAGGGAGAAGGGAAGGAGGAGGG + Intergenic
1102746427 12:115253095-115253117 AAGGGTAAAGTAAATGAGACAGG + Intergenic
1102764721 12:115422918-115422940 AAGGGAGGAGAGAAGGAGGAAGG + Intergenic
1103455126 12:121059537-121059559 AAGGATGAAGTGAAGGATGCCGG - Intergenic
1103956796 12:124581960-124581982 AAGGGAAAGTAGAAGGAGGTAGG + Intergenic
1104111759 12:125710906-125710928 AAGGGAAAAGGGAAAGAGCCTGG + Intergenic
1104172519 12:126295900-126295922 AAGGAAAGAGAGAAGGAGGGAGG + Intergenic
1104232898 12:126902585-126902607 AAAGGGAAAGAGAAAGAGGGAGG - Intergenic
1104900047 12:132184737-132184759 CAGGGTGGAGAGAAGCAGGCTGG - Intergenic
1105202441 13:18191740-18191762 AAAGATAGAGAGAAGCAGGCAGG - Intergenic
1105277551 13:18944535-18944557 AGGGGTAAGGATGAGGAGGCTGG - Intergenic
1106009080 13:25800739-25800761 ATGGGTGGAGACAAGGAGGCAGG - Intronic
1106041360 13:26096840-26096862 AAGGAGAAAGAGAAGGAAGAGGG - Intergenic
1106264366 13:28096885-28096907 AAGATTAAAGAGATGGAGGTAGG - Intronic
1106299408 13:28450506-28450528 AAGGGAGAAGGGAAGGAGGGAGG + Intronic
1106525318 13:30535470-30535492 AATGGTAAAGAGAAGCATGGAGG - Intronic
1107002376 13:35564026-35564048 GAGGGTAGAGGGAAGGAGGAAGG - Intronic
1107011654 13:35676479-35676501 AAGGGTGGAGAGCAGGGGGCAGG - Intergenic
1107333094 13:39322747-39322769 AAAGGAAGAGAGAAGGAGGAAGG + Intergenic
1108426207 13:50303975-50303997 GAGGGTAGAGAGCAGGAGGAAGG - Intronic
1109374818 13:61478603-61478625 GAGGGTAAAGGGAGGGAGGAAGG - Intergenic
1109799582 13:67358706-67358728 AGGGGGAAAGAGAAGAAGGAAGG - Intergenic
1109873995 13:68374120-68374142 AAAGGAAAAGAGAGGGAGGTAGG + Intergenic
1109878968 13:68446036-68446058 AAGGGTTAAGAGTAGAAGTCAGG + Intergenic
1109961164 13:69633965-69633987 ATGGGGAAAGAGAAGGAAGTGGG - Intergenic
1110207767 13:72937080-72937102 ACGGGTTAAAAGAAGAAGGCTGG - Intronic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1110582494 13:77147552-77147574 AAGGGTAGAGAGAAGGAAGGGGG - Intronic
1111251606 13:85608633-85608655 AAGGGTAAGGAGAAGAGGGCGGG - Intergenic
1111714482 13:91862967-91862989 AAGGGGAAAGAGAAGGAGAAAGG - Intronic
1112889478 13:104212568-104212590 AAGGGTAGAGACACGGAGGGAGG + Intergenic
1113278978 13:108767658-108767680 AAGAGTGAAGGGAAGAAGGCAGG + Intronic
1113316757 13:109188790-109188812 AATGTTCAAGAGAAGGAAGCAGG + Intronic
1113375194 13:109758936-109758958 AAGGGGAAAGGGAAGGAGAAGGG + Intronic
1113522965 13:110953652-110953674 AAAGGTAAAGGGGAAGAGGCTGG + Intergenic
1113972450 13:114200302-114200324 CTGGGGACAGAGAAGGAGGCTGG - Intergenic
1113975668 13:114225627-114225649 GAGGGAGAAGAGAAGGAGGGAGG + Intergenic
1114170029 14:20262884-20262906 AAGGGCAAAGGGAAGGAGGGAGG + Intronic
1114467938 14:22937836-22937858 AAGCCTATAGAGAAGGAGGGAGG - Intergenic
1114500464 14:23164693-23164715 TGGGGAAAAGAAAAGGAGGCAGG + Intronic
1114548536 14:23520334-23520356 AAGGGGGAAGAAAAGGAGACTGG + Intergenic
1114562187 14:23601367-23601389 TAGAGTGAAGAGAGGGAGGCTGG - Intergenic
1114675312 14:24436384-24436406 AAAGGTAAAGGGCAGCAGGCTGG - Exonic
1114796086 14:25716672-25716694 GAGGGTTGAGAGGAGGAGGCAGG + Intergenic
1114906408 14:27133272-27133294 GAGGGTAAGGAGAAGGGGGATGG - Intergenic
1115163574 14:30423295-30423317 AATAGTAAAGTGAAGGAGGGTGG - Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115648031 14:35383886-35383908 AAGGGTAAACTGAGGGAGGGAGG + Intergenic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1116575370 14:46567798-46567820 AAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1116695047 14:48164289-48164311 AAGGGTAATCAGAAGAAGCCTGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117903503 14:60560396-60560418 AAGGGTGCAGAAAAGGAAGCTGG + Intergenic
1118041566 14:61922531-61922553 GAGGGTAGAGAGTAGGAGGAGGG + Intergenic
1118179152 14:63473884-63473906 AAAGGTAAAGAGAAGGAACCTGG + Intronic
1118294575 14:64557408-64557430 AAGGGGAAAGAGAAGGAGAAGGG + Intronic
1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG + Intronic
1118357530 14:65027071-65027093 AAAGGCAAGGAGGAGGAGGCTGG + Intronic
1118361587 14:65061844-65061866 AAGGGAAAAGAGCTGGAGGTGGG + Exonic
1118533909 14:66737229-66737251 AAGGGGAAAAAGAAAGAGGAAGG - Intronic
1118964869 14:70571390-70571412 AAGTGCAGAGAGAAGGTGGCGGG - Intergenic
1118990741 14:70794971-70794993 AAAGGAAAAGAAAAAGAGGCTGG - Intronic
1119180384 14:72601044-72601066 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1119456478 14:74760353-74760375 AAAGGAAAAGGGAAGGAGGGAGG - Intergenic
1119999852 14:79290411-79290433 AAGGGAAAGGAGGAGGAGACAGG + Intronic
1120241405 14:81953624-81953646 TAGTGTAGAGAGAAGGAAGCAGG - Intergenic
1120336101 14:83157065-83157087 AAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1120913673 14:89690743-89690765 AAGGGCAAAGAGGAGGAAGCAGG + Intergenic
1121166883 14:91810352-91810374 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
1121724925 14:96140274-96140296 GAGGGTAAAGAGAAGGGAGATGG - Intergenic
1121889092 14:97572507-97572529 AAGGGTTAAGTAAATGAGGCAGG - Intergenic
1122227336 14:100287365-100287387 AAGGGCAGAGAGAAGGGGGCAGG - Intergenic
1122392789 14:101401803-101401825 AAGAGGAAAGAGAAGGAGAAGGG - Intergenic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1122507081 14:102238570-102238592 AGGGGTAATGAGGAGGAGGGAGG - Intronic
1122566985 14:102666134-102666156 AAAGATAAAGAGAAGGAAGTGGG + Intronic
1122640096 14:103154788-103154810 AAGGGGAAGGGGAAGGTGGCAGG + Intergenic
1123107064 14:105846596-105846618 AAGGGAGAAGGGAAGGAGGATGG - Intergenic
1123213659 14:106785415-106785437 AATGCAAAAGTGAAGGAGGCTGG - Intergenic
1123736377 15:23188189-23188211 AAGGGGAAAGCGAAGGAGAAAGG - Intergenic
1124287083 15:28411166-28411188 AAGGGGAAAGCGAAGGAGAAAGG - Intergenic
1124295618 15:28500463-28500485 AAGGGGAAAGCGAAGGAGAAAGG + Intergenic
1124534071 15:30529389-30529411 AAGGCTAAAAAGAAGGAAGAGGG - Intergenic
1124764576 15:32478221-32478243 AAGGCTAAAAAGAAGGAAGAGGG + Intergenic
1124862378 15:33454852-33454874 AAGGCTATAGAGAAGAGGGCAGG + Intronic
1125065894 15:35486134-35486156 AAGGCAAAGGAGAAGCAGGCAGG + Intronic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125402385 15:39318010-39318032 AAAGGTAAGGAGGAGGAGGAGGG - Intergenic
1125496281 15:40197476-40197498 AAGGGTACAGAAAATGAGGTAGG + Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1126471087 15:49011541-49011563 ATGGTTAAAGAGAAGGGGACAGG - Intronic
1126859803 15:52872737-52872759 AAGGGTCAAGTGAATGAGGAAGG - Intergenic
1127397207 15:58552446-58552468 GAGGGCAGAGAGGAGGAGGCGGG - Intronic
1127767730 15:62203898-62203920 AAGGGGGAAGAGAAGGAGAGGGG - Intergenic
1128454551 15:67825366-67825388 GGGGGTGAAGAGAAGGAGGGGGG - Intronic
1128681841 15:69658089-69658111 GTGGGTCAAGAGATGGAGGCAGG - Intergenic
1128733129 15:70034273-70034295 AATGGTGCAGAGAGGGAGGCAGG + Intergenic
1128867417 15:71125107-71125129 AAGGGGAAAGGGAAGGAGAAAGG + Intronic
1129887043 15:79045778-79045800 AAGGGGGAAGAGAAGGACACAGG + Intronic
1130408507 15:83624421-83624443 AAGCGCAAAGAGCAGGAAGCGGG + Intergenic
1130567347 15:85008063-85008085 AGAGGTCAAGAGAAGGTGGCAGG + Intronic
1130717776 15:86352780-86352802 AAGAGTAAAGAAAAAGTGGCTGG - Intronic
1130888162 15:88111020-88111042 AGGGGTAAAGAGATGGGGACTGG + Intronic
1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG + Intergenic
1133203104 16:4216783-4216805 AAGGGGAAAGGGATGCAGGCTGG + Intronic
1133547878 16:6825708-6825730 AAGAGGAAAGGGAGGGAGGCAGG + Intronic
1133569621 16:7027916-7027938 AAGGGAAAAGAGAAGGAAGGAGG + Intronic
1133656722 16:7872090-7872112 AAGGAAAAAGGGAAGGAGGGAGG - Intergenic
1133882363 16:9794928-9794950 AAGGATGAAGAGGAGGAGGAGGG + Intronic
1134124467 16:11606933-11606955 AAGGATACAGTGAAGTAGGCCGG - Intronic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1134861161 16:17561693-17561715 AAGGTAAAAGACAATGAGGCAGG - Intergenic
1135671501 16:24379561-24379583 AAGGATAAAGATACTGAGGCTGG - Intergenic
1135728185 16:24873192-24873214 AAGGGAAAGGAGAAGAAGGAAGG + Intronic
1135795971 16:25442858-25442880 AAGGGAAAGGAGAAGGAGAAGGG - Intergenic
1135795975 16:25442876-25442898 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1135938744 16:26803019-26803041 AAGGAAGAAGAGAAGGAGGAAGG + Intergenic
1135973473 16:27089324-27089346 AAGGGTAGAGAGAAGAAGGTAGG + Intergenic
1135976009 16:27109406-27109428 GAGGGAAAAGGGAAGAAGGCAGG + Intergenic
1136343815 16:29662926-29662948 AAGGGTGCAGAGGAGGAGGTGGG - Intergenic
1136385587 16:29923876-29923898 AAAAGTAAAGAAAAGAAGGCCGG + Intronic
1136536547 16:30902989-30903011 AAGAGTTAAGAGAACGGGGCAGG - Exonic
1136574498 16:31115517-31115539 GGGGGGAAAGAAAAGGAGGCTGG - Intergenic
1136695282 16:32074858-32074880 AATGGAAGAGTGAAGGAGGCTGG + Intergenic
1136795781 16:33018115-33018137 AATGGAAGAGTGAAGGAGGCTGG + Intergenic
1136874137 16:33836265-33836287 AATGGAAGAGTGAAGGAGGCTGG - Intergenic
1137039626 16:35598938-35598960 AAGGAGAAAGAGAAGGCAGCAGG - Intergenic
1137273814 16:46920251-46920273 AAGGGGAAAGAGCAGGAGTTTGG + Intronic
1137727159 16:50664858-50664880 AAAGGAAAATGGAAGGAGGCTGG - Intergenic
1138011711 16:53386814-53386836 AAAGGTAGAGAAAAGCAGGCTGG - Intergenic
1138312246 16:56037131-56037153 TAGGGAAAAGAAAAGAAGGCAGG - Intergenic
1138339063 16:56276737-56276759 AAGGCTAAATAAAAGGAGGGAGG + Intronic
1138339863 16:56281569-56281591 AAGGGGACTGAGAAGGAGGGAGG - Intronic
1138564813 16:57825264-57825286 AGGGACAAAGAGAAGGAGCCTGG - Intronic
1138835410 16:60428870-60428892 GAAGGGAAAGAGAAGGAGGATGG + Intergenic
1138988513 16:62361525-62361547 AAGGGGAGAGAGAGGGAGGGAGG + Intergenic
1139025354 16:62810249-62810271 AAGGAGAGAGAAAAGGAGGCAGG - Intergenic
1139375726 16:66495307-66495329 AAGGATCAAGGGAAGGAGGGAGG - Intronic
1139449578 16:67018736-67018758 AAGAAAAAAGAAAAGGAGGCAGG + Intergenic
1140406486 16:74714530-74714552 AAGGGGAAGGAGATGGAGGTGGG - Intronic
1140832803 16:78767073-78767095 AAGGAGAGAGAGAAGGAGGGAGG - Intronic
1140931794 16:79634751-79634773 ACAGGTAAAGAGAAGGATTCAGG + Intergenic
1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG + Intergenic
1140959654 16:79899802-79899824 AAGGGAGAAGAGAAAGAGGAGGG - Intergenic
1140970427 16:80007238-80007260 AAAGGTAGAGAGAAGGATGGTGG - Intergenic
1140998945 16:80289837-80289859 AATGTTAAAGGGAAGGAAGCTGG + Intergenic
1141103713 16:81216131-81216153 AAGGTCAGAGAGATGGAGGCAGG + Intergenic
1141141657 16:81500382-81500404 AAGGAGAGAGAGAAGGAGGAAGG - Intronic
1141372844 16:83503447-83503469 AGGGGCAGTGAGAAGGAGGCCGG + Intronic
1141796477 16:86278709-86278731 AAGGGTATAGTGAGGGAGGTTGG - Intergenic
1141877176 16:86833815-86833837 AAGGGAAAAGAAACGAAGGCCGG + Intergenic
1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG + Intronic
1141934776 16:87229953-87229975 AAGGGCAAGGACAGGGAGGCAGG - Intronic
1142399394 16:89851435-89851457 AAGGGGCAGGAGAATGAGGCTGG - Intronic
1203098039 16_KI270728v1_random:1279770-1279792 AATGGAAGAGTGAAGGAGGCTGG + Intergenic
1142784584 17:2210585-2210607 ATGGGGAAAGAGAAAGAGGAGGG + Intronic
1143015949 17:3891371-3891393 AAGGATCAAGAGAAAGGGGCTGG + Intronic
1143060323 17:4195243-4195265 AAGGGTAAAGAGAAAGAACCAGG - Intronic
1143606288 17:7988286-7988308 AAACATACAGAGAAGGAGGCCGG - Intergenic
1143687978 17:8534531-8534553 AAGGGCAAATGGAAGCAGGCAGG - Intronic
1143902003 17:10181430-10181452 AAGGGTAAAGAAGAGGATGGGGG + Intronic
1143913487 17:10271718-10271740 AAAGGTAAAAAGATGCAGGCTGG + Intergenic
1143980356 17:10863867-10863889 AAGGGGAAAAAGAAAGAGGAAGG - Intergenic
1144499727 17:15775539-15775561 AAGGAGAAAGGGAAGGAGGAAGG - Intergenic
1144694740 17:17295144-17295166 AAGAAAAAAGAGAATGAGGCCGG - Intergenic
1144741414 17:17584608-17584630 AAAGGTAAAGAAAAGGAAGATGG - Intronic
1145124018 17:20285766-20285788 AAGGGGAGAGAGAAGGAGGGAGG - Intronic
1145897643 17:28469744-28469766 TAGGGTAAGGAGGAGGAGTCAGG + Intronic
1147041329 17:37721594-37721616 ATGGGAAAAGAGAAGCAGCCGGG - Intronic
1147055406 17:37830545-37830567 AGGGGGAAAGAGTAGCAGGCAGG + Intergenic
1147497669 17:40933235-40933257 AAGAGGAAAAAGAATGAGGCAGG - Intronic
1147584503 17:41646167-41646189 AGGGACAGAGAGAAGGAGGCAGG - Intergenic
1147632392 17:41940439-41940461 AAGAGGAAAGGGCAGGAGGCAGG - Intronic
1147725575 17:42564408-42564430 AAGGGTAAAAAGAGGGAAGGAGG - Intronic
1147890048 17:43710781-43710803 AAGGGCAAAGAGAGGGAGAAAGG + Intergenic
1147947293 17:44087254-44087276 AAGGGGAGTGGGAAGGAGGCCGG - Intronic
1148006402 17:44434304-44434326 AAGGGGAAAGAAAAAGGGGCAGG + Intronic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148202384 17:45757896-45757918 AAGAGTAAAGAGAAAGAGCCAGG + Intergenic
1148354592 17:46967515-46967537 AAGGGCGAAGAGAAGGAGAGAGG + Intronic
1148564038 17:48622731-48622753 AAGGGCAAAGGAAAGGAGGGAGG + Exonic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1149182229 17:53952912-53952934 AAGAGCAAAGAAAAGGAGCCAGG + Intergenic
1149273165 17:55004726-55004748 AGGGGGAAGGAGGAGGAGGCGGG + Intronic
1149362913 17:55912760-55912782 ACAGCTAAAGAGAAGAAGGCAGG - Intergenic
1149910971 17:60566404-60566426 AAGGGTAAACACCAGGAGGCAGG - Intronic
1150250746 17:63703204-63703226 AAAGTTAAATAGAATGAGGCTGG + Exonic
1150430350 17:65110689-65110711 AAGACAAAAAAGAAGGAGGCCGG - Intergenic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150551087 17:66210905-66210927 AAGGGTGAGGAGAAGGAAGGTGG + Intergenic
1150628600 17:66859822-66859844 AAGGGGGAGGAGAAGGAGGAGGG - Intronic
1150702276 17:67458193-67458215 AAGGAAAAAGAGGAGGAAGCAGG - Intronic
1150789657 17:68193118-68193140 AAGGGTAGGGAAAAGGAGGATGG - Intergenic
1150985846 17:70196225-70196247 ATGGGAAGAGAGAAGGTGGCTGG + Intergenic
1151170448 17:72241403-72241425 AAGGGTAAAAAGTAGGAGTTAGG + Intergenic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1151498326 17:74473117-74473139 AAGGGTAAGGGAAAGGAGGCAGG + Intronic
1151652103 17:75476398-75476420 AAGAGGAAAGAGAAGGAGGGAGG - Intronic
1151920093 17:77148168-77148190 AAAGGGAAAATGAAGGAGGCGGG + Intronic
1152261586 17:79270119-79270141 AATGGCAAAGGGAAGGAGGACGG - Intronic
1152715062 17:81895513-81895535 CAAGGTCAAGAGATGGAGGCCGG + Intronic
1152715081 17:81895592-81895614 CAAGGTCAAGAGATGGAGGCCGG + Intronic
1152834905 17:82523146-82523168 AAGGGCAGTGAGATGGAGGCTGG + Intronic
1153503333 18:5770602-5770624 TAGGGTAAAGAGGATGAGGGGGG + Intergenic
1153563313 18:6394063-6394085 AAGGGTAGTGAGAAGGAGAGGGG - Intronic
1153776118 18:8455751-8455773 AAGGACAAAGAGAAGAGGGCAGG - Intergenic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1153883967 18:9446688-9446710 AAAGGAAAAGAGAGGGAGGGAGG - Intergenic
1154345800 18:13542644-13542666 CAGGGAGAAGATAAGGAGGCGGG + Intronic
1155125027 18:22865836-22865858 AAGCATAAACAGTAGGAGGCAGG - Intronic
1155249329 18:23940154-23940176 AAGGGGACAGAGATGGGGGCAGG + Intronic
1156090468 18:33462007-33462029 AAGGGTCCAGAGAAAGAGCCTGG + Intergenic
1156461090 18:37321694-37321716 GAGGGGCAAGAGGAGGAGGCGGG + Intronic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1157327346 18:46678668-46678690 AAGGAGAAAGGGGAGGAGGCAGG + Intronic
1157496836 18:48162215-48162237 AAGGCTGCAGGGAAGGAGGCTGG - Intronic
1157604832 18:48919533-48919555 TAGGGTAATGGGAAGGAGACAGG - Intergenic
1157888337 18:51390127-51390149 AAGGGTGGAGAGAAGAAGGCAGG - Intergenic
1157895206 18:51460082-51460104 AAGGGGAAAGATAAGGATGGAGG - Intergenic
1159121312 18:64175089-64175111 AAGGGTAGAGAGAAAGAGAGAGG - Intergenic
1160076310 18:75680814-75680836 AAGGGTAATGATAAGGACACAGG + Intergenic
1160259667 18:77280542-77280564 AAGGGTCAGGAGACAGAGGCAGG - Intergenic
1160879849 19:1314409-1314431 AGGGGTAGAGGGAGGGAGGCAGG + Intergenic
1161093406 19:2375056-2375078 AAGGGGATAGAGTTGGAGGCAGG - Intergenic
1161541016 19:4851640-4851662 AAGGGGGAAGAGGAGGAGGGCGG + Intronic
1161899874 19:7110403-7110425 GAGGGAAAAGAGATGAAGGCAGG - Intergenic
1162227638 19:9237199-9237221 AAGGGAAAAGAGAAGTAAGAAGG - Intergenic
1162275456 19:9650478-9650500 ATGTGAAAAGAGAAGGGGGCGGG + Intronic
1162783528 19:13020168-13020190 AGGGGAGAAGAGAAGGAGGCTGG + Intronic
1162876782 19:13626590-13626612 AAGGGGAAAGGGAAGGGGGAAGG + Intergenic
1162911623 19:13850767-13850789 AAGAGTCAAGAGTAAGAGGCAGG - Intergenic
1163491197 19:17618068-17618090 AAGGGTAGAGGGAAGGATGGGGG - Intronic
1164103455 19:22080425-22080447 AAGTGTAAGGTGAAGGAGCCAGG - Intronic
1164196285 19:22965577-22965599 AATTCTAAAGAGAAGGAGGAAGG - Intergenic
1164441704 19:28284492-28284514 AAGGGGAAAGAGGAGGTGGAGGG + Intergenic
1164441814 19:28284865-28284887 GAGGGTGGAGAGAAGGAGGGTGG + Intergenic
1164564303 19:29314921-29314943 CAGGGTGGAGAGGAGGAGGCTGG + Intergenic
1164574853 19:29399925-29399947 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
1164587441 19:29484866-29484888 CAGGGAAAAGAAAAGGGGGCTGG - Intergenic
1164914354 19:32038388-32038410 ATGGGTAAAGAGAAAAAGCCAGG - Intergenic
1164918094 19:32067955-32067977 AAGGGTAAGGAGAAGCAAGAAGG - Intergenic
1164937087 19:32223404-32223426 AAGGATAGAGGGAAGGAGGGAGG + Intergenic
1165084926 19:33337911-33337933 GAGGAAAGAGAGAAGGAGGCCGG + Intergenic
1165177392 19:33940247-33940269 AAGGGGAAAGGCAGGGAGGCTGG - Intergenic
1165580838 19:36862155-36862177 AAAGATAAAGAGAAGTTGGCCGG - Intronic
1165663263 19:37601636-37601658 AAGGGTAAAGAGATAGAGTTTGG + Intronic
1165821697 19:38680768-38680790 AGGAATAAAGAGAAGGAGGAAGG - Intronic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166090049 19:40502957-40502979 CAGGGTAAAGGGACGGAGGGCGG + Intronic
1166273561 19:41734561-41734583 AAGTGTAATGAGAAGAAAGCAGG + Intronic
1166278630 19:41774404-41774426 AAGTGTAATGAGAAGGAAGTAGG + Intergenic
1166282590 19:41804411-41804433 AGGCGTAAAGAAAAGGAGGAAGG + Intronic
1166964429 19:46519693-46519715 AAATGTAAAGACACGGAGGCTGG + Intronic
1167011840 19:46813709-46813731 GAGGTGAGAGAGAAGGAGGCGGG - Intergenic
1167086362 19:47312380-47312402 AAAGATAAGGAGAAGGAGGCTGG - Intronic
1167212642 19:48143018-48143040 ATGGGGACAGAGAAGGGGGCTGG + Intronic
1167345721 19:48944504-48944526 AAGGGTAAGGATATGGATGCGGG + Exonic
1167713157 19:51124667-51124689 AAGGGCATTGAGAGGGAGGCAGG + Intergenic
1167758895 19:51430983-51431005 AAAGAGAAAGAGTAGGAGGCTGG - Intergenic
1167846357 19:52168074-52168096 AAGAGGAAAGAAAAGGAGTCAGG - Exonic
1167880956 19:52456924-52456946 AAGAGGAAAGAAAAGGAGTCAGG + Exonic
1167888593 19:52522152-52522174 AAGAGGAAAGAAAAGGAGCCAGG + Intergenic
1167896842 19:52588575-52588597 AAGGGCAAAGAAAAGGAGCCAGG + Intergenic
1167942090 19:52956043-52956065 AAGAGCAAAGAAAAGGAGCCAGG - Exonic
1167944980 19:52980907-52980929 AAGAGCAAAGAAAAGGAGCCAGG - Intergenic
1167958349 19:53086278-53086300 AAGAGGAAAGAAAAGGAGTCAGG - Exonic
1168025430 19:53640294-53640316 AAAGGGAAAGAGACAGAGGCCGG + Intergenic
1168109199 19:54182051-54182073 AAGGGAAAAGGGAAGGACGGAGG + Intronic
1168251571 19:55145308-55145330 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1168304469 19:55427995-55428017 AAAGGTAAAAAGGAGGTGGCAGG - Intergenic
1168433809 19:56302326-56302348 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
925188727 2:1866564-1866586 AAGGGGAGAGAGAGAGAGGCAGG + Intronic
925435281 2:3831920-3831942 AAGAGGAAAGTGAAGAAGGCAGG - Intronic
925474481 2:4197634-4197656 AAGGGCACAGATGAGGAGGCAGG + Intergenic
925749494 2:7074821-7074843 AAGGGAAGAAAGAAGGAGGGGGG + Intergenic
925910245 2:8569251-8569273 AAAGGGAAAGAGAAGGAGGGAGG + Intergenic
926105444 2:10146721-10146743 AAGGGTAGGGAGGAGGAGGAGGG + Intronic
926306577 2:11641400-11641422 AACAGAAGAGAGAAGGAGGCAGG + Exonic
926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG + Intergenic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927785675 2:25972838-25972860 GAGGGGAAAGAGAAAGAGGTGGG - Intronic
928644042 2:33332997-33333019 AAGGGTAGAGCTAGGGAGGCAGG + Intronic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
929660472 2:43779393-43779415 AAGGAGAAAGAGAAGGCAGCAGG - Intronic
929789543 2:45013099-45013121 AGGGAAAAAGAGAAGGGGGCGGG + Intergenic
930084063 2:47480221-47480243 AAGGGGGAAGGGAAGGAGGAAGG - Intronic
930084071 2:47480240-47480262 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
930175042 2:48292966-48292988 AGGGGCAAAAAGAAGGAGGCTGG + Intergenic
930258946 2:49123002-49123024 AAGGATAAAGGAAAGGAGGGAGG - Intronic
930307624 2:49695104-49695126 ACTAGTAAAGAGAAGGAGGCAGG - Intergenic
930443146 2:51434605-51434627 AAAAGTAAAGGGATGGAGGCTGG + Intergenic
930556787 2:52906260-52906282 AAGGGGAAGTAGAAGGAGGCTGG - Intergenic
930606570 2:53499199-53499221 CGGGGAAAAGAGAGGGAGGCAGG + Intergenic
930897395 2:56462207-56462229 AGGTGTAAAGAGGCGGAGGCTGG - Intergenic
931169832 2:59790974-59790996 AAGGGAAAGGCGAGGGAGGCTGG + Intergenic
931231158 2:60375989-60376011 AAGGGAAAGCAGGAGGAGGCAGG + Intergenic
931246778 2:60498678-60498700 ATCAGTAAAGAGAAGGAAGCAGG + Intronic
931444848 2:62318040-62318062 AAGGGTAAAGTGAAGCGGCCGGG + Intergenic
931455310 2:62405432-62405454 AATGGCAGAGAGCAGGAGGCAGG - Intergenic
931691470 2:64837990-64838012 AAGGGAAAGGAAAAGGAAGCAGG + Intergenic
931786332 2:65622425-65622447 AGGGGAAAAGAGAATGAGGAGGG + Intergenic
931891941 2:66682812-66682834 AAGGACAAAGAGAAGAAGGCAGG - Intergenic
932168282 2:69528650-69528672 GAGGGTAAAAAGAAGGAAGGAGG + Intronic
932439335 2:71722070-71722092 ATGGGTAGAGAGAAGGGGACAGG - Intergenic
932488631 2:72104246-72104268 AAGTTTAAAGGGAAGGTGGCAGG - Intergenic
932529638 2:72515185-72515207 AAGGGAAAAGAGAAGGTCCCAGG + Intronic
932734405 2:74244495-74244517 AAGGGGAAAGAAAAGAAGGAAGG - Intronic
933209553 2:79551273-79551295 AAGGGGAAAGAGAAGGCAACAGG + Intronic
933727350 2:85434388-85434410 AGGGGAGAAGAGAGGGAGGCAGG + Intronic
933740853 2:85532800-85532822 AAAGATAAAGAGAGGGAGGGAGG - Intergenic
933982951 2:87568480-87568502 AAAGGAAAAGAGGAGGGGGCAGG - Intergenic
934655709 2:96116069-96116091 GATGGTAAAGAGAATGAGGAAGG + Exonic
934855353 2:97725855-97725877 AAGTGCAAAGATCAGGAGGCAGG + Intronic
936310890 2:111382315-111382337 AAAGGAAAAGAGGAGGGGGCAGG + Intergenic
936664521 2:114578959-114578981 AAAGGTCAAAAAAAGGAGGCTGG - Intronic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937213809 2:120297410-120297432 CAGGGTCAAGAGATGGTGGCAGG - Intergenic
937489406 2:122350113-122350135 AATGGAAAACAGAAGAAGGCAGG - Intergenic
937619616 2:123970719-123970741 AAGGGGAAAGAGAAGGAAAGAGG + Intergenic
938043430 2:128095425-128095447 AAGGAGGAAGAGAAGGAGGAGGG - Intronic
939039554 2:137171820-137171842 AAGGATGAAGAGAGGGAGGGAGG - Intronic
939162281 2:138604760-138604782 AAAGGCAAGGAGGAGGAGGCAGG + Intergenic
939232035 2:139440157-139440179 AAGGGAGAAGAGAAAGAGGGAGG - Intergenic
939307254 2:140427339-140427361 AAGGGTAAAGACACGGAGAAGGG - Intronic
939589875 2:144051808-144051830 AAGGGCAAAGAAAAGGCGGAGGG + Intronic
939820063 2:146946643-146946665 GAGGGTGGAGAGAAGGAGGAGGG + Intergenic
939870889 2:147524620-147524642 AAGGGTAGCTAGAAGGAGGAAGG + Intergenic
939945831 2:148409432-148409454 AAAGGAAAAGGGAAGGAGGGAGG + Intronic
940019878 2:149145634-149145656 AAGGGAGAAGGGAGGGAGGCTGG - Intronic
940312571 2:152294034-152294056 TAGGGTAGAGAGGAGGAGTCAGG - Intergenic
940853904 2:158714960-158714982 AAAGGTAGAGGGAAGAAGGCAGG - Intergenic
941282283 2:163567922-163567944 AAGGAGAGAGAGAAGGAGGGAGG + Intergenic
941736318 2:168980923-168980945 CAGGGTAGAGAGGAGGAGACTGG - Intronic
941760650 2:169238925-169238947 AAGGGGAAAGAGAAAGTGGAGGG - Intronic
942468811 2:176238430-176238452 AAGGGTAAATATAAGGAGGGGGG - Intergenic
942490277 2:176483054-176483076 AAAGGGAAAGAGAAGGTTGCAGG + Intergenic
942613048 2:177761998-177762020 TAGGGTCAACAGCAGGAGGCGGG + Intronic
942839497 2:180342077-180342099 AAAGGAAAATAGAAGGATGCTGG - Intergenic
942942232 2:181631778-181631800 AAGGGGAAAGAGAAGGAAATGGG + Intronic
942997009 2:182275138-182275160 GAGGGTCAAAAGAGGGAGGCAGG + Intronic
943173526 2:184435570-184435592 AAGAGTAAAGAGAATGTGGAAGG + Intergenic
943177245 2:184492386-184492408 AAGGGTGGAGGGAAGGAGGTTGG + Intergenic
943549105 2:189316589-189316611 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
943699259 2:190972053-190972075 GGGGGTAAAGAGAGGGAGGGAGG + Intronic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944094058 2:195946726-195946748 CCGGGTGAAGAGAAGGAGGAAGG - Intronic
944316332 2:198289370-198289392 GAGGGGAAAGAGAAAGAGACAGG - Intronic
944483639 2:200181344-200181366 GAGGGAAAATAGAAGCAGGCAGG - Intergenic
944727939 2:202490745-202490767 AAGGGTAAAGAGTAGGATTAGGG + Intronic
945013102 2:205485813-205485835 AAGGATAAAGAGAGGGTGGCTGG - Intronic
945768300 2:214007964-214007986 AGGGGTGAAGAGAAGGAGGGAGG - Intronic
946025459 2:216669299-216669321 AAGGATTAAGAGAAGGAAGAGGG + Intergenic
946030204 2:216697622-216697644 AAGGGTAGAGAGAAGGGGGGAGG + Intergenic
946422668 2:219573513-219573535 GAGGGGGAAGAGAAGGAGGAGGG - Intronic
946558243 2:220883691-220883713 AAGGATAAAGAGAAGAATGGAGG + Intergenic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
946997125 2:225406210-225406232 AAGGGCATGGATAAGGAGGCTGG - Intronic
947082030 2:226409700-226409722 GAAGGCAAAGAGAAGGAGGCAGG + Intergenic
947098433 2:226592486-226592508 GAGGGTGAAGAGAAGCAGGGTGG - Intergenic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
947651181 2:231787148-231787170 AAGGGAAAAGAGAAGGGGAGAGG - Intronic
947744298 2:232499765-232499787 AAGGCTGAAGAGAGGGAGGCTGG - Intergenic
948087714 2:235265480-235265502 CAGGGTGAAGACAGGGAGGCTGG - Intergenic
948131127 2:235601299-235601321 AAGGAGAAAGAGATGGAGACAGG + Intronic
948546864 2:238738878-238738900 AAGGCTAAAGAAAAGAAGTCAGG - Intergenic
948790527 2:240374339-240374361 AAGGGACCAGAGAAGGAGGATGG + Intergenic
1168965285 20:1894850-1894872 GAGGGGAAAGGGAAGGAGGGAGG + Intronic
1169541628 20:6606108-6606130 AAGGGAAAAGGGAAGGAGGGCGG - Intergenic
1169950433 20:11037649-11037671 ATAGGTTAAGAGAAGGAGGGAGG + Intergenic
1170440984 20:16378421-16378443 AAGGGGAAAGAGAGGGAGACAGG + Intronic
1170550683 20:17473519-17473541 AAGGTTAAATAGGAGGAGGTTGG - Intronic
1172458090 20:35093147-35093169 ACGTGTAGAGAGAAGCAGGCAGG - Intergenic
1172591296 20:36119901-36119923 GAGGGTACAGAGGAGGAGGGCGG - Intronic
1173042220 20:39475191-39475213 AAGGGAAAAGGGAAGGAGGTTGG - Intergenic
1173064388 20:39696245-39696267 AAGGGGAAAGAGAGAGAGGGAGG + Intergenic
1173112831 20:40209957-40209979 AAGGGAAGAAAGGAGGAGGCAGG + Intergenic
1173363475 20:42365045-42365067 AAAGGCAAAGAGAAGCAGGTGGG + Intronic
1173661178 20:44734781-44734803 AGGGGTCAAGAGAGGAAGGCAGG - Intergenic
1174437219 20:50517858-50517880 AAAAGTAAAGAGAAGGAGACAGG - Intronic
1175069682 20:56322726-56322748 AGGAGAAACGAGAAGGAGGCAGG + Intergenic
1175140451 20:56857025-56857047 AAGGGAAAGGAGAAGGGAGCGGG + Intergenic
1175191910 20:57217053-57217075 AAGGGGAAAGGGATGGAGGCAGG + Intronic
1175723385 20:61300855-61300877 AAGGGTGAGGAGGAGGAGGTGGG - Intronic
1175843373 20:62045328-62045350 AAGGGTAGAGAGGAGCGGGCAGG - Intronic
1176695205 21:9968864-9968886 ATGGGGAAAGAGAAGGAGATTGG - Intergenic
1176715510 21:10346268-10346290 AAAGATAGAGAGAAGTAGGCAGG + Intergenic
1177112136 21:17041431-17041453 CAGGGTAAAGTGTAGGAGGGGGG - Intergenic
1177973020 21:27813778-27813800 AAGGAAAAAGAGAGGAAGGCTGG + Intergenic
1178422721 21:32455229-32455251 AAGGGGCAAGAGAAGGAGAGAGG + Intronic
1178808588 21:35860169-35860191 GAGGGAAAAGAGAGGGAGGGAGG + Intronic
1179215866 21:39366817-39366839 AAGGGGGAAGAGAAGGGGGAAGG - Intergenic
1179262086 21:39766200-39766222 AAGGAGAAAGAGAATGAAGCAGG - Intronic
1179292328 21:40029564-40029586 GAGGGTGGAGAGTAGGAGGCGGG + Intronic
1179524465 21:41966823-41966845 GAGGTTAGAGAAAAGGAGGCTGG - Intergenic
1179556100 21:42177465-42177487 AAGGGTAAAGGAAAGGACGCAGG - Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1179902405 21:44401012-44401034 GAGGAGAAAGGGAAGGAGGCAGG - Intronic
1180036881 21:45254688-45254710 AAGGGTGAACAGAGGCAGGCAGG + Intergenic
1180602838 22:17033685-17033707 AAAGATAGAGAGAAGTAGGCAGG - Intergenic
1180898546 22:19354558-19354580 AAGGGTCCAGAGAAGGTGGAAGG - Intronic
1181821310 22:25477824-25477846 TAGGGTCAATAGAATGAGGCAGG - Intergenic
1181866016 22:25855982-25856004 GAGGGTAAAGAGTGGGAGGAGGG - Intronic
1182058817 22:27382186-27382208 GAGGGCAGAGTGAAGGAGGCTGG + Intergenic
1182098064 22:27639089-27639111 ACGGCTAGAGCGAAGGAGGCGGG + Intergenic
1182173410 22:28256623-28256645 CAGGGTAAAAAGAACAAGGCTGG + Intronic
1182268156 22:29135481-29135503 AAGTGTGAAGAGAAGGAAGTGGG + Intronic
1182366249 22:29781347-29781369 AAGGGAAGAGAGTAGGAAGCTGG - Intergenic
1182641146 22:31768773-31768795 AGGGGTAGAGAGAGGGAGGGAGG - Intronic
1182775429 22:32827970-32827992 AGGGGAATAGACAAGGAGGCTGG - Intronic
1182886407 22:33777666-33777688 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1183020077 22:35019851-35019873 AAGAATAAAGACATGGAGGCTGG - Intergenic
1183296882 22:37035060-37035082 GAGGATTCAGAGAAGGAGGCAGG - Intergenic
1183547227 22:38460921-38460943 GAGGGTAAGGAGGAGGTGGCAGG + Intergenic
1183697120 22:39429776-39429798 AAAGGTAAAGAAAATGGGGCTGG - Intronic
1183970507 22:41474038-41474060 GAGGGTCAAAAGGAGGAGGCAGG + Intronic
1184135215 22:42544753-42544775 AAGGCCATAGGGAAGGAGGCAGG + Intergenic
1184449718 22:44575775-44575797 AAGGGGAAAGAAGAGGAGGAGGG + Intergenic
1184686503 22:46098763-46098785 AGGGGCAAGGAGCAGGAGGCCGG - Intronic
1184786331 22:46673718-46673740 CTGGGTAAAGAGGAGGACGCCGG + Exonic
1184975508 22:48058728-48058750 CAGGGTAAAGATAAGGTTGCGGG + Intergenic
1185006820 22:48282870-48282892 GAGGGAAAAAAGAAGGAGGGAGG + Intergenic
1185177876 22:49340354-49340376 AAGAAGAAAAAGAAGGAGGCTGG - Intergenic
1185304942 22:50109852-50109874 AAGAGAAAGGAAAAGGAGGCTGG + Intronic
949379749 3:3431493-3431515 AAGGTTAAAGGGGAGGAAGCAGG + Intergenic
949642514 3:6054205-6054227 ATGGGCAAAGAGAAGTAGGGTGG - Intergenic
949700130 3:6746956-6746978 AAGGCTACAGAGGAGGTGGCTGG - Intergenic
949926166 3:9043452-9043474 ATGGGTGAACAGAAGGGGGCAGG + Intronic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
950753908 3:15156064-15156086 AGGAGGAAAGGGAAGGAGGCAGG + Intergenic
950921351 3:16697846-16697868 CAGGGGGAAGAAAAGGAGGCAGG + Intergenic
951431946 3:22618394-22618416 AAGAGGAAAGAGAAGAAGGAAGG + Intergenic
951571669 3:24070488-24070510 AAGGGTAGAGGGTAGGAGGAGGG - Intergenic
951682064 3:25305273-25305295 AAGGAAAAAGAGAAAAAGGCTGG + Intronic
951795921 3:26538222-26538244 AAGGGGAAAGGGAAGGAGAAGGG + Intergenic
951858783 3:27227334-27227356 AAGGGGAAAGACATGGAAGCAGG + Intronic
952089295 3:29865015-29865037 AAGGGGAAGGAGAAGGAGGGAGG + Intronic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
952288260 3:31989104-31989126 AAGAGGAAAGAAAAGGAGCCAGG + Exonic
952354967 3:32575517-32575539 ATGAGTAAAGAAAAGGAGACTGG - Intergenic
952567577 3:34677942-34677964 AATGGCAAACAGAATGAGGCTGG - Intergenic
952647621 3:35680777-35680799 AAGAAGAAAGAGAAGGAGGGAGG - Intronic
952949811 3:38513691-38513713 AAGGAGAAAGGGAAGGAGGGAGG - Intronic
953055444 3:39383940-39383962 AAGGGAATTGAGAAGGGGGCAGG + Intronic
953115218 3:39986259-39986281 AAGTGTAACCAGAATGAGGCTGG - Intronic
953453432 3:43022710-43022732 AAGGGCAATGAGAAGGAGTGGGG + Intronic
953578950 3:44136135-44136157 AAGGGTAAAGGGGAGGAAGCAGG - Intergenic
953855558 3:46497133-46497155 AAGGAAAAAGGAAAGGAGGCTGG - Intergenic
953891154 3:46752527-46752549 AAGGGCAAAGGGCAAGAGGCTGG + Intronic
954334023 3:49905738-49905760 AAGGCTGTAGATAAGGAGGCTGG + Intronic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
954382954 3:50229314-50229336 AAGGACAAAGAAAAGGAGGGAGG + Intronic
954594298 3:51812263-51812285 AAGGGTAGAGGAAAGGAGGACGG - Intergenic
954958482 3:54543043-54543065 AAATGTAAAGAGAAAAAGGCTGG - Intronic
955033862 3:55247612-55247634 CAAGGTAAAGAGAAGGAGAAAGG - Intergenic
955086665 3:55709487-55709509 AAGGGTAAAGCAAAGGAGAACGG + Intronic
955525511 3:59815732-59815754 AAGGGAAAAGAGTGGGAGGGGGG + Intronic
955536142 3:59925558-59925580 GAGGGTAAAGAATAGTAGGCAGG - Intronic
955697240 3:61649120-61649142 AAGGGAAAAGGGAGGGAGGGAGG - Intronic
955933904 3:64083861-64083883 AAGGGTAAAGCAAGGCAGGCAGG + Intergenic
956313954 3:67913816-67913838 AGGGGAAAAGGGAAGGAGGAGGG - Intergenic
956828757 3:73024654-73024676 AAAGGAAAGGAGAAGGAGGGAGG - Intronic
957200217 3:77124832-77124854 AAAGGTAAAGGGAAGAAGGGAGG - Intronic
957220168 3:77372137-77372159 AAAGGGAAAGAGAAGGAAGGAGG + Intronic
957416934 3:79917461-79917483 AAGAGGGAAGAGAAGGAGGGAGG + Intergenic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
957888310 3:86320313-86320335 GAGGGTGAAGGGAAGGAGGAGGG - Intergenic
958903065 3:99910926-99910948 AAGGATGAAGAGATGGAGACTGG + Intronic
959007978 3:101042205-101042227 ATGGCTACAGAGAAGGAGGAAGG - Intergenic
959112635 3:102140275-102140297 AAGGAGAAAGAGAGGGAGGGAGG - Intronic
959290075 3:104462641-104462663 AAGTCTGAAGAAAAGGAGGCAGG - Intergenic
959454401 3:106541049-106541071 ACAGATAAAGAGAAGGAAGCAGG - Intergenic
959626315 3:108456119-108456141 AAGAGGAAAGAGAGGGAGGGAGG + Intronic
959705419 3:109334825-109334847 AAGTGTAAATAGAAGTAGGGTGG - Intronic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
960183771 3:114613986-114614008 AAGGATGAGGAGAAGGAGGTGGG - Intronic
960883231 3:122367134-122367156 AAGGATGAAGAGAAGGAGAGAGG + Intronic
960883236 3:122367157-122367179 GAGGGTGAAGAGAAGGAGAGAGG + Intronic
961025523 3:123552310-123552332 ATAGGGAAAGAGAAAGAGGCAGG + Intronic
961540976 3:127599162-127599184 AAGGGCAAAGATCTGGAGGCTGG + Intronic
961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG + Intronic
962401838 3:135067300-135067322 AAGGGCAATGAGGTGGAGGCAGG + Intronic
962694750 3:137937016-137937038 AGGGGAAAAGAGGATGAGGCAGG + Intergenic
963112540 3:141699259-141699281 AGGGGTAATGAGGAGGAGGGAGG + Intergenic
963207624 3:142652566-142652588 GAGGGCACAGAGTAGGAGGCGGG + Intronic
963471082 3:145742658-145742680 GAGGGGAAAGAGAAAGAAGCAGG - Intergenic
963511172 3:146251026-146251048 AAAGGGAAAGGAAAGGAGGCAGG + Exonic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
963994590 3:151693203-151693225 AATGGTAACCAGAAGGAGGAAGG - Intergenic
964617856 3:158688473-158688495 AAGGGTAAAGGGAAGGAAAGAGG - Intronic
964738597 3:159942141-159942163 AAGGAGAGAGAGAAGGAGGGAGG + Intergenic
964760492 3:160131033-160131055 AAGGGTCCAGGGAAGGAAGCAGG - Intergenic
965005282 3:163014089-163014111 AAGGGTTAAGAGAAAGGGGAAGG + Intergenic
965742794 3:171893843-171893865 AAGGAGAGAGGGAAGGAGGCAGG - Intronic
966060111 3:175743655-175743677 AAGGGTAGTGAAAAGGAGGTAGG + Intronic
967277979 3:187795314-187795336 AAGGAAGAAGAGAAGGAGGGAGG + Intergenic
967563251 3:190942754-190942776 AAGGGAAATAAGAAGGAGGGAGG - Intergenic
967687800 3:192437856-192437878 GTGGGCAAAGAGTAGGAGGCAGG - Intronic
967821678 3:193844528-193844550 AAGGAAAAAGAGAAAGGGGCTGG + Intergenic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968075993 3:195816401-195816423 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076105 3:195816820-195816842 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076118 3:195816864-195816886 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076156 3:195816998-195817020 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076170 3:195817042-195817064 CCCGGTAAGGAGAAGGAGGCCGG - Intergenic
968076181 3:195817081-195817103 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076205 3:195817165-195817187 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076218 3:195817209-195817231 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076267 3:195817387-195817409 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076305 3:195817520-195817542 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968181910 3:196601681-196601703 AAGGGAAAGGAGGAGGAAGCTGG - Intergenic
968808600 4:2790160-2790182 AAGGCCAAAGAGAAGGGGGCCGG - Intergenic
969114609 4:4863229-4863251 AGGGTTAAAGGGAAGGCGGCTGG - Exonic
969561194 4:7949531-7949553 AAGGGGAAAGAGGAAGAGGAAGG - Intergenic
969979526 4:11140470-11140492 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
970022683 4:11586909-11586931 AAGGATACAGAGAAGGAAGCAGG + Intergenic
970302519 4:14696419-14696441 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
970910665 4:21271090-21271112 TAGGGTAAAGAGAAGGATCTTGG + Intronic
971001951 4:22333150-22333172 AAGGTGAAGGAGAAGCAGGCAGG - Intergenic
971035875 4:22692428-22692450 AAGGTGGAAGAGAAGGAGGGAGG + Intergenic
971394283 4:26214302-26214324 AAGGAGACAGAGAAGGAGGGAGG + Intronic
971483411 4:27134705-27134727 AAAGACAAAGACAAGGAGGCCGG + Intergenic
972142088 4:35973322-35973344 AGGGGGAAAGGGAGGGAGGCAGG + Intronic
972422728 4:38904817-38904839 AAGAGTAAAGAGGATGAGACAGG + Intronic
972648726 4:40994855-40994877 AAGGAGAGAGAGAAGGAGGGAGG + Intronic
972787868 4:42344482-42344504 GGGGGTTCAGAGAAGGAGGCTGG + Intergenic
973529813 4:51825057-51825079 AAGGGTAGAGGGTAGGAGGTTGG - Intergenic
973963663 4:56137923-56137945 AAGGGTAAGGATAAGGAAGTGGG + Intergenic
973994134 4:56439531-56439553 AAGGGTAAAGAACAGTGGGCCGG - Intronic
974137067 4:57832223-57832245 AATAGTAAAAAGGAGGAGGCAGG - Intergenic
974570176 4:63635629-63635651 AAGGGTGAAGAGTGGGAGGAGGG + Intergenic
974745773 4:66073817-66073839 AAGAGAAAAGAGAAGAAAGCAGG - Intergenic
974799739 4:66801610-66801632 AAGGGAAAAAAGAGGCAGGCAGG - Intergenic
974802489 4:66836226-66836248 AAAGGGATAGAGAAGGAGGTTGG + Intergenic
975836048 4:78423032-78423054 AAGGGAAGAGATAAGGTGGCAGG - Intronic
975967576 4:79993236-79993258 AAGGGGAGAGAAAAGGAGGGAGG + Intronic
976408412 4:84685252-84685274 AAAGGTAAGGTGGAGGAGGCTGG + Intronic
976626972 4:87195599-87195621 AAGGGTAGAGAGAAGGCAGAAGG + Exonic
977048303 4:92094414-92094436 AAGGATAAAGAGAAGAGGGATGG - Intergenic
977307955 4:95348970-95348992 AAGGGTAGTGAGAGGGAGGGCGG + Intronic
977320706 4:95512070-95512092 ATGGGTCTGGAGAAGGAGGCAGG + Intronic
977711911 4:100135997-100136019 CATGGTAAAGGGCAGGAGGCAGG - Intergenic
978543068 4:109839603-109839625 AAGGGTAGAGGGAGGGAGGAGGG - Intronic
978599796 4:110415922-110415944 AAGAGCAAAGAAAAGGAGCCAGG + Intronic
979069771 4:116187133-116187155 AAGGGGAAAGAGAAGAAGGTAGG + Intergenic
979251941 4:118574840-118574862 AAGGGGAAAGAGCAGCAGGAGGG - Intergenic
979853542 4:125603389-125603411 AAGGAGAAAGGGAAGAAGGCAGG + Intergenic
980367836 4:131829092-131829114 ATGGGGAAAGAGAAGGAGATTGG - Intergenic
980726579 4:136769633-136769655 GAGGGTGAAGAGAAGGAAGTGGG - Intergenic
980896494 4:138865591-138865613 AATGATAAAGAGAAGGAGGAAGG + Intergenic
980945997 4:139320945-139320967 GAGGATAAAAAGAAGGTGGCTGG - Intronic
981138796 4:141242886-141242908 AAGAATAAAGAGAAGTTGGCTGG - Intergenic
981148512 4:141353860-141353882 ATTGGTAAAGAGGAGGATGCTGG - Intergenic
981241712 4:142484753-142484775 AAGGGTGGAGAGTAGGAGGAGGG - Intronic
981439195 4:144763258-144763280 AAGAGTAGAGAGAGGGAGGACGG + Intergenic
981735206 4:147942581-147942603 AAGGGGCAGGAGAAGGAGGACGG - Intronic
981766640 4:148258337-148258359 AAGGAAAGAGAGAAGGAGGCAGG + Intronic
981814005 4:148807656-148807678 AAGGGGAAGGGGAAGGAGGGTGG + Intergenic
982303459 4:153903802-153903824 ATGGGAAAAGGGAAGGTGGCTGG + Intergenic
982869176 4:160553952-160553974 ATGGGTACAGAGTAGGGGGCAGG + Intergenic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
983421283 4:167520591-167520613 AAGTGTACAGACATGGAGGCAGG - Intergenic
983531022 4:168809940-168809962 AAGTGTTAATAGAAGGAGGGTGG + Intronic
984376271 4:178934675-178934697 AAGGGAAATGAGAAGGAGAAAGG - Intergenic
984401495 4:179271421-179271443 AAGGGAAAAGAGAGGGAGGCAGG - Intergenic
984419111 4:179496850-179496872 AAGGAGAAAGAGGAGGAGGTGGG + Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
984703982 4:182834573-182834595 AGGGGAAAGGAGAAGGAGGAGGG - Intergenic
985141033 4:186840675-186840697 AAGGGAGGAGAGAAGGAGTCGGG - Intergenic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985385579 4:189444174-189444196 AAGGAGAAAGAGAAGGAGAAAGG - Intergenic
985781603 5:1874516-1874538 ATGGGGAGAGAGAGGGAGGCCGG + Intergenic
985929291 5:3043707-3043729 ATGGATAAAGAGATGGAGACAGG - Intergenic
986576318 5:9216803-9216825 AATGGAAAAGAGAAAAAGGCAGG - Intronic
986949373 5:13063161-13063183 ATGAGTAAAGTGAAGAAGGCAGG + Intergenic
987432166 5:17848091-17848113 GAGGGAAAAGAGAGTGAGGCAGG + Intergenic
987445737 5:18017101-18017123 AAAGTTAGAAAGAAGGAGGCAGG + Intergenic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988786890 5:34573287-34573309 AAGGGCAAAGAGAAGGCGAGAGG - Intergenic
988850396 5:35174737-35174759 AAGGGTAAAGTCAAGGTGGCTGG - Intronic
988907230 5:35802151-35802173 AAGAGTAAAGACAGAGAGGCAGG - Intronic
989069647 5:37497233-37497255 AAGGGAAAAGGGAGGGAGGAGGG - Intronic
989408269 5:41086725-41086747 AAGAGAAACCAGAAGGAGGCTGG - Intergenic
989601220 5:43202448-43202470 AGGGGTAAAGAGACAGTGGCAGG - Intronic
989665227 5:43846301-43846323 AAGGAAAAAGAGAGGGAGGAAGG - Intergenic
990322334 5:54642144-54642166 AAGGTCTGAGAGAAGGAGGCTGG + Intergenic
990427444 5:55700864-55700886 AAGGAGACAGAGAAGGAGGAGGG - Intronic
990755424 5:59064108-59064130 AAGGAAAGAGAGAAGGAGGGAGG + Intronic
990805953 5:59662094-59662116 CAGGGTAAAGAGCAAGAGGCTGG - Intronic
991100702 5:62789347-62789369 AAGGGTACAAAGCAGGAGGCAGG + Intergenic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
992154772 5:73944462-73944484 AAGGATAAAGAGCAGGAGTAGGG + Intergenic
992475417 5:77097142-77097164 AAGGAAGAAGAGAAGGAGGGAGG + Intergenic
992952356 5:81872855-81872877 AGAGGGAAAGAGAAGGAGGGTGG - Intergenic
993077647 5:83254381-83254403 AAGGGTAATGAGGAGGAGGGTGG - Intronic
993407526 5:87529882-87529904 AAGGAGAGAGAGAAGGAGGGAGG - Intergenic
993812751 5:92503160-92503182 AAGAATAAAGAGAAGGAGCAAGG - Intergenic
993905004 5:93612618-93612640 AAGGGGAGAGGGAAGGGGGCGGG + Intergenic
994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG + Intergenic
994064200 5:95517487-95517509 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
994277883 5:97861022-97861044 AAGGATAAAGAGTGGGAGGAGGG + Intergenic
994409395 5:99388088-99388110 AAGGGAAAAGGGAGGGAGGGAGG - Intergenic
994501400 5:100583183-100583205 TAGGCTGAAGAGAAGGAGGAAGG + Intronic
994558721 5:101339047-101339069 AAGGCCAAAGTGAAGCAGGCTGG + Intergenic
994731631 5:103498681-103498703 AAGGGAAAAGGAAAGGAGGGAGG + Intergenic
994810273 5:104508590-104508612 AGGGACAAAGAGAAGGAGGGAGG + Intergenic
995419242 5:111944601-111944623 AATTGGAAAGAGAAGAAGGCTGG - Intronic
995547468 5:113247410-113247432 AAGAGTAAAGAGAACAAAGCAGG + Intronic
995701891 5:114945414-114945436 GAGGGTAGAGAGTAGGAGGAGGG - Intergenic
995941536 5:117591836-117591858 AAGGGGAAAGAGAGGGAAGTGGG - Intergenic
996010238 5:118474307-118474329 AAAGGGAAAGAGAATGAGCCTGG - Intergenic
996926862 5:128837700-128837722 AAGGGATTAGAGAAGGAGGAAGG + Intronic
997444893 5:133933751-133933773 AAGTGGATAGAGAAGGAGGAGGG - Intergenic
997605485 5:135172994-135173016 AAGGGGGAAAAGAGGGAGGCAGG + Intronic
997715123 5:136036815-136036837 AAGACTCCAGAGAAGGAGGCTGG + Intronic
997722493 5:136090526-136090548 AAAGTGAAAGAGAATGAGGCCGG + Intergenic
998511553 5:142718449-142718471 ATGGGTAAATACAAGGAAGCTGG + Intergenic
998834382 5:146189910-146189932 AAGAATAAAGAGAAGAAGGTAGG + Intergenic
998894505 5:146785188-146785210 AAGAGTATAGAAAAGGAGGAAGG + Intronic
999090446 5:148931658-148931680 AAGGAGGAAGAGAAGGAGGGAGG - Intronic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999363061 5:151002449-151002471 TAGGATAAAGAAAAAGAGGCTGG + Intergenic
999585275 5:153082780-153082802 AAAAGTAAAGAGAATGAGACTGG + Intergenic
1000918949 5:167116164-167116186 AAGGATAAACAGAAGGAAGTAGG + Intergenic
1001105997 5:168855005-168855027 AATAGTAAAGAAAAGGAAGCTGG - Intronic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1001330210 5:170756672-170756694 AAGGGTAAGGAAAAGGAGGTTGG + Intergenic
1001620017 5:173075845-173075867 AGAGGTAAAGGAAAGGAGGCAGG - Intronic
1001976684 5:176006145-176006167 GGGGGTAAAGAGAATGAGACAGG + Intronic
1002189180 5:177469948-177469970 AAGGGAGAAGAGAAAGAGGAGGG + Intronic
1002240743 5:177837636-177837658 AGGGGTAAAGAGAATGAGACAGG - Intergenic
1003228488 6:4227878-4227900 AAGGGTAGTGGGAAGGAGGGAGG + Intergenic
1003316937 6:5021534-5021556 AAGGGTAGTGAGAAGGAGGGAGG - Intergenic
1003465433 6:6376096-6376118 AAGGGGAAAGGGTAGGAGGTGGG + Intergenic
1003558121 6:7158551-7158573 AAGGGTATGGAGGTGGAGGCTGG - Intronic
1004491621 6:16122629-16122651 CAGGGTAAGGAGAAGCAGACTGG + Intergenic
1004617408 6:17303605-17303627 AAGGGAAAAGGGAAGGAGAAGGG + Intergenic
1004673943 6:17823437-17823459 AAGGAAAAAGAGAGGGAGGAAGG - Intronic
1004914847 6:20321969-20321991 AAGGGTATAGGGAAGAATGCAGG + Intergenic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1005026090 6:21464477-21464499 AGGGGCACAGATAAGGAGGCAGG - Intergenic
1005081904 6:21965215-21965237 AGAGGAAATGAGAAGGAGGCAGG + Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005847225 6:29791771-29791793 ACAGGTAAGGAGTAGGAGGCAGG + Intergenic
1006191783 6:32213890-32213912 AAGAGGAAAGAGAAGGAGAGCGG - Intronic
1006371924 6:33650146-33650168 AAGGGCAGAGAGAAGGAGGGTGG - Intronic
1006376931 6:33676888-33676910 AAGGGTGAGGAGGTGGAGGCAGG + Exonic
1006630491 6:35426969-35426991 AAGTCTCAAGAGAAGGAGGGGGG + Exonic
1006671595 6:35732688-35732710 ACTGGTAAAGAGAATGAGGAAGG + Intergenic
1006826633 6:36940634-36940656 GAGGGAGAAGAAAAGGAGGCGGG + Intergenic
1006911249 6:37565071-37565093 AAGGTGCAAGAGAAAGAGGCAGG - Intergenic
1006941793 6:37756507-37756529 AAGGGTGGAGAGATTGAGGCTGG - Intergenic
1007266813 6:40602529-40602551 AATGGGAAAAAGAAAGAGGCAGG - Intergenic
1007694521 6:43723920-43723942 AAGGCTAATGAGGAAGAGGCTGG + Intergenic
1007741052 6:44009655-44009677 AAGGGAGAAGGGAAGGAGGGAGG + Intergenic
1007772648 6:44203474-44203496 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
1007983163 6:46179891-46179913 AAGAGTGAGGACAAGGAGGCAGG + Intergenic
1008056516 6:46951310-46951332 GAGGGAGAAGAGAAGAAGGCTGG + Intronic
1008176281 6:48271341-48271363 AAGGGCAAATAGAAGCAGGGTGG - Intergenic
1008362344 6:50635560-50635582 AAGGGGAAAGGGAGGGAGGGAGG + Intergenic
1008372064 6:50744189-50744211 GAGGGTAAAAAGTAGGAGGGTGG - Intronic
1008450822 6:51648417-51648439 AAAGGTAAAGAGAAGAAAACAGG + Intronic
1009195930 6:60684371-60684393 AAGAGAAGAGAGAAGGAGGGAGG + Intergenic
1009292648 6:61903530-61903552 AAGGATGAAGTCAAGGAGGCTGG + Intronic
1009318375 6:62253484-62253506 AAGGCCAAAGAGGAGGAGGCAGG - Intronic
1009319379 6:62267470-62267492 AAGTGTTCAGAGAAGGAGACAGG + Intronic
1009362624 6:62834378-62834400 GAGGGTAAAGAATAGGAGGAAGG - Intergenic
1009552032 6:65109812-65109834 GAGGGTGAATAGAAGTAGGCAGG - Intronic
1010146318 6:72673544-72673566 AGGGGCAAAGGGAAGGAGTCTGG + Intronic
1010348992 6:74849342-74849364 AAGTTTAAAGAGAAGGATGTAGG - Intergenic
1010368091 6:75076076-75076098 AAGGGAAAAGAAAAGGAAACAGG + Intergenic
1010518270 6:76801383-76801405 TAAGGTAAAGAGGTGGAGGCCGG - Intergenic
1010682263 6:78810637-78810659 ATGGGTAAAGAGAGGAAGGAAGG - Intergenic
1010704334 6:79089806-79089828 AAGGAAAAAGAGAGGGAGGGAGG - Intergenic
1011199052 6:84814643-84814665 AAGTGTAAAAAAAAGGAGGGGGG - Intergenic
1011484757 6:87830004-87830026 AAGGGAGAGGAGAAGGAGGAAGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012407732 6:98919525-98919547 ATGAGGAAAGAGAAGCAGGCTGG + Intronic
1012848262 6:104417219-104417241 AAAGGAAAAGAGATGGAGGTAGG - Intergenic
1013569994 6:111413007-111413029 AAGGGTGAAGAGTAAGAGGGAGG - Intronic
1013592546 6:111631576-111631598 AGGGTTAGAAAGAAGGAGGCTGG + Intergenic
1013605824 6:111746812-111746834 GAGGGTAGAGGGAGGGAGGCAGG + Intronic
1013707699 6:112858106-112858128 AAGGGGACAGAGAAAGAGACTGG + Intergenic
1013768887 6:113605049-113605071 GAGGGGCAAGAGAAGGAGGAAGG - Intergenic
1014251281 6:119117862-119117884 AAGGGTTGAGAGAAACAGGCAGG + Intronic
1014810821 6:125883677-125883699 TAGGGGAAAGAGAAGGATGGGGG - Intronic
1014948005 6:127519013-127519035 AAGAGGAAAGAGAAGAAGGCGGG + Exonic
1015237912 6:130992304-130992326 AGTGGTAAGGAGAAGGATGCTGG - Intronic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015464290 6:133531130-133531152 AAGGGCAAAGAGAAGCCGGCTGG + Exonic
1015561922 6:134525274-134525296 AAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1015994950 6:138987967-138987989 GAGGGTGCAGAGAAAGAGGCGGG + Exonic
1016161323 6:140884000-140884022 AAGGGGAAGGAGAAGGAGAACGG - Intergenic
1016196965 6:141355857-141355879 TAGGGGAAAGAGTGGGAGGCAGG - Intergenic
1016362188 6:143279418-143279440 AAGTGGAAAGATTAGGAGGCTGG - Intronic
1016369367 6:143356615-143356637 AAGGGGAAAGAGAAGGGAGAGGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1016985422 6:149891275-149891297 AAGGGAAAAGCAAAAGAGGCAGG - Intronic
1017074993 6:150609754-150609776 AGTGGTACAGAGAAGGAGGATGG + Intronic
1017200469 6:151748416-151748438 AAGAGTAAAAAGAATGAGGCAGG - Intronic
1018002218 6:159589387-159589409 GTGTGTAAAGAGCAGGAGGCTGG - Intergenic
1018205841 6:161436311-161436333 GAGGGCAGAGAGGAGGAGGCGGG + Intronic
1018302905 6:162422646-162422668 AAGAGTCATAAGAAGGAGGCTGG + Intronic
1019290302 7:247009-247031 AAGGAAAGAGGGAAGGAGGCAGG + Intronic
1019346845 7:535288-535310 CAGGGTGAAGAGGAGGAGCCGGG - Intergenic
1019423821 7:963830-963852 AAGGGTCCTGAGAGGGAGGCAGG + Intronic
1020080026 7:5282203-5282225 AAGGGGAAGGAGAGGGAGGGAGG + Intronic
1020137628 7:5595583-5595605 AAGGATGAATAGAAGGTGGCAGG + Intronic
1020201922 7:6086675-6086697 AAGGGGAAAGGGAAGGGGGAAGG - Intergenic
1020685189 7:11285851-11285873 AAGGGAATAGAGAAAGAGGGAGG - Intergenic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1021229505 7:18068849-18068871 ATGAGTTAAGAGAAGTAGGCAGG - Intergenic
1021778025 7:24073093-24073115 AAGGGTGAAGAGGAGGATTCAGG - Intergenic
1021867476 7:24972341-24972363 AAGAGAAAAGAGAATGTGGCTGG - Intronic
1022113387 7:27244463-27244485 GAGGGTTATGGGAAGGAGGCTGG - Intronic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1022243582 7:28535403-28535425 AAGGAAGAAGAGAGGGAGGCAGG + Intronic
1022329758 7:29366410-29366432 AAGGGTGAAGACCAGGAGGGTGG + Intronic
1023031743 7:36095642-36095664 GAGGGAAGAGAGAAGGAAGCGGG + Intergenic
1023046989 7:36218847-36218869 AAGGTGGAAGAGAAGTAGGCTGG + Intronic
1023219632 7:37906090-37906112 AAGGGCCAAGCAAAGGAGGCAGG + Exonic
1023242102 7:38159690-38159712 AGGGCAAAAGAGATGGAGGCGGG + Intergenic
1024255189 7:47535628-47535650 AAGGGTAGAGAGCAGGCTGCTGG + Intronic
1025198890 7:56950013-56950035 AAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1025280086 7:57620551-57620573 AAAGGAAAAGTGAAGGAGGATGG - Intergenic
1025304647 7:57844950-57844972 AAAGGAAAAGTGAAGGAGGATGG + Intergenic
1025673056 7:63626920-63626942 AAGGGGAAGGAGAGGGAGGGAGG + Intergenic
1025898078 7:65722598-65722620 AAGGAAAAAGGGAAGGAGGAAGG - Intergenic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026379010 7:69780526-69780548 TAGGGCAAAGAGGAGGAGGGCGG + Intronic
1026582362 7:71629079-71629101 AAGGGTCAAGAGGAGTTGGCTGG + Intronic
1026865048 7:73818509-73818531 AAGGAAAAAGGGAGGGAGGCAGG - Intronic
1026905054 7:74058007-74058029 AAGGAGAAAGAGAAGGAGAAGGG - Intronic
1026942141 7:74293364-74293386 AGGGGAAAGGAGAAGGAGACGGG - Intronic
1026962832 7:74420054-74420076 AAGGAAGAAGAGAAGGAGGGAGG - Intergenic
1026967759 7:74451251-74451273 AAAGAAAAAGAGAAAGAGGCAGG + Intergenic
1026998012 7:74631824-74631846 AGGGGTAACGGGAAGGAGGATGG - Intergenic
1027478153 7:78659623-78659645 AAGGGTAAAGGAGAGGATGCAGG + Intronic
1027767461 7:82363559-82363581 AAGGATAAAGACAAACAGGCGGG - Intronic
1028207691 7:88035097-88035119 AAGGAGCAAGAGAATGAGGCAGG - Intronic
1028231558 7:88311763-88311785 AAGGGTATAGTGAAGAAGCCAGG + Intergenic
1028503802 7:91549541-91549563 ATGGGTAAAGTGAGGGAGTCAGG + Intergenic
1028728132 7:94112675-94112697 AAGGAGAAAGAGAGGGAGGGAGG + Intergenic
1028762291 7:94509782-94509804 GAGGCTAAAGAGGAGGAGGAAGG + Exonic
1029644550 7:101845546-101845568 GAGGGAATAGAGGAGGAGGCTGG + Intronic
1029875047 7:103741676-103741698 AAGGGAAAAGACAGGGAGGGAGG + Intronic
1030380371 7:108803984-108804006 AAGGGAGGAGAGAGGGAGGCAGG - Intergenic
1030404157 7:109089279-109089301 AACGGGAAAGAGATGAAGGCTGG + Intergenic
1030507924 7:110447694-110447716 AAGGGGAAAGAAAAAAAGGCAGG - Intergenic
1030925003 7:115441006-115441028 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
1031289672 7:119917209-119917231 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
1031380256 7:121077006-121077028 AAGGGCAAAGAGGAGGATACAGG - Intronic
1031647740 7:124247460-124247482 GAGGGTAGAGGGAAGGAGGAGGG - Intergenic
1031680852 7:124673063-124673085 AAAGGTACAAGGAAGGAGGCAGG - Intergenic
1031886729 7:127252257-127252279 AAGGGTGACGGGAAGGGGGCAGG - Intronic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1031949362 7:127876117-127876139 AAGGACAAAGAGAAGGAGAGGGG - Intronic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032436789 7:131907339-131907361 GAGGGCAAAGGGAAGGAGGGAGG + Intergenic
1032449090 7:132013109-132013131 AAGGATACAGAAAAGGAGGGAGG - Intergenic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033568626 7:142604928-142604950 AAGGGGAGAGAGAAAGGGGCTGG - Intergenic
1033583329 7:142755819-142755841 GAGGGAAGAGAGAAGGAGGGTGG - Intronic
1033586340 7:142777327-142777349 GAGGGAAGAGAGAAGGAGGGTGG - Intergenic
1033804327 7:144937422-144937444 AAGGGTAAGGAGAAGGGGAAGGG - Intergenic
1033956389 7:146854054-146854076 CAGGGAGATGAGAAGGAGGCTGG + Intronic
1034471806 7:151258744-151258766 CAGGGCAGAGAGAAGGTGGCGGG - Intronic
1034855785 7:154545428-154545450 AAGGATGAAGAAAAGGAGGGAGG - Intronic
1036164785 8:6422567-6422589 AAGGGGATAGAGAATGAGTCAGG - Intronic
1036193308 8:6691489-6691511 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
1036289421 8:7474126-7474148 AAGGGTAAAAAGATGGGTGCTGG + Intronic
1036387171 8:8292552-8292574 AAGGGGAAAGAGGAGCAGGCCGG - Intergenic
1036437261 8:8746009-8746031 AAAAGTAAAGTGAAAGAGGCTGG + Intergenic
1036961346 8:13248196-13248218 AATGGTACAGAGAAAGGGGCTGG - Intronic
1037373028 8:18200534-18200556 AAGGGTAAAGGGTGGGAGGATGG + Intronic
1037689435 8:21170186-21170208 GAGGGAAAAGGGAAGGAGGATGG - Intergenic
1037812455 8:22095144-22095166 AAGGGAAAAGTGAGGGATGCAGG - Intronic
1037819778 8:22130053-22130075 GAGGGGAGAGGGAAGGAGGCGGG + Intronic
1037935303 8:22911469-22911491 AGGGGTGGAGAGAAGGAGGTGGG - Intronic
1038395828 8:27244736-27244758 AAGTGGAAAGAGGAGGGGGCGGG + Intronic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1039184306 8:34899702-34899724 AAGGTTGAGGAGAAGGTGGCTGG - Intergenic
1039394956 8:37217672-37217694 AGGGGTACAGAGCAGCAGGCTGG - Intergenic
1039726739 8:40226106-40226128 AAGGGTAGAGATAAAAAGGCAGG - Intergenic
1039774080 8:40718645-40718667 GAGGGAAAGAAGAAGGAGGCTGG - Intronic
1039812653 8:41063380-41063402 AAGGGGAAAGGGAGGGAGGGAGG + Intergenic
1040024645 8:42770565-42770587 AAGGGTGCAGAGCAGGAGGATGG + Intronic
1040499280 8:47992827-47992849 AGGGGTAATGAGGAGGAGGGAGG + Intergenic
1041440980 8:57896754-57896776 AAAGGTAAAGAGAAGTAGCCAGG - Intergenic
1041516464 8:58704492-58704514 AAGGAGAAAGAGAAGAAAGCAGG + Intergenic
1041577296 8:59413508-59413530 AAGGGTGGAGAGAGGGAGGCAGG + Intergenic
1041577340 8:59414172-59414194 AGGGTTAAAGAAAAGGAGACAGG + Intergenic
1041626495 8:60034778-60034800 AGAGATAAAGAGAAGGAGGTAGG - Intergenic
1041732401 8:61075849-61075871 AAGGGAAGAAGGAAGGAGGCTGG - Intronic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042282176 8:67066195-67066217 TGGGGGAAAGAGAGGGAGGCTGG - Intronic
1042422343 8:68606655-68606677 AATAGTAAAGATTAGGAGGCAGG - Intronic
1042574061 8:70198707-70198729 GAGGTAAAAGAGAAGGTGGCTGG + Intronic
1042579152 8:70257513-70257535 AAGGAGAAAGAGCAGCAGGCAGG + Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043088218 8:75864606-75864628 AAGAGTAAATAGATGTAGGCTGG + Intergenic
1043855986 8:85265537-85265559 AAGGGGGAAGGGAAGGAGGTGGG - Intronic
1044402224 8:91786119-91786141 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044402229 8:91786137-91786159 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044619735 8:94177121-94177143 AAGGAGAAAGAGAGGGAGACGGG + Intronic
1045076211 8:98571379-98571401 AAGGGGAAAGAGGGGAAGGCGGG + Intronic
1045196342 8:99934841-99934863 ACGGATAAAGAAAAGGAGGCCGG + Intergenic
1045355920 8:101388996-101389018 ATGGGGACAGAGAAGGAGGATGG - Intergenic
1045725799 8:105171692-105171714 AGGGGGAAAGAGTGGGAGGCGGG - Intronic
1045813217 8:106248494-106248516 AACAGTAAAGAGAAGAAAGCTGG + Intergenic
1045865468 8:106860517-106860539 AATAAAAAAGAGAAGGAGGCCGG + Intergenic
1046002182 8:108434304-108434326 AAGGGTACAGGGAGGGAGGGAGG + Intronic
1046221829 8:111226788-111226810 AAGGGAAAAGAGAGGGAGTTTGG - Intergenic
1046237795 8:111449392-111449414 TAGGATACAGAGAAGGAGACAGG + Intergenic
1046366573 8:113239650-113239672 ATGGGTAATGAGTAGGAGGGTGG + Intronic
1047509062 8:125502410-125502432 AAGAGCAAAGACATGGAGGCTGG - Intergenic
1047801161 8:128311817-128311839 AAGGCTACAGTGAAGGAAGCAGG + Intergenic
1047928600 8:129704409-129704431 AAGGGAGGAGAGAAGGAGGTAGG - Intergenic
1048073828 8:131047072-131047094 AAGGAAAAACAGAAGAAGGCAGG - Intergenic
1048115486 8:131517197-131517219 GAGGGTAAGCAGAAGGATGCAGG - Intergenic
1048313445 8:133344262-133344284 AAGGGGAGAGAGAAGGAAGGAGG - Intergenic
1048377428 8:133834781-133834803 AAGGTCAAAGAGAAGGCTGCAGG + Intergenic
1048580660 8:135727725-135727747 AAAGGAAGAGAGAAGGAGGGAGG + Intergenic
1048680692 8:136838319-136838341 AGGGGAATAGAGAAGGAGGTGGG - Intergenic
1048904364 8:139073615-139073637 AAGGAGAAAGAGAAGGAGAGAGG - Intergenic
1049181599 8:141225858-141225880 GAGGGCAAAGGGGAGGAGGCTGG - Intronic
1049334607 8:142076533-142076555 GAGGGTCATGAGAAGGAGCCGGG - Intergenic
1049358579 8:142200952-142200974 AAAGAAAAAGAGAGGGAGGCAGG + Intergenic
1049470426 8:142772883-142772905 AAAGGTGGACAGAAGGAGGCAGG + Intronic
1050952112 9:11610750-11610772 GAGGGGAAAGAGAAGGAGAGAGG - Intergenic
1051000739 9:12279139-12279161 TAGGGTAAAGAGGAGGAGTAAGG - Intergenic
1051653682 9:19356121-19356143 AAGTGTAAATTGAAGGACGCAGG - Intronic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1052425882 9:28303844-28303866 AAGGAGATAGAAAAGGAGGCAGG + Intronic
1052520472 9:29541536-29541558 AAGGACAGAGAGATGGAGGCAGG - Intergenic
1052902088 9:33801985-33802007 GAGGGAAGAGAGAAGGAGGGTGG - Intergenic
1053164964 9:35837793-35837815 AAAGGCAAGGAGATGGAGGCCGG - Intronic
1053632183 9:39954811-39954833 ATGGGGAAAGAGAAGGAGATTGG - Intergenic
1053773582 9:41508724-41508746 ATGGGGAAAGAGAAGGAGATTGG + Intergenic
1054211705 9:62295887-62295909 ATGGGGAAAGAGAAGGAGATTGG + Intergenic
1054313277 9:63552942-63552964 ATGGGGAAAGAGAAGGAGATTGG - Intergenic
1054459143 9:65453312-65453334 ATGGGTAAAGGGAAGGATGTGGG + Intergenic
1054732719 9:68717082-68717104 AAGGGGACAGGGAAGGAGGGAGG + Intronic
1054800658 9:69345154-69345176 AAGTGTCAGGTGAAGGAGGCTGG + Intronic
1054976225 9:71149067-71149089 AATTGTAAAGAGAAGGATGGCGG + Intronic
1055003057 9:71475142-71475164 AAAGGTGAAGGGAAGAAGGCAGG - Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056329144 9:85507576-85507598 AATGGAAAAGGAAAGGAGGCAGG + Intergenic
1056422495 9:86442952-86442974 AAGGAAAGAGAGAAGGAGGGAGG - Intergenic
1056558700 9:87711021-87711043 AAGAATAAAAAGATGGAGGCGGG + Intergenic
1056721119 9:89072972-89072994 AAGTGAATAGAGAATGAGGCTGG + Intronic
1056847374 9:90052421-90052443 AAAAGTGAAGAGAAGAAGGCAGG - Intergenic
1057115969 9:92522498-92522520 ATGGGGAAAGAGAAGGAGAGAGG - Intronic
1057169088 9:92950114-92950136 AAGGATAAAAAGAAGCAGGTGGG + Intronic
1057289894 9:93798895-93798917 AAGGAGAAAGAGAAAGAGGGAGG - Intergenic
1057516607 9:95727274-95727296 AAGAGGAAAGAGAAGGGGGGTGG - Intergenic
1057914016 9:99041696-99041718 AAGGGGATAGTGGAGGAGGCGGG + Intronic
1058070725 9:100598462-100598484 AGGGGTAAAGCGAAGGCCGCAGG + Intergenic
1058748200 9:108012722-108012744 GTGGGTTAAGTGAAGGAGGCAGG - Intergenic
1059025380 9:110622305-110622327 AAGGGTAAAGAAAAGAAGTCAGG - Intergenic
1059325921 9:113503981-113504003 AAGGGGAAGGGGGAGGAGGCAGG - Intronic
1059585066 9:115597163-115597185 AAGGAGAAAGAGGAGGAGGAGGG - Intergenic
1059783231 9:117551864-117551886 ATGGGTAAAGGGAAGGATTCTGG + Intergenic
1059812026 9:117865957-117865979 AAGGGTAAAGGGGAGGAAGCAGG + Intergenic
1060625852 9:125110651-125110673 AAGGTGAAGGAGAAGCAGGCAGG - Intronic
1061036800 9:128118737-128118759 AAGGGTACAGGGATGGAGGATGG + Intergenic
1061082732 9:128381989-128382011 AAAGAGAAAGAGAAGGAGGGAGG + Intronic
1061456906 9:130705224-130705246 AAAGGAAAAGAAAAGGCGGCCGG + Intergenic
1061791741 9:133062776-133062798 ACGGGTGGAGAGAAGCAGGCAGG + Intronic
1061890286 9:133615715-133615737 GAGGGTGCAGAGAGGGAGGCTGG - Intergenic
1061962462 9:133994951-133994973 AAAGGTAAAGAAAATGGGGCAGG + Intergenic
1062074738 9:134579769-134579791 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074755 9:134579811-134579833 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074773 9:134579854-134579876 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062532228 9:137007018-137007040 AAGGCTAAGGGGAAGGGGGCCGG + Intergenic
1062617294 9:137403585-137403607 AGGGGCAAAGAGAAGGAGAGAGG - Intronic
1062638364 9:137503439-137503461 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638371 9:137503458-137503480 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638378 9:137503477-137503499 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638397 9:137503534-137503556 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1185545400 X:939789-939811 AAGAGAAAAGAGGAGGAGGGGGG - Intergenic
1185611093 X:1394136-1394158 AAGAAAAAAGAAAAGGAGGCGGG - Intergenic
1185726529 X:2426387-2426409 AAGGAAAAAGAGAAGGAAGGAGG - Intronic
1185943571 X:4348774-4348796 AAGGGAAAAGAGAAGGGAGGTGG - Intergenic
1186014880 X:5180150-5180172 AAAGGGAGAGAGAAGGAGACAGG + Intergenic
1186017818 X:5217994-5218016 AGGGGTAGAGAGAAGGAGGAGGG + Intergenic
1186145760 X:6622031-6622053 AAGGAGAAAGGGAAGGAGGAGGG + Intergenic
1186634890 X:11392310-11392332 AATGGTACATAGGAGGAGGCTGG - Intronic
1186687742 X:11943234-11943256 AAGAGTAAAAAGAAAAAGGCAGG - Intergenic
1187075740 X:15932681-15932703 AAGGATATAGTTAAGGAGGCTGG + Intergenic
1187135102 X:16540574-16540596 TAAGGAAAAGAGAAAGAGGCCGG + Intergenic
1187843796 X:23515450-23515472 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1187882869 X:23862838-23862860 AAGGGAAGGGAGAAGGAGGGAGG + Intronic
1188074571 X:25759375-25759397 AAGGGTTCAGAGAAGGAGCGAGG + Intergenic
1188205908 X:27358317-27358339 AAAGGTGAAGAGAAGAAGGTAGG + Intergenic
1188595347 X:31893570-31893592 AAGGGGAAAGGGAGGGAGGGAGG + Intronic
1188776718 X:34229241-34229263 AGGGCTAGAGAGAAGCAGGCTGG - Intergenic
1189052927 X:37665336-37665358 AAGGGCAAAGACATGGAGGCAGG - Intronic
1189290614 X:39882962-39882984 AAGGGTTAAGAGAAGTCGGAGGG + Intergenic
1189419417 X:40843444-40843466 GAGGGTAAAGGGAAGAAGGGTGG - Intergenic
1189649655 X:43175841-43175863 AAGGGAAAAGAGAAAGAAGAGGG + Intergenic
1189684344 X:43548420-43548442 GGGGGTAAAGAGGAGGAGTCAGG + Intergenic
1189875835 X:45434790-45434812 AAAGGTAAAGAGGGGGAGGTGGG - Intergenic
1189956444 X:46279510-46279532 AATGGTGAAGAGATGGAGGTCGG + Intergenic
1190047480 X:47124281-47124303 AAGAAGAAAGAGAAAGAGGCCGG + Intergenic
1191597184 X:62958808-62958830 AAGGGGAAAGAGAAAGAGTTTGG - Intergenic
1192093511 X:68185774-68185796 AAGGCTAAAGAAAAGGAGAAAGG + Intronic
1193005397 X:76612797-76612819 AAGGGTAAAGGGGAGGAAGACGG + Intergenic
1193667419 X:84338918-84338940 AAGGTGAAAGGGAAGCAGGCAGG - Intronic
1193699238 X:84742551-84742573 AGGGGTAATGAGGAGGAGGGAGG - Intergenic
1193746658 X:85290102-85290124 AAGGGTGGAGAGATGGCGGCAGG - Intronic
1193893188 X:87077529-87077551 AAGGGAAAAGAGAAGGGGAGAGG + Intergenic
1193959773 X:87910933-87910955 AAGGGTAGAGGGTAGGAGGAGGG + Intergenic
1193990994 X:88307267-88307289 GAGGGTGAAGAGAGGGAGACAGG - Intergenic
1194390073 X:93306278-93306300 AGTGGGAAAGAGAAGGTGGCTGG - Intergenic
1194431396 X:93811289-93811311 AAGGGGAAATAGAAGGAGAAAGG - Intergenic
1194728666 X:97428656-97428678 GAGGGTTAAGAGAAGAAGGAGGG - Intronic
1195318214 X:103699376-103699398 GGGAGTATAGAGAAGGAGGCAGG + Intergenic
1195378977 X:104253977-104253999 TAGGGTAAAGCGAGTGAGGCAGG - Intronic
1195493604 X:105503457-105503479 AAGAGAAAAAAGAAGGAAGCTGG + Intronic
1195745024 X:108108319-108108341 ACAGGTAAATAGAAGGAGGCAGG - Intronic
1196654370 X:118201651-118201673 ATGGGTCCAGAGAATGAGGCAGG - Intergenic
1197744528 X:129922711-129922733 AAGGAAAAAAAAAAGGAGGCTGG - Intronic
1197849694 X:130844405-130844427 AAAGAGAAAGAGAAGGAGGAAGG + Intronic
1198197015 X:134373404-134373426 GAGGGTAAAGAGAAAGAAGTCGG - Exonic
1198428407 X:136542142-136542164 GAGGGGAGAGAGAAGGAGGCTGG - Intronic
1198466740 X:136910210-136910232 GAGGGGAAAGAGAAGGAGATGGG - Intergenic
1198690523 X:139279117-139279139 AAGGGTAGTGAGAGGGAGGTGGG + Intergenic
1198789537 X:140328576-140328598 AAGAGTAATGAGAGGGCGGCCGG - Intergenic
1198843415 X:140882922-140882944 AAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1198871537 X:141180930-141180952 AAGGGGAAAGAAAATGAGGAAGG - Intergenic
1199009561 X:142743124-142743146 TAGATTAAAGACAAGGAGGCTGG - Intergenic
1199572063 X:149276187-149276209 AATGAGAAAGGGAAGGAGGCAGG - Intergenic
1199695735 X:150341705-150341727 AAAGGGAAAGAGAGGGAGGGGGG - Intergenic
1199770382 X:150971490-150971512 AAGGGTGGAGAGCAGGAGGAGGG + Intergenic
1200379716 X:155822221-155822243 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200379724 X:155822245-155822267 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200613210 Y:5348569-5348591 AAGGGCAAAGACACAGAGGCAGG - Intronic
1200834295 Y:7717961-7717983 CAGGGGAAAGAGAAGAAGTCTGG - Intergenic
1201235371 Y:11905147-11905169 AAAGGAAAAGGGAAGGAGGGAGG + Intergenic
1201453008 Y:14136324-14136346 AAGGGAAAAGAGAAGGAAAATGG - Intergenic
1201579315 Y:15494348-15494370 AAGGGAAAGGAGAACCAGGCTGG + Intergenic
1201864728 Y:18637687-18637709 AAGGTTAAAGAGAAGAAGGCAGG - Intergenic
1201868594 Y:18682691-18682713 AAGGTTAAAGAGAAGAAGGCAGG + Intergenic
1202273667 Y:23094715-23094737 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202292360 Y:23325966-23325988 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic
1202426663 Y:24728460-24728482 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202444126 Y:24941626-24941648 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic