ID: 1015307522

View in Genome Browser
Species Human (GRCh38)
Location 6:131726351-131726373
Sequence AGGTTGTTATAGGTGCTACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015307519_1015307522 14 Left 1015307519 6:131726314-131726336 CCTGTAGCTTGCAAGACAATGTG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG 0: 1
1: 0
2: 0
3: 3
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015307522 Original CRISPR AGGTTGTTATAGGTGCTACA CGG Intronic
901930009 1:12591191-12591213 AGGTCGTTACAGGTGCCCCACGG + Intronic
903209402 1:21808305-21808327 AGGGTGTTACAGGGGTTACAGGG + Intergenic
903792107 1:25900846-25900868 ATGTTGTTTTAGGGGCTAAAGGG - Intronic
905130884 1:35756287-35756309 AGGTTATTATGGGTGCCACTAGG + Intronic
905805598 1:40874762-40874784 ATGTTTTTATATATGCTACATGG + Intergenic
908419470 1:63945861-63945883 AGGTTGCTCTAGCTGCAACATGG + Intronic
912042341 1:105408252-105408274 AGGTTGTTGTAGATGTTAGATGG + Intergenic
912581595 1:110725864-110725886 ATGTTGTTCTAGGTGCTGCAAGG - Intergenic
921908667 1:220524327-220524349 ACTTTGTTTTAGGTACTACAAGG - Intergenic
924361706 1:243248222-243248244 AGGTGATTAAAGGTGATACAGGG + Intronic
1063019752 10:2115995-2116017 AGGTTGTTATTTCTGCTTCATGG - Intergenic
1068286565 10:54944678-54944700 AGGTTGTTATATGAGCTATTGGG + Intronic
1077798947 11:5518925-5518947 CGGTTGTTATAGGTGGCACCAGG + Intronic
1078480947 11:11674857-11674879 AAGTTTTTAAAAGTGCTACAAGG - Intergenic
1081380614 11:42410064-42410086 AGGTTGTTTTAATTGCTACCTGG + Intergenic
1085868948 11:80326772-80326794 AGGTTGTTAAAGATGATATATGG - Intergenic
1087476306 11:98639380-98639402 TGGTTGTGATAAGTTCTACATGG - Intergenic
1089188093 11:116634670-116634692 AGTTTGTTATAGCAGTTACATGG - Intergenic
1089539941 11:119183726-119183748 AGGTTGGTAGTGGTGCTTCAGGG - Exonic
1091165243 11:133469781-133469803 AGGTTTTTATAGATCCTACCTGG + Intronic
1092893762 12:12993781-12993803 ACATTGTTACAGGTGCTATAAGG + Intronic
1092908335 12:13122739-13122761 AGGTGGTGATGGGTGCTTCAAGG + Intronic
1094578918 12:31715177-31715199 ATGTTGTTTTAGGAGCTAAAGGG - Intronic
1110722755 13:78783454-78783476 ATATTGTTATATTTGCTACATGG + Intergenic
1113056928 13:106278262-106278284 AGGTGGTGATGGGTGCTACGTGG - Intergenic
1115051223 14:29065922-29065944 AGATTGTTATAGGTGGACCATGG - Intergenic
1119500306 14:75121238-75121260 AGGTTTTTTTAGGTGACACAAGG + Intronic
1123162891 14:106296915-106296937 AGGTTGTCATATGTGCTATTGGG + Intergenic
1124862019 15:33450988-33451010 GGGTTGTTTCAGGTGCTGCAAGG - Intronic
1130398828 15:83530077-83530099 GGGTTGTTAGTGGTGCTTCAGGG + Intronic
1132266052 15:100471708-100471730 AGATTATTATATGTGCTTCAGGG - Intronic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1138238291 16:55404415-55404437 ACTTTGTTAGAGATGCTACAGGG + Intronic
1140595365 16:76402984-76403006 ATGTTGTTATCATTGCTACATGG - Intronic
1145233239 17:21190328-21190350 AGTTTGTTTTAGGTGTTAGAAGG - Intronic
1153760692 18:8329007-8329029 ATGTTGTTATAGATGCCATAAGG + Intronic
1155799452 18:30082126-30082148 AGGATGTTAATGGTGCTTCAGGG + Intergenic
927258311 2:21060071-21060093 AGGTTGTTTTAGCAGCTACTAGG - Intergenic
930136608 2:47908364-47908386 GGGTTGTTATATGTGGTATAAGG + Intergenic
940683881 2:156821843-156821865 AGGTTCTTGAAGGTGCTAAAAGG + Intergenic
943244639 2:185431228-185431250 AGCTTTTTATAGGTAGTACATGG + Intergenic
944991307 2:205239247-205239269 AAGGTGTTCTAGGTGCTAAAAGG + Intronic
948555712 2:238809494-238809516 AGTTTGTGATAGGGGCTAGAAGG - Intergenic
1178787959 21:35671947-35671969 ATGTACTTATAGGTACTACAGGG + Intronic
1179598458 21:42459691-42459713 TGGTAGTTATTGGTGCTGCATGG - Intergenic
1180741705 22:18057597-18057619 AGGTGGTTATGGGTGCTTAACGG + Intergenic
1184799005 22:46748783-46748805 AGGCTGTTGCAGGAGCTACAGGG - Intergenic
949936748 3:9121671-9121693 AGCTCATTATAGGTGATACAAGG + Intronic
950434162 3:12968386-12968408 AGCTTGTCATAGGTGCTTGAAGG - Intronic
950889512 3:16390960-16390982 AGGTTGTCATGGGGGGTACAGGG - Intronic
952031999 3:29154216-29154238 AGGGTGTTATAGGAATTACAAGG + Intergenic
952822416 3:37496593-37496615 AGGTGGTTCTGGCTGCTACATGG - Intronic
960204885 3:114884880-114884902 GGTTTGTTAGAGGAGCTACAGGG - Intronic
967173252 3:186840541-186840563 AGGTTGATGTATGTGCTTCAGGG - Intergenic
968874203 4:3256734-3256756 AGGTTGTGATAAGTGCTGGAAGG + Intronic
969050661 4:4370661-4370683 AGGTTGTTACAGCGGCAACAGGG + Intronic
971010286 4:22426630-22426652 AGATTGTGATAACTGCTACAAGG + Intronic
972805404 4:42525169-42525191 AGGTATTCATAGGTGCTGCAAGG + Intronic
975025585 4:69544293-69544315 TGGCTGTTACAGCTGCTACATGG + Intergenic
985587989 5:750811-750833 ATGGTGTGACAGGTGCTACAGGG + Intronic
985602658 5:843278-843300 ATGGTGTGACAGGTGCTACAGGG + Intronic
989125859 5:38051868-38051890 AAGTTTTGAAAGGTGCTACAAGG + Intergenic
990801713 5:59611481-59611503 AGGTTGTGATGAGTGTTACAAGG - Intronic
996143371 5:119942676-119942698 AGCTAGTTAGAGGTGATACAAGG - Intergenic
998557732 5:143141991-143142013 GGGTTATTACAGGTGCTGCAGGG + Intronic
999107433 5:149086188-149086210 AGGCTGTTATAGGTGTGAAAAGG - Intergenic
1006815110 6:36844835-36844857 AGTTTGTTCTAGGTGCAGCATGG - Intergenic
1015214894 6:130738295-130738317 TGGTTGTTATAGTTTGTACATGG - Intergenic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1023383600 7:39633021-39633043 AGCTAGTTATAGATGCCACAGGG + Intronic
1026890657 7:73979889-73979911 GGTTTGTTATAGGTCCTTCAGGG - Intergenic
1030578267 7:111317895-111317917 AATTTGTTATAGATTCTACATGG + Intronic
1037021007 8:13970094-13970116 AGTTTGTTGTATGTGCTACAAGG + Intergenic
1040991178 8:53352178-53352200 AGATTTTTATAGGAGCTCCATGG - Intergenic
1043587385 8:81784770-81784792 AGGAGGTTACAGGTGCTACAGGG + Intergenic
1047629385 8:126690478-126690500 AGGCAGTTCTAGGTGTTACATGG + Intergenic
1052001139 9:23282496-23282518 AGGTTGTTGTAGGTTGTCCATGG - Intergenic
1053422756 9:37990247-37990269 AGGGTGTTGGAGGTGGTACAGGG + Intronic
1055097441 9:72427917-72427939 ATATTGTTATAGGTACTTCATGG - Intergenic
1059739273 9:117133947-117133969 AGATAGTTATAGGGGTTACAAGG - Intronic
1060568462 9:124615419-124615441 AGGATTTTAAAGGTGCTATATGG - Intronic
1189403944 X:40700612-40700634 AGTTTGTTAGAGTTGCTATAAGG + Intronic
1196675126 X:118412201-118412223 AGTATGTTAAAGGTACTACAAGG + Intronic
1198788990 X:140322051-140322073 AGATTGTTATAGCTGTTATATGG - Intergenic