ID: 1015310459

View in Genome Browser
Species Human (GRCh38)
Location 6:131761659-131761681
Sequence CTCCTGGATTTCCTTACACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015310457_1015310459 -9 Left 1015310457 6:131761645-131761667 CCAAGAAACCAGTACTCCTGGAT No data
Right 1015310459 6:131761659-131761681 CTCCTGGATTTCCTTACACGTGG No data
1015310455_1015310459 3 Left 1015310455 6:131761633-131761655 CCTACAAGACTTCCAAGAAACCA No data
Right 1015310459 6:131761659-131761681 CTCCTGGATTTCCTTACACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015310459 Original CRISPR CTCCTGGATTTCCTTACACG TGG Intergenic
No off target data available for this crispr