ID: 1015307519

View in Genome Browser
Species Human (GRCh38)
Location 6:131726314-131726336
Sequence CACATTGTCTTGCAAGCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 97}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015307519_1015307523 15 Left 1015307519 6:131726314-131726336 CCTGTAGCTTGCAAGACAATGTG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1015307523 6:131726352-131726374 GGTTGTTATAGGTGCTACACGGG 0: 1
1: 0
2: 0
3: 1
4: 49
1015307519_1015307520 -6 Left 1015307519 6:131726314-131726336 CCTGTAGCTTGCAAGACAATGTG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1015307520 6:131726331-131726353 AATGTGCAAGTATTAGATAAAGG 0: 1
1: 0
2: 1
3: 27
4: 397
1015307519_1015307524 26 Left 1015307519 6:131726314-131726336 CCTGTAGCTTGCAAGACAATGTG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1015307524 6:131726363-131726385 GTGCTACACGGGTGCAAAAGAGG 0: 1
1: 0
2: 1
3: 2
4: 40
1015307519_1015307521 4 Left 1015307519 6:131726314-131726336 CCTGTAGCTTGCAAGACAATGTG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1015307521 6:131726341-131726363 TATTAGATAAAGGTTGTTATAGG 0: 1
1: 0
2: 1
3: 19
4: 213
1015307519_1015307522 14 Left 1015307519 6:131726314-131726336 CCTGTAGCTTGCAAGACAATGTG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG 0: 1
1: 0
2: 0
3: 3
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015307519 Original CRISPR CACATTGTCTTGCAAGCTAC AGG (reversed) Intronic
907712252 1:56894592-56894614 CACAATGTCTAAAAAGCTACAGG + Intronic
908030081 1:59989807-59989829 CACATTGTCTCTGAAGCTCCAGG + Intronic
909204339 1:72734956-72734978 CACATTGTCTTGAAAAGAACTGG - Intergenic
912951173 1:114121469-114121491 CACATTGTTTTCTAAGCAACAGG + Intronic
914920831 1:151846521-151846543 AACTTTGTCTTGCAGGCAACAGG - Intergenic
915413467 1:155721204-155721226 CAGATTGTAATGCCAGCTACTGG + Intronic
919554647 1:199035481-199035503 CACATTGTCTTTCAACCCATTGG - Intergenic
920828318 1:209443203-209443225 CTCATAGTCCTGGAAGCTACAGG - Intergenic
921080017 1:211731738-211731760 AACATTGACTTCCAAGCTGCAGG - Intergenic
924382553 1:243477782-243477804 AACATGGTCTTCCAAGCTTCTGG + Intronic
1065225532 10:23539747-23539769 CACATTGTTTTGCCAGTTAGAGG - Intergenic
1067142491 10:43668864-43668886 CACATGGCACTGCAAGCTACAGG - Intergenic
1068596825 10:58911033-58911055 CACATTATCTTGCAAGGCAGAGG - Intergenic
1069581520 10:69569992-69570014 CACCTTCTCCTGCAAGCTCCCGG + Intergenic
1070730870 10:78827354-78827376 CACATTGTCTTGTAAGACAGAGG + Intergenic
1071925763 10:90407275-90407297 CTCATTATCTTGCAAGGTTCAGG - Intergenic
1073284339 10:102378498-102378520 CACATTGTAGTCCCAGCTACTGG + Intronic
1076291166 10:129346858-129346880 CACATTTTCTTCCCAGCCACAGG - Intergenic
1080187446 11:29506785-29506807 CAGGTTTTCTTGCAAACTACTGG + Intergenic
1088015970 11:105060517-105060539 CACATTGTCTAGCAAGATGAGGG + Intronic
1090009619 11:123034678-123034700 CACGTGGTCTTGCATCCTACTGG - Intergenic
1090807308 11:130210532-130210554 CCCCTGGTCTTGGAAGCTACAGG - Intergenic
1091051481 11:132376798-132376820 CAAATTGTCTTGCAAGGCATTGG - Intergenic
1093678659 12:21974487-21974509 CACTTTGTCTTTCAAACTGCGGG - Intergenic
1096412790 12:51389495-51389517 CACATTGTCTTGCATTTGACTGG + Intronic
1096668430 12:53182344-53182366 CACAATGCCTTGCATGCAACAGG - Intronic
1099013710 12:77321622-77321644 CACATTTTCTTGCCAGTTAATGG + Intergenic
1099382667 12:81974843-81974865 CACATTGTGTTACACCCTACAGG + Intergenic
1099727987 12:86459502-86459524 CTCATTTTCTTGCTAGCTATTGG - Intronic
1101345709 12:103884390-103884412 CACTTTTTCTTGCAAGATAATGG + Intergenic
1111433232 13:88172093-88172115 CACTTTGTCTTTCCAGCTACTGG - Intergenic
1115467376 14:33730474-33730496 CACATTGTCTTCCAAGACTCAGG + Intronic
1115893264 14:38056515-38056537 CCCATTATCTTGCTAGCAACTGG - Intergenic
1116583410 14:46672112-46672134 CACACTGGCTTGAAAGCTACTGG + Intergenic
1116791331 14:49343341-49343363 CATATTGTCCTGCAAGATAGTGG - Intergenic
1117220253 14:53597053-53597075 CACATTTTCCTGCTAGCTGCTGG - Intergenic
1117268841 14:54120285-54120307 CACATTCTCTTGCAGTCTAAAGG + Intergenic
1120022184 14:79543398-79543420 CCCAGTGTCTTGCAAGTTCCAGG + Intronic
1123442308 15:20301353-20301375 CACCTTGTCATGCCAGCCACTGG - Intergenic
1123712043 15:22995440-22995462 CACAATGTCTTTAAAGCTGCAGG - Intronic
1129459779 15:75694730-75694752 CACCTTGTCTGGGAAGCTACGGG + Intronic
1137763808 16:50962111-50962133 CACATCGTTTTGCAAACTCCTGG - Intergenic
1140719665 16:77759931-77759953 CACATTTCCTTGCAAGCTCCCGG - Intergenic
1146418698 17:32662206-32662228 CACCTTTTCTTGAAAGCTACTGG - Intronic
1147280125 17:39352918-39352940 CACTTTTTCTTACAACCTACTGG - Intronic
1147887475 17:43693957-43693979 CACAGTGGCGTGCCAGCTACTGG - Intergenic
1148464943 17:47859323-47859345 CACATTATCCTTCAAGCTCCTGG + Intergenic
1149165642 17:53748900-53748922 CCCATTGCATTGCAGGCTACTGG + Intergenic
1153874658 18:9358360-9358382 CAGATTGTCTTCCAAGATTCTGG - Intronic
1154478827 18:14796638-14796660 CCCATTGTATTGCAGGCTGCTGG - Intronic
1154939106 18:21093196-21093218 CAAATAGTCTTAGAAGCTACTGG + Intronic
926470819 2:13255341-13255363 CACATTAATTTACAAGCTACAGG - Intergenic
927543211 2:23930420-23930442 CACATTGTATTGCAGTTTACTGG - Intronic
935873043 2:107472009-107472031 CAATTTGTCTTACAAGTTACAGG - Intergenic
938554316 2:132410364-132410386 CACACTGCCTTGTAAACTACAGG + Intergenic
939873784 2:147553968-147553990 CCCATTGTCTTGCAATGTGCAGG - Intergenic
942997453 2:182280439-182280461 CACACTTTCTTGGAAACTACTGG - Intronic
943314281 2:186366788-186366810 CACAGTGCCTTTCAAGATACTGG + Intergenic
944650623 2:201826639-201826661 CACAGTGTTTTGCAATCTCCAGG + Intronic
1173894859 20:46542974-46542996 AGCATTTTCTTGCAAGCTGCGGG - Intronic
1174253865 20:49239456-49239478 AACATTGTCTTCCACGATACTGG - Intronic
1176857528 21:13984604-13984626 CACTTTGTCATGCCAGCCACTGG - Intergenic
1176867078 21:14059618-14059640 CACTTTGTCATGCCAGCCACTGG + Intergenic
1177291128 21:19112682-19112704 CAAATTGTCTGGCAAGTTAGGGG - Intergenic
1177319577 21:19503282-19503304 CACATTTTCTTCCATTCTACAGG + Intergenic
1181434421 22:22901906-22901928 CATATTGTCCTGCAAGCATCTGG + Intergenic
1184056895 22:42058758-42058780 CACCTTCTCTTGCTAGCTCCAGG - Exonic
1184285090 22:43465971-43465993 CACAAAGTCCTGCTAGCTACAGG + Intronic
949653247 3:6185795-6185817 CACATTGTCTTCCAAACTGGGGG + Intergenic
951084181 3:18491561-18491583 CAGATTTTCCTGTAAGCTACTGG - Intergenic
954154874 3:48679853-48679875 CACATTTTCTTGCAAACTTCAGG + Exonic
960518738 3:118630935-118630957 CCCATTGTCTTGCTAGCTGCTGG - Intergenic
962271296 3:133979778-133979800 AACATTGTGTTGCACCCTACAGG + Intronic
974151747 4:58019025-58019047 AACATTGTCTTGCAGGCAAAGGG - Intergenic
974517314 4:62934809-62934831 CACAGTTTCTTGAAAGCCACAGG + Intergenic
981250019 4:142589693-142589715 CAAATTGTCTTCCAAGGTAGTGG - Intronic
986896513 5:12377194-12377216 CTCATTGTCTTGTGAGCTGCTGG + Intergenic
989119517 5:37990361-37990383 CACATGGCCTTGTAAGCCACAGG - Intergenic
989608626 5:43270431-43270453 CACCATGTCTTCCAACCTACTGG - Intronic
990785713 5:59416757-59416779 CACATCTACTTGCAAGCTAAGGG + Intronic
992995811 5:82331650-82331672 CCCTTTCTCTTGCAGGCTACTGG - Intronic
995012719 5:107275942-107275964 CACATTGACATCCAAGCTAATGG + Intergenic
999845118 5:155470612-155470634 CCCGTTGTCTTGCTAGCTGCTGG - Intergenic
1003822515 6:9915078-9915100 CACTTTGACTTGCAAACCACTGG + Intronic
1003845877 6:10172733-10172755 CTCATGGTCTTGCTAGCTTCAGG - Intronic
1011946132 6:92905673-92905695 AATATTGTCCTGAAAGCTACAGG - Intergenic
1013418467 6:109945569-109945591 CACATTGCCTGGCCAGTTACAGG + Intergenic
1013924234 6:115449415-115449437 GACTTTGTCTAGCAAGCAACAGG + Intergenic
1014256389 6:119163660-119163682 CACTTTGTCTTCCATGCTCCCGG - Intergenic
1015307519 6:131726314-131726336 CACATTGTCTTGCAAGCTACAGG - Intronic
1015967920 6:138713328-138713350 CACATTGCCTTGTAAACTAGGGG + Intergenic
1016124874 6:140387601-140387623 CACATTGTGATGGAAGCTCCAGG + Intergenic
1023191108 7:37584125-37584147 CCCATTGCATTGCAAGCTGCTGG - Intergenic
1026525309 7:71148097-71148119 CCCATTCTCTTGGAAACTACTGG - Intronic
1029658090 7:101940635-101940657 CACATTCCCTTGCAAGCTAAAGG - Intronic
1043246120 8:78004023-78004045 CACATTGTCTGAGAAGCAACAGG - Intergenic
1044761946 8:95528340-95528362 CACATTGTTTTGCTGGCTCCAGG - Intergenic
1049150181 8:141029991-141030013 CACTTTGTCTTGGAAGCTGAAGG + Intergenic
1050520162 9:6488843-6488865 CACTCTGTCTTCCAGGCTACAGG + Intronic
1050633083 9:7581227-7581249 CACATTGTCTTTCAACTTAGTGG + Intergenic
1054914638 9:70484657-70484679 CCCAGTGTCTTTCAAACTACGGG - Intergenic
1056048567 9:82744764-82744786 CACATTTCCTTCCCAGCTACTGG - Intergenic
1060410615 9:123397763-123397785 CAGATTGTCTATCAGGCTACCGG + Intronic
1192708738 X:73557317-73557339 CACATTGTTTTGCAAAATTCTGG - Intergenic
1198117625 X:133559381-133559403 CACAGTGTCTAGCAAACAACAGG - Intronic
1201610480 Y:15837668-15837690 CACATTTTCTTGCAGGATAGAGG - Intergenic