ID: 1015314909

View in Genome Browser
Species Human (GRCh38)
Location 6:131807478-131807500
Sequence AGTGGGGGACGGGGCGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015314898_1015314909 22 Left 1015314898 6:131807433-131807455 CCACGTATTTTAAGTGGACGATT No data
Right 1015314909 6:131807478-131807500 AGTGGGGGACGGGGCGCAGAGGG No data
1015314897_1015314909 23 Left 1015314897 6:131807432-131807454 CCCACGTATTTTAAGTGGACGAT No data
Right 1015314909 6:131807478-131807500 AGTGGGGGACGGGGCGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015314909 Original CRISPR AGTGGGGGACGGGGCGCAGA GGG Intergenic