ID: 1015315783

View in Genome Browser
Species Human (GRCh38)
Location 6:131814589-131814611
Sequence TGGATCATAAGGGAAGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1207
Summary {0: 1, 1: 0, 2: 3, 3: 61, 4: 1142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015315783_1015315789 3 Left 1015315783 6:131814589-131814611 CCTTTTCCTTCCCTTATGATCCA 0: 1
1: 0
2: 3
3: 61
4: 1142
Right 1015315789 6:131814615-131814637 TCTTAACTCTAGAATATGGAAGG No data
1015315783_1015315788 -1 Left 1015315783 6:131814589-131814611 CCTTTTCCTTCCCTTATGATCCA 0: 1
1: 0
2: 3
3: 61
4: 1142
Right 1015315788 6:131814611-131814633 ATTATCTTAACTCTAGAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015315783 Original CRISPR TGGATCATAAGGGAAGGAAA AGG (reversed) Intronic
900230802 1:1556207-1556229 TGGATCACAAGGTCAGGAGATGG + Intronic
900862354 1:5242717-5242739 TGGATCATGAGGTCAGGAGATGG - Intergenic
901008929 1:6187389-6187411 CGGATCATGAGGTCAGGAAACGG + Intronic
901234252 1:7659114-7659136 TGAAGCAGAGGGGAAGGAAAGGG + Intronic
902630622 1:17702454-17702476 GGGGACAGAAGGGAAGGAAAGGG - Intergenic
902723326 1:18318960-18318982 TGGATGGTGAGGGAAGGAAGAGG - Intronic
902856261 1:19208242-19208264 TGGATCACAAGGTCAGGATATGG + Intronic
903173815 1:21569164-21569186 TGACTCAGAAGGGATGGAAAGGG - Intronic
903530178 1:24024058-24024080 TGGATCATGAGGTCAGGAGATGG + Intergenic
903717230 1:25376689-25376711 TGGATCATGAGGTCAGGAGATGG + Intronic
904984442 1:34533392-34533414 TGGATCATGAGGTCAGGAGATGG - Intergenic
905118406 1:35662361-35662383 TGGATCACAAGGTCAGGAGATGG - Intergenic
905344851 1:37304411-37304433 GGGAGCATCAGGGAAGAAAAGGG + Intergenic
906237148 1:44218928-44218950 TGGATCATGAGGGAGGTGAAGGG - Intronic
906664818 1:47613509-47613531 TGGATCACAAGGTCAGGAGATGG + Intergenic
906817683 1:48895806-48895828 TGGAGGATAAGAGAAGGCAAAGG + Intronic
907151551 1:52293153-52293175 TGGATCATGAGGTCAGGAGATGG + Intronic
907608354 1:55842290-55842312 TGGATCTTGGGGAAAGGAAATGG - Intergenic
907664733 1:56424931-56424953 TGCAAAAAAAGGGAAGGAAAGGG - Intergenic
907687666 1:56629405-56629427 TGGATCACAAGGTCAGGAGATGG + Intronic
907929908 1:58989725-58989747 AGAATCATAAGAGAAGGAAAAGG + Intergenic
908082705 1:60598321-60598343 GGGAAAAGAAGGGAAGGAAAGGG + Intergenic
908117580 1:60954962-60954984 AAGTTCTTAAGGGAAGGAAAAGG + Intronic
908649365 1:66314902-66314924 TGGATCATCAGAGAAGGACTGGG - Intronic
908845067 1:68316318-68316340 TGGATCATGAGGTCAGGAGATGG + Intergenic
908903128 1:68979149-68979171 TGAACCATAATGGAGGGAAAAGG + Intergenic
909150306 1:71994303-71994325 TGGATCATGAGGTCAGGCAATGG + Intronic
909255722 1:73418398-73418420 TGATTCAGAAGGGGAGGAAAGGG + Intergenic
909731082 1:78890712-78890734 TGGAACATAAGAGAATGAAGGGG - Exonic
909906593 1:81203357-81203379 TGATTCATAAAGGGAGGAAAGGG - Intergenic
910337607 1:86153180-86153202 AGGATAATACTGGAAGGAAAAGG - Intronic
910527590 1:88198585-88198607 TGGATCATGAGGTCAGGAGATGG - Intergenic
910928654 1:92421229-92421251 TGGATCACAAGGTCAGGAGATGG + Intergenic
911119874 1:94285651-94285673 TGGATCATGAGGTCAGGAGATGG + Intergenic
911345885 1:96696448-96696470 AGGTTCAGAAGGGAAAGAAAAGG - Intergenic
911427142 1:97732251-97732273 TGGATCATGAGGTCAGGAGATGG + Intronic
911669982 1:100597056-100597078 TGTGTTCTAAGGGAAGGAAAAGG - Intergenic
911704932 1:100999919-100999941 TGGATCATGAGGTCAGGAGATGG + Intronic
911822124 1:102435885-102435907 TGCATCAGAAAGGAAGGGAATGG + Intergenic
912193034 1:107362950-107362972 TGAAACAGAAGGGAGGGAAAGGG - Intronic
912224258 1:107714755-107714777 TGGAATATAAGGAAAGGAATAGG - Intronic
913237784 1:116799606-116799628 TGGATCACAAGGTCAGGAGATGG + Intergenic
913283170 1:117204641-117204663 TGGATCATGAGGTCAGGAGATGG + Intronic
913546902 1:119878009-119878031 TGGATCATGAGGTCAGGAGATGG - Intergenic
913652975 1:120935806-120935828 TGGATCATGAGGTCAGGAGATGG - Intergenic
913945293 1:125156514-125156536 TGAATCATAATGGAATGGAATGG - Intergenic
914168128 1:145193234-145193256 TGGATCATGAGGTCAGGAGATGG + Intergenic
914518666 1:148395879-148395901 TGGATCATGAGGTCAGGAGATGG - Intergenic
914643156 1:149629949-149629971 TGGATCATGAGGTCAGGAGATGG - Intergenic
914703265 1:150151696-150151718 TGTATCAGAAGGGAGAGAAATGG + Intronic
914936779 1:151988704-151988726 TGTGTCAGAAGAGAAGGAAAAGG - Intronic
915035519 1:152920546-152920568 TGGATCATGAGGTCAGGAGATGG - Intergenic
915357954 1:155267849-155267871 TAGAACATCAGGGTAGGAAAGGG - Intronic
915403332 1:155640307-155640329 TGTATCACAAAGGAAGGGAATGG - Intergenic
915420607 1:155778472-155778494 TGGATCATGAGGTCAGGAGATGG - Intronic
915853427 1:159352893-159352915 TAGATGAGAAGGGAAGGACAAGG + Intergenic
916024880 1:160824754-160824776 TGGATCACAAGGTCAGGAGATGG + Intronic
916103349 1:161411859-161411881 TGGATCACAAGGTCAGGAGATGG + Intergenic
916157261 1:161865379-161865401 TGGATCACAAGGTCAGGAGATGG - Intronic
917030971 1:170691419-170691441 TGGAAGGAAAGGGAAGGAAAAGG - Intronic
917249042 1:173037272-173037294 TGGATCATGAGGTCAGGAAATGG - Intergenic
917407402 1:174722151-174722173 TGGATCATAAGGTCAGGAGATGG - Intronic
918006934 1:180549774-180549796 TGGATCACAAGGTCAGGAGATGG + Intergenic
918186528 1:182132338-182132360 TGACTCATTAGGGGAGGAAAAGG + Intergenic
918323636 1:183388985-183389007 TGGAGCACAAGGAAAAGAAAGGG + Intronic
918386358 1:184011967-184011989 AAGAAAATAAGGGAAGGAAAAGG + Intronic
918602529 1:186380378-186380400 TGGATCAATAGGGAGGGAGAGGG + Intronic
918699070 1:187584246-187584268 TGGATCATGAGGTCAGGAGATGG + Intergenic
918941362 1:191002275-191002297 TGGATAATAGTGCAAGGAAAAGG - Intergenic
921350778 1:214232221-214232243 TGGATCATGAGGTCAGGAGATGG + Intergenic
921438436 1:215155740-215155762 TGGATCATAAGGTCAAGAGATGG - Intronic
921645279 1:217607661-217607683 TGGCTCCTAAGGGAAAGACAGGG - Intronic
921658400 1:217768713-217768735 TGGATCATGAGGTCAGGAATTGG - Intronic
921867202 1:220098108-220098130 TGGATCATGAGGTCAGGAGATGG - Intronic
921906633 1:220502325-220502347 TGGATATAAAGGGAAGGGAAGGG - Intergenic
922289542 1:224198983-224199005 CGGATCATGAGGTCAGGAAATGG + Intergenic
922457276 1:225785298-225785320 TGGATCATGAGGTAAAGAGATGG - Intronic
922550899 1:226493700-226493722 TGGGTCATATGGAAAGGAAGGGG - Intergenic
922991737 1:229919931-229919953 TGGATCATGAGGTCAGGAGATGG - Intergenic
923290876 1:232544336-232544358 TGGATCACAAGGTCAGGAGATGG + Intronic
923305184 1:232681921-232681943 TGGATCACAAGGTCAGGAGATGG + Intergenic
923536800 1:234858715-234858737 TAGAGCATGAGGGAAAGAAATGG - Intergenic
924106661 1:240655665-240655687 CGGATCATGAGGTCAGGAAATGG - Intergenic
924137830 1:240989214-240989236 TGGATCATGAGGTCAGGAGATGG + Intronic
924611185 1:245575086-245575108 TGGATCACAAGGTCAGGAGATGG - Intronic
924637940 1:245806685-245806707 TGGATCATGAGGTCAGGAGATGG + Intronic
924751907 1:246901411-246901433 TGGATCATGAGGTCAGGAGATGG + Intronic
924815839 1:247441214-247441236 AGGAAAATAAGGAAAGGAAAGGG - Intronic
1062891880 10:1068256-1068278 TGGATCATGAGGTCAGGAGATGG + Intronic
1063117285 10:3080292-3080314 TGGATCACAAGGTCAGGAGATGG + Intronic
1063160932 10:3418042-3418064 TGCATCAGAAGGGAAAGAGATGG + Intergenic
1063399043 10:5723276-5723298 TGGATCAGAAGGTCAGGAGATGG - Intronic
1063440377 10:6068138-6068160 GGGAGCACAAGGAAAGGAAAAGG + Intergenic
1063610745 10:7560071-7560093 TGGATCATGAGGTCAGGAGATGG - Exonic
1063644550 10:7865828-7865850 AGGAGCAGAAAGGAAGGAAATGG - Intronic
1063904463 10:10767771-10767793 TGGATCACAAGGTCAGGAGATGG + Intergenic
1064009544 10:11724791-11724813 TGGATCATGAGGTCAGGAGATGG - Intergenic
1064161637 10:12951580-12951602 TGGATCACAAGGTCAGGAGATGG + Intronic
1064426444 10:15233678-15233700 TGGATCATGAGGTCAGGAGATGG + Intronic
1064529877 10:16297201-16297223 GGGAACGTGAGGGAAGGAAAGGG + Intergenic
1064529892 10:16297259-16297281 GGGAACATGAGGGAAGGAAAGGG + Intergenic
1064853874 10:19742636-19742658 TGGATCATGAGGTCAGGAGATGG + Intronic
1065556447 10:26920390-26920412 TGGATCACAAGGTCAGGAGATGG - Intergenic
1065706148 10:28473103-28473125 TGGATTAAAAGGGAAGTACAAGG + Intergenic
1065842775 10:29718102-29718124 TGGATCATGAGGTCAGGAGATGG + Intronic
1065896611 10:30168377-30168399 TGGATCACAAGGTCAGGAGATGG + Intergenic
1066438990 10:35419494-35419516 TGGACCATGAGGGAAGGACTGGG + Intronic
1066592058 10:37006326-37006348 TGGATCATGAGGTCAGGAGATGG + Intergenic
1066675403 10:37882047-37882069 TGGATCATGAGGTCAGGAGATGG - Intergenic
1066764876 10:38793709-38793731 TGGAACATAATGGAATGGAATGG - Intergenic
1066765864 10:38802084-38802106 TGGAACATAATGGAATGGAATGG - Intergenic
1066768242 10:38822376-38822398 TGGAACAGAAGGGAATGGAATGG + Intergenic
1066769882 10:38836187-38836209 TGGAACAGAATGGAATGAAATGG + Intergenic
1066772103 10:38854691-38854713 TGGATCAGAAGGGAATGGAATGG + Intergenic
1066772792 10:38860274-38860296 TGGAACAGAATGGAATGAAATGG + Intergenic
1066773240 10:38864219-38864241 TGGAATATAATGGAATGAAATGG + Intergenic
1066774970 10:38878143-38878165 TGGAATGGAAGGGAAGGAAAAGG + Intergenic
1066775644 10:38883894-38883916 TGGAACATAATGGAATCAAACGG + Intergenic
1066778676 10:38918998-38919020 TGGAATATAATGGAAGGGAATGG + Intergenic
1066937691 10:41858559-41858581 TGGATTATAATGGAATGGAATGG + Intergenic
1066937740 10:41858904-41858926 TGGATTATAATGGAATGGAATGG + Intergenic
1066939372 10:41869459-41869481 TGGATTATAATGGAATGGAAAGG + Intergenic
1066940563 10:41877087-41877109 TGGAATATAATGGAATGAAAAGG + Intergenic
1066940677 10:41877791-41877813 TGGATTATAATGGAATGGAAAGG + Intergenic
1066941371 10:41882131-41882153 TGGATTATAATGGAATGGAATGG + Intergenic
1066943318 10:41894490-41894512 TGGAATATAATGGAATGAAAAGG + Intergenic
1066943825 10:41897713-41897735 TGGATTATAAGGGAATGTAATGG + Intergenic
1066945436 10:41908018-41908040 TGGAATATAATGGAATGAAAAGG + Intergenic
1066969739 10:42303357-42303379 TGGAACAGAATGGAATGAAATGG - Intergenic
1066970964 10:42312004-42312026 TGGAATATAATGGAATGAAATGG - Intergenic
1067021833 10:42807207-42807229 TGGTTCACAAGGGAAGGAACTGG - Intronic
1067131282 10:43567717-43567739 TGGCTTATAAAGGATGGAAAAGG + Intronic
1067630437 10:47959875-47959897 TGGATCAGAAAGGCAGGAAGTGG - Intergenic
1068138217 10:52972214-52972236 AGGACCACAAGGCAAGGAAAGGG - Intergenic
1068303708 10:55177401-55177423 TGGATCAGAAAGGAAGAGAATGG + Intronic
1068564134 10:58552556-58552578 TGGATCACAAGGTCAGGAGATGG - Intronic
1068590968 10:58852729-58852751 TGGAGAATAAGTGAAGGCAAAGG + Intergenic
1069012619 10:63391285-63391307 TGGATCATGAGGTCAGGAGATGG + Intronic
1069094699 10:64244572-64244594 TGGATCACGAGGTAAGGAGATGG - Intergenic
1069185479 10:65417396-65417418 TGGATCATGAGGTCAGGAGATGG + Intergenic
1069974829 10:72204691-72204713 TAGATCTTAAGGGAAGTAATTGG - Intronic
1070116547 10:73534433-73534455 TGGATCATGAGGTAAGGAGATGG - Intronic
1070476639 10:76835687-76835709 TGGATCATGAGGTCAGGAGATGG + Intergenic
1070841030 10:79488003-79488025 TAGATCTTATGGGAAGGATAGGG + Intergenic
1071619643 10:87107577-87107599 GGCATCCTAAGTGAAGGAAATGG + Intronic
1071736911 10:88311081-88311103 TGCTACATAAGGTAAGGAAAAGG + Intronic
1072099500 10:92215969-92215991 TGGATCATGAGGTCAGGAGATGG - Intronic
1072336303 10:94401897-94401919 TGGATCACAAGGTCAGGAGATGG - Intergenic
1072403193 10:95126335-95126357 TGTATCAGAAAGGAAGGGAATGG - Intergenic
1072926084 10:99618820-99618842 TGGAACCAAAGGGAAGTAAAAGG + Intronic
1073026084 10:100488234-100488256 TGGATCATGAGGTCAGGAGATGG + Intronic
1073243745 10:102074928-102074950 TGGATCATGAGGTCAGGAGATGG + Intergenic
1073284274 10:102377994-102378016 TGGATCATGAGGTCAGGAGATGG + Intronic
1073335285 10:102703341-102703363 TGGATCATGAGGTCAGGACATGG - Intronic
1073437933 10:103533148-103533170 TGGATCATGAGGTCAGGAGATGG - Intronic
1073537171 10:104288111-104288133 TGGATCACAAGGTCAGGAGATGG - Intronic
1074200890 10:111234184-111234206 GGGATCTTCAGGAAAGGAAATGG + Intergenic
1074315231 10:112355498-112355520 TGGATCACGAGGTCAGGAAATGG - Intergenic
1074338069 10:112598331-112598353 TGGTTCAGAAGGAAAGGAAGAGG - Intronic
1074368278 10:112877752-112877774 TGGATAATCAGGGAAGAAAGAGG - Intergenic
1074713131 10:116193832-116193854 TGGATCATGAGGTCAGGAGATGG + Intronic
1076392570 10:130114137-130114159 TGGATCACAAGGTCAGGAGATGG + Intergenic
1076609850 10:131717263-131717285 TGGATCATGAGGTCAGGAGATGG + Intergenic
1077558795 11:3242720-3242742 TGGATAAAAAGAAAAGGAAAGGG - Intergenic
1077594882 11:3523322-3523344 TGGATCATAAGGTCAAGAGATGG - Intergenic
1077709110 11:4518071-4518093 TGGATAAGACGGGAAAGAAAAGG + Intergenic
1078515794 11:12021225-12021247 TGGATCACAAGGTCAGGAGATGG - Intergenic
1079052915 11:17178950-17178972 TGGATCATGAGGTCAGGAGATGG - Intronic
1079058017 11:17224386-17224408 TGGATCATGAGGTCAGGAATTGG - Intronic
1079525774 11:21385916-21385938 TGGATATTATGGGAAGGAGAAGG - Intronic
1079563999 11:21858468-21858490 TGGATCATAAGATCAGGAGATGG + Intergenic
1079589625 11:22166600-22166622 TGCAACATATGAGAAGGAAAAGG - Intergenic
1079859783 11:25654492-25654514 TGGATCATGGGGGAAGAAAAAGG - Intergenic
1080061265 11:27959353-27959375 AGGAACATAAAAGAAGGAAATGG - Intergenic
1080825529 11:35845870-35845892 TGGATCACAAGGTCAGGAGATGG - Intergenic
1081046584 11:38281199-38281221 TGGATCATGAGGTCAGGAGATGG + Intergenic
1081070285 11:38602726-38602748 TGGATCAGAAGGAGAGGTAAGGG - Intergenic
1082051564 11:47774550-47774572 TGGATCACAAGGTCAGGAGATGG - Intergenic
1082171195 11:49007629-49007651 TGGATCACGAGGACAGGAAATGG - Intergenic
1082878507 11:58014137-58014159 TGGAGCAGAAGGGAAAGAGAGGG + Intergenic
1083051521 11:59781052-59781074 TTGATGAAAAGGGAGGGAAAAGG - Intronic
1083242216 11:61397388-61397410 TGGATCACAAGGTCAGGAGATGG - Intronic
1083459508 11:62801423-62801445 GGAAGCAGAAGGGAAGGAAAGGG + Intronic
1083788734 11:64970586-64970608 TGGATCACAAGGTCAGGAGATGG - Intronic
1084157245 11:67320700-67320722 AGAACCATGAGGGAAGGAAACGG + Intronic
1084168719 11:67389944-67389966 GGGAGCAGAAGGGAAGGAGAGGG + Intronic
1084368923 11:68724981-68725003 AGTATAATAAGGCAAGGAAAAGG + Intronic
1084393556 11:68893848-68893870 TGGATCACAAGGTCAGGAGATGG + Intronic
1084639146 11:70414120-70414142 TGGATCACAAGGTCAGGAGATGG + Intronic
1084870589 11:72096223-72096245 TGGATCACAAGGTCAGGAGATGG - Intronic
1085117541 11:73943498-73943520 TGGATCACAAGGTCAGGAGATGG - Intergenic
1085221115 11:74874397-74874419 TGTATCAGAAAGGAAGGGAATGG + Intronic
1085226863 11:74929401-74929423 TGGATTATAAGAGAAGAAGAAGG - Intronic
1085355216 11:75830492-75830514 TGGATCACAAGGTCAGGAGATGG - Intronic
1085362597 11:75904404-75904426 AGGATTATAATGGAAAGAAACGG - Intronic
1085578339 11:77627208-77627230 TGGATCATGAGGTCAGGAGATGG + Intronic
1085837284 11:79970677-79970699 GGGAAGAGAAGGGAAGGAAAGGG - Intergenic
1085888418 11:80548331-80548353 TGGATCACAAGGTCAGGAGATGG + Intergenic
1086414647 11:86576598-86576620 GGGCACATAAAGGAAGGAAATGG - Intronic
1086464952 11:87043500-87043522 TGGATCACGAGGTCAGGAAATGG + Intronic
1086694706 11:89829461-89829483 TGGATCACGAGGTCAGGAAATGG + Intergenic
1086711442 11:90015038-90015060 TGGATCACGAGGTCAGGAAATGG - Intergenic
1087905709 11:103694623-103694645 TATATCATAAGGAAAGGAAAGGG + Intergenic
1088255077 11:107896031-107896053 TGGATCATGAGGTCAGGAGATGG + Intronic
1089050786 11:115544057-115544079 TGGATCACTAGGGGAGAAAAAGG + Intergenic
1089087040 11:115828900-115828922 TGGATCATGAGGTGAGGAGATGG + Intergenic
1089691024 11:120186752-120186774 AGGAACAGAAGGGAAGGAAGAGG + Intergenic
1090503978 11:127289540-127289562 TGGATCATGAGGTCAGGAGATGG + Intergenic
1090561189 11:127934514-127934536 TGGATCACGAGGACAGGAAATGG - Intergenic
1091155395 11:133367198-133367220 TGGATCATGAGGTCAGGAGATGG - Intronic
1091491085 12:933233-933255 TGGATCACAAGGTCAGGAGATGG + Intronic
1091948807 12:4574000-4574022 TGGATCACAAGGTCAGGAGATGG + Intronic
1092092152 12:5812198-5812220 GGGAAGAAAAGGGAAGGAAAGGG + Intronic
1092158000 12:6296989-6297011 TGGATCATGAGGTCAGGAGATGG + Intergenic
1092205121 12:6610100-6610122 TGCATAATAAGGGAAGGAGATGG - Intergenic
1092421049 12:8332094-8332116 TGGATCACAAGGGCAAGAGATGG - Intergenic
1092676251 12:10924208-10924230 TGGATCATGAGGTCAGGAGATGG - Intronic
1093007002 12:14061732-14061754 TGTAGCTTAAGGGCAGGAAAAGG - Intergenic
1093877731 12:24370249-24370271 TGGATCATGAGGTCAGGAGATGG + Intergenic
1094045041 12:26158310-26158332 TGAATCAGAAAGAAAGGAAAAGG - Intronic
1094683366 12:32685802-32685824 TTGTCCATAAGAGAAGGAAATGG - Intronic
1095084366 12:38045519-38045541 TGGATCATGAGGTCAGGAGATGG + Intergenic
1095237761 12:39818878-39818900 GGGACAATCAGGGAAGGAAAGGG - Intronic
1095431551 12:42139956-42139978 CGGATCATAAGGTCAGGAGATGG + Intronic
1095640415 12:44479927-44479949 TGTATCAGAAAGGAAGGGAATGG + Intergenic
1096437666 12:51608231-51608253 TGGATCACAAGGTCAGGAGATGG - Intronic
1096531660 12:52246504-52246526 TGGAGCAGCAGGGAAGGGAATGG + Intronic
1097012584 12:55963990-55964012 TGTATCAAAAGGAAAGGAAAGGG - Intronic
1097442028 12:59620757-59620779 TGGCTCAAAAGGGAAGCATATGG + Intronic
1097502353 12:60420245-60420267 TGGATCATCAGATAGGGAAAAGG + Intergenic
1097790124 12:63806718-63806740 GGGATTATTAGGGAGGGAAAGGG - Intronic
1097842251 12:64332879-64332901 GGAATCAAAAGGGAAGCAAAAGG - Intronic
1097887933 12:64748828-64748850 TGGACCAGCAGGGAAGGAATGGG + Intronic
1098089039 12:66881313-66881335 AGGTTCACAAGGGAAGTAAAGGG + Intergenic
1098104205 12:67052534-67052556 TGGATCACAAGGTCAGGAGATGG + Intergenic
1098343868 12:69479617-69479639 TGGATCATGAGGTCAGGAGATGG - Intronic
1098827738 12:75318784-75318806 TATATCCTAATGGAAGGAAATGG - Intronic
1099721565 12:86367574-86367596 TGGATCACAAGGTCAGGAGATGG + Intronic
1100737351 12:97551351-97551373 TGGCTCATAGGAGAAGCAAAAGG + Intergenic
1100777355 12:97988795-97988817 AGGAACAGAAGGGAAGGGAAAGG + Intergenic
1100777382 12:97988895-97988917 AGGAACAGAAGGGAAGGGAAAGG + Intergenic
1100913044 12:99387392-99387414 TGGATCACAAGGTCAGGAGATGG + Intronic
1102410611 12:112714935-112714957 TGGATCAGCAGAGAAGAAAAGGG - Intronic
1102804348 12:115766425-115766447 TGGATCAGAAGGGATGGGAATGG - Intergenic
1103355311 12:120315492-120315514 TGGATCACAAGGTCAGGAGATGG + Intergenic
1103489712 12:121307701-121307723 TGGATCATGAGGTCAGGAGATGG - Intergenic
1103729884 12:123020438-123020460 TTGATGCTAAGGGAAGGAAAGGG + Intronic
1104363374 12:128154411-128154433 TTGTTCATAATAGAAGGAAAAGG - Intergenic
1104457484 12:128927459-128927481 TGGATCACAAGGTCAGGAGATGG - Intronic
1104639030 12:130455556-130455578 TGGACCAAAAGGGAAGGGCATGG + Intronic
1105046553 12:133008551-133008573 TGGATCACAAGGCCAGGAGATGG + Intronic
1105444045 13:20437194-20437216 TGGAACATAGAGGAAAGAAAGGG + Intronic
1105445688 13:20454640-20454662 TGGATCATGAGGTCAGGAGATGG - Intronic
1105508270 13:21029871-21029893 TGGATCATGAGGTCAGGAGATGG + Intronic
1105659624 13:22479510-22479532 TGGATCACAAGGTCAGGAGATGG - Intergenic
1106232853 13:27834750-27834772 TGGATCATGAGGTCAGGAGATGG - Intergenic
1106558631 13:30830794-30830816 TGGCCAATGAGGGAAGGAAATGG - Intergenic
1106778457 13:33031618-33031640 CGGAAAATAAGGGAAGAAAATGG + Intronic
1107092481 13:36496807-36496829 GGTATCTTAAGGAAAGGAAAAGG + Intergenic
1107139070 13:36978107-36978129 TGGATCATGAGGTCAGGAGATGG - Intronic
1107189525 13:37562363-37562385 TGGATCATGAGGTCAGGAGATGG - Intergenic
1107466837 13:40658784-40658806 TGGATCACAAGGTCAGGAGATGG + Intronic
1107627939 13:42309495-42309517 GGTAGCATAAGGAAAGGAAATGG + Intronic
1107676888 13:42806984-42807006 TGGCTCAGAAGGGAAAGAAAGGG - Intergenic
1107744002 13:43485985-43486007 TGGATCATGAGGTCAGGAGATGG + Intronic
1107748774 13:43542353-43542375 TGGATCACAAGGTCAGGAGATGG - Intronic
1108876326 13:55054798-55054820 TGGATCAGAAGGGAAAGGTAGGG - Intergenic
1109178216 13:59181454-59181476 TGGATCACAAGGTCAGGAGATGG + Intergenic
1109634067 13:65090313-65090335 TGGACCATAAGGGAAGCAGCTGG + Intergenic
1109693455 13:65923399-65923421 TGGATCATGAGGTCAGGAGATGG + Intergenic
1110251388 13:73384653-73384675 TGGATCACAAGGTCAGGAGATGG - Intergenic
1110900261 13:80813370-80813392 TGGATCATGAGGTCAGGAGATGG - Intergenic
1110903821 13:80860637-80860659 TGGAAGAAAAGGGAAGGAGAAGG - Intergenic
1110956118 13:81554493-81554515 TGGATCACAAGGTCAGGAGATGG + Intergenic
1111088536 13:83410347-83410369 TGGATCACAAGGTCAGGAGATGG - Intergenic
1111559230 13:89923359-89923381 TGAATCAAAAGGTAAGAAAAAGG - Intergenic
1111573243 13:90115692-90115714 TGGATCACAAGAGTAGGAGATGG + Intergenic
1111580308 13:90214035-90214057 TGGATCACAAGGTCAGGAGATGG - Intergenic
1112019880 13:95362392-95362414 TGGATCACAAGGTCAGGAGATGG + Intergenic
1112187387 13:97140547-97140569 TGCAACATAAGGGAAGTAAGTGG - Intergenic
1112199911 13:97264248-97264270 TGGATCACAAGGTTAGGAGATGG - Intronic
1112204511 13:97310650-97310672 TGGATCACAAGGTCAGGAGATGG - Intronic
1112480515 13:99770941-99770963 TGGATCATGAGGTCAGGAGATGG - Intronic
1112853218 13:103732768-103732790 TGGATCATGAGGTCAGGAGATGG - Intergenic
1113168229 13:107467815-107467837 TGGATCATGAGGTCAGGAGACGG + Intronic
1115028001 14:28765780-28765802 TGGAGCAGGAGAGAAGGAAAAGG + Intergenic
1115036323 14:28861191-28861213 TGGATCACGAGGTCAGGAAATGG + Intergenic
1115330908 14:32197006-32197028 TGGATCACAAGGTCAGGAGATGG - Intergenic
1115615845 14:35093872-35093894 TGGATCACAAGGTCAGGAGATGG - Intronic
1115994126 14:39177666-39177688 TGGATGAAAAGGGAAAGCAAAGG + Exonic
1116513723 14:45780538-45780560 TGGATCACAAGGTCAGGAGATGG - Intergenic
1116582634 14:46661874-46661896 TGGATCTGAAGAAAAGGAAATGG - Intergenic
1117311730 14:54532335-54532357 GGGAGCAGAGGGGAAGGAAATGG + Intronic
1117598390 14:57347163-57347185 TGGATCTTAAGAGAAAGTAATGG - Intergenic
1117609028 14:57463616-57463638 TGGATCATGAGGTCAGGAGATGG - Intergenic
1117698718 14:58392492-58392514 GGGATCATGAGGTCAGGAAATGG - Intergenic
1117818956 14:59628363-59628385 TTGATAATAAGGGAACTAAAGGG + Intronic
1118050270 14:62018807-62018829 TGAAACATAAGGCATGGAAAGGG - Intronic
1118182342 14:63506225-63506247 TGGATCACAAGGTCAGGAGATGG + Intronic
1118377834 14:65192349-65192371 TGGATCACAAGGTCAGGAGATGG - Intergenic
1118625868 14:67658369-67658391 TGGATCACAAGGTCAGGAGATGG + Intronic
1118976971 14:70686320-70686342 TGGATTATAAGGGACGGATTAGG - Intergenic
1119093023 14:71801877-71801899 GGGAACAGAAGGGAAGGGAATGG + Intergenic
1119390613 14:74288888-74288910 TGGATCACAAGGTCAGGAGATGG + Intronic
1119839128 14:77777969-77777991 TGGATCATGAGGTCAGGAGATGG - Intergenic
1120234079 14:81870783-81870805 TGGATCACAAGGTCAGGAGATGG - Intergenic
1120503484 14:85325434-85325456 TGGATAATTAGGGAAGGCATAGG + Intergenic
1120583897 14:86287297-86287319 TGGAAGGGAAGGGAAGGAAAGGG + Intergenic
1120594097 14:86413014-86413036 TGAATCAGATCGGAAGGAAAGGG - Intergenic
1120638690 14:86983265-86983287 TGGATCATGAGGTCAGGAGATGG + Intergenic
1120656948 14:87201685-87201707 TGGATAAAAAGGGAAGTTAATGG + Intergenic
1121549977 14:94791745-94791767 TGGATCATGAGGTCAGGAGATGG - Intergenic
1121760874 14:96443996-96444018 TGGATCATGAGGTCAGGAGATGG - Intronic
1122547445 14:102531842-102531864 TGGATCATGAGGTCAGGAGATGG - Intergenic
1202841765 14_GL000009v2_random:127446-127468 TGGATCACAAGGTCAGGAGATGG + Intergenic
1202874726 14_GL000225v1_random:196920-196942 TGGAATATAATGGAAGGGAAAGG + Intergenic
1123229049 15:17082131-17082153 TGGAACATAATGGAATGGAATGG + Intergenic
1123711012 15:22987671-22987693 TGGATCATGAGGTCAGGAGATGG + Intronic
1123763748 15:23454205-23454227 TGGATCATGAGGTCAGGAGATGG - Intergenic
1124398752 15:29330213-29330235 TGGATCATGAGGTCAGGAGATGG + Intronic
1124648868 15:31460358-31460380 TGGATCACAAGGTCAGGAGATGG - Intergenic
1124769702 15:32521437-32521459 TGGATCACAAGGTCAGGAGATGG + Intergenic
1125026385 15:35033979-35034001 TGGATCACAAGGTCAGGAGATGG + Intergenic
1125062230 15:35438046-35438068 TGGATAATAAGGGATTTAAATGG + Intronic
1125543124 15:40483581-40483603 TGGATCATGAGGTCAGGAGATGG - Intergenic
1125659817 15:41385097-41385119 TGGATCATGAGGTCAGGAGATGG + Intergenic
1125753234 15:42044879-42044901 TGGCTCAGATGGGAAGCAAATGG + Intronic
1126645100 15:50867883-50867905 TGGATCATGGCGGGAGGAAATGG + Intergenic
1126773197 15:52077913-52077935 TGGATCACAAGGTCAGGAGATGG - Intergenic
1126820743 15:52501192-52501214 TGGATCATGAGGTCAGGAGATGG - Intronic
1126821910 15:52512902-52512924 TGGATCATGAGGTCAGGAGACGG + Intronic
1127101572 15:55571028-55571050 AGGATCATAGGGGATGGAGAAGG - Intronic
1127296481 15:57613153-57613175 TGGATCACAAGGTCAGGAGATGG - Intronic
1127360105 15:58237689-58237711 TGGATCACAAGGTCAGGAGATGG + Intronic
1127680463 15:61291068-61291090 TGGATCACAAGGTCAGGAGATGG + Intergenic
1128162989 15:65436749-65436771 TGGATCATGAGGTCAGGAGATGG - Intergenic
1129099079 15:73241644-73241666 AGAATCAAAAGGGAAAGAAAAGG - Intronic
1129142294 15:73610748-73610770 GGGACCAGAAGGGTAGGAAAAGG - Intronic
1129449418 15:75642114-75642136 TGGATCACAAGGTCAGGAGATGG - Intronic
1129640066 15:77366910-77366932 TGGATCATGAGGTCAGGAGATGG + Intronic
1129743571 15:78002403-78002425 TGGATCATGAGGTCAGGAGATGG - Intronic
1130339541 15:82987517-82987539 AAAATCATAAGGCAAGGAAAAGG - Intronic
1130510575 15:84585794-84585816 TGGATCACAAGGTCAGGAGATGG - Intergenic
1130552235 15:84897151-84897173 TGGATCATGAGGTCAGGAGATGG + Intronic
1131190087 15:90307843-90307865 TGGAGCAGAAGGAAAGCAAAAGG - Intronic
1131534428 15:93222931-93222953 TGGATCATGAGGTCAGGAGATGG - Intergenic
1131791456 15:95970202-95970224 AGGAAAAAAAGGGAAGGAAAGGG + Intergenic
1132216541 15:100066674-100066696 TGTATCATAAGGGAAGACAGTGG - Intronic
1132359319 15:101199278-101199300 TGGATCATGAGGTCAGGAGATGG + Intronic
1132728814 16:1350693-1350715 AGGAGCATAAGGGACGGACAGGG - Intronic
1132848496 16:2012455-2012477 TGGATCATGAGGGCAGGAGATGG - Intronic
1132952988 16:2575171-2575193 ATGTTCATAATGGAAGGAAATGG - Intronic
1132961363 16:2624997-2625019 ATGTTCATAATGGAAGGAAATGG + Intergenic
1132976405 16:2713319-2713341 TGGATCACAAGGTCAGGAGATGG - Intronic
1132982881 16:2748049-2748071 TGGATCATGAGGTCAGGACACGG + Intergenic
1133080518 16:3315416-3315438 TGGATCACAAGGTCAGGAGATGG - Intronic
1133139805 16:3735517-3735539 CGGATCACAAGGTCAGGAAAGGG - Intronic
1133361154 16:5174815-5174837 TGGATCATTTGGGATGGACAGGG - Intergenic
1133411114 16:5569729-5569751 GGGGTCATGAGGAAAGGAAAAGG - Intergenic
1133570829 16:7038330-7038352 TTGATCATGAGGGAAAGAAATGG + Intronic
1133671118 16:8021820-8021842 ATAATCATAAGGGTAGGAAAGGG - Intergenic
1134445596 16:14328825-14328847 TGGATCACAAGGTCAGGAGATGG + Intergenic
1134534540 16:15015162-15015184 TGGATCACAAGGTCAGGAGATGG - Intronic
1134757808 16:16684222-16684244 TGGATCATGAGGTCAGGAGATGG - Intergenic
1134988262 16:18674957-18674979 TGGATCATGAGGTCAGGAGATGG + Intergenic
1135062110 16:19279864-19279886 TGGATCACAAGGTCAGGAGATGG - Intergenic
1135070819 16:19349965-19349987 TGGATCACAAGGTCAGGAGATGG + Intergenic
1135077615 16:19407641-19407663 TGGGTGAAAAGGGAAGAAAAGGG + Intergenic
1135223000 16:20629768-20629790 TGGATCATGAGGTCAGGAGATGG + Intronic
1135296823 16:21286865-21286887 TGGATCATGAGGTCAGGAGATGG + Intronic
1135515215 16:23126399-23126421 TGGATCACAAGGTCAGGAGATGG + Intronic
1135584552 16:23658875-23658897 TGGAACCTAAGAGGAGGAAAAGG + Intronic
1136341872 16:29649368-29649390 TGGATCATGAGGTTAGGAGATGG - Intergenic
1136419965 16:30125662-30125684 TGGATCATGAGGTCAGGAGATGG - Intergenic
1136448893 16:30341080-30341102 TGGATCACAAGGTCAGGAGATGG + Intergenic
1136646670 16:31625071-31625093 TGGATCATGAGGTCAGGAGATGG + Intergenic
1136866142 16:33756306-33756328 TGGATCACAAGGTCAGGAGATGG + Intergenic
1137747373 16:50832556-50832578 TGGATCACAAGGTCAGGAGATGG - Intergenic
1137752114 16:50872186-50872208 TGGATCACGAGGTAAGGAGATGG - Intergenic
1138042652 16:53690417-53690439 TGGATCACAAGGTCAGGAGATGG - Intronic
1138112311 16:54333923-54333945 TGGATCACAAGGTCAGGAGATGG - Intergenic
1138129771 16:54469766-54469788 TGGATCATGAGGTCAGGAGATGG + Intergenic
1138211564 16:55167338-55167360 TGGATCACAAGGTCAGGAGATGG + Intergenic
1138320449 16:56106690-56106712 TGGATCATAAGTGGGGAAAACGG - Intergenic
1138451260 16:57094437-57094459 TGGGGCATAAGGGAAGAAGATGG + Intronic
1138454592 16:57114033-57114055 TGGTTGATAAGGGAATGAAATGG + Intronic
1138677120 16:58659639-58659661 TGGATCACAAGGTCAGGAGATGG - Intergenic
1138929819 16:61639433-61639455 TGGATCTGAAAGGCAGGAAAAGG - Intergenic
1139369415 16:66457530-66457552 TGGATCATGGGGTGAGGAAAAGG - Intronic
1139414301 16:66794685-66794707 TGGATCACAAGGTCAGGAGATGG + Intronic
1139909158 16:70386413-70386435 CGGATCACAAGGTAAGGAGATGG - Intronic
1140356748 16:74313033-74313055 ATGATCAAAAGAGAAGGAAACGG - Intergenic
1140465254 16:75175944-75175966 TGGATCACAAGGTCAGGAGATGG + Intergenic
1142046539 16:87928990-87929012 TGGATCACAAGGTCAGGAGATGG - Intronic
1142314144 16:89332837-89332859 TTGAGCATAAAGGAAAGAAATGG - Intronic
1142352468 16:89586491-89586513 TGGGTCATACGGGAATGAAGAGG - Intronic
1142366586 16:89653229-89653251 TGGATCACAAGGTCAGGAGATGG - Intronic
1142370790 16:89680301-89680323 TGGATCATGAGGTCAGGAGATGG - Intergenic
1142633691 17:1243200-1243222 TGGATCACAAGGTCAGGAGATGG - Intergenic
1142993840 17:3749473-3749495 TGGATCACAAGGTCAGGAGATGG - Intronic
1143424569 17:6824225-6824247 TGTATCAAAAGAGAAGAAAAGGG - Intronic
1143469812 17:7165564-7165586 TGGATCATGAGGTCAGGAGATGG + Intergenic
1143760180 17:9096592-9096614 TGGATCACAAGGTCAGGAGATGG - Intronic
1143809522 17:9459736-9459758 TGGATCACAAGGTCAGGAGATGG - Intronic
1143945613 17:10589411-10589433 TGGATCACAAGGTCAGGAGATGG - Intergenic
1144031044 17:11323779-11323801 TGGAGCGTAAGGGAAGGAAAGGG - Intronic
1144072554 17:11687910-11687932 TGGATCATGAGGTCAGGAGATGG + Intronic
1144140300 17:12341402-12341424 TGGATAAATAGAGAAGGAAATGG + Intergenic
1144140914 17:12347404-12347426 TGGATCATGAGGTCAGGAGATGG + Intergenic
1144354361 17:14429947-14429969 TGGATCACAAGGTCAGGAGATGG - Intergenic
1144415613 17:15043611-15043633 TGGATCATGAGGTCAGGAGATGG + Intergenic
1144432527 17:15207478-15207500 TGGATCATGAGGTCAGGAGATGG - Intergenic
1144558393 17:16301790-16301812 TGGATCATGAGGTCAGGAGATGG - Intronic
1145090040 17:19978379-19978401 TGGATCATTAGCGAATGAAAAGG + Intergenic
1145232106 17:21180662-21180684 TGGAGCATGAGGGTAGGAAGGGG + Intronic
1145328712 17:21852939-21852961 TGGAATATAATGGAAGGCAATGG + Intergenic
1145329830 17:21862101-21862123 TGGATCAGAATGGAATGGAATGG + Intergenic
1145329941 17:21863036-21863058 TGGAATATAAGGGAATGGAATGG + Intergenic
1145335679 17:21910442-21910464 TGGATCAAAATGGAATGGAATGG + Intergenic
1145336313 17:21915730-21915752 TGGATTATAATGGAATGGAATGG + Intergenic
1145345908 17:21990366-21990388 TGGATTGGAAGGGAATGAAATGG + Intergenic
1145704557 17:26860436-26860458 TGGATCATAATGGAATCGAATGG + Intergenic
1145707983 17:26939633-26939655 TGGAATATAATGGAAGGGAATGG + Intergenic
1145875919 17:28318341-28318363 TGGAGCATGAGGGAAGGTCAAGG - Intergenic
1146385817 17:32372075-32372097 TGGATCATGAGGTCAGGAGATGG + Exonic
1146428108 17:32762961-32762983 TGGATCACAAGGTCAGGAGATGG + Intronic
1146851351 17:36224509-36224531 TGGATCACAAGGTCAGGAATTGG - Intronic
1146867262 17:36348382-36348404 TGGATCACAAGGTCAGGAATTGG - Intronic
1147070139 17:37948993-37949015 TGGATCACAAGGTCAGGAATTGG - Intergenic
1147081660 17:38028519-38028541 TGGATCACAAGGTCAGGAATTGG - Intronic
1147097611 17:38152489-38152511 TGGATCACAAGGTCAGGAATTGG - Intergenic
1147202340 17:38811308-38811330 TGGATCACAAGGTCAGGAGAAGG + Intronic
1147355900 17:39896503-39896525 TGGGCCATAAGGAAAGAAAAGGG - Intergenic
1147394723 17:40133088-40133110 TGGATGAGAAGAGAAGGAAAAGG + Exonic
1147437868 17:40428817-40428839 TGGATCATGAGGTCAGGAGATGG + Intergenic
1147534661 17:41311811-41311833 GGGGTCATAAAGGCAGGAAAAGG + Intergenic
1147835728 17:43330245-43330267 TGGATCCTAAAGGAACGTAAGGG + Intergenic
1147837432 17:43344463-43344485 TGGATCCTAAAGGAATGTAAGGG + Intergenic
1147992042 17:44340032-44340054 TGGATCACAAGGTCAGGAAATGG - Intergenic
1148069847 17:44902341-44902363 TGGACCACAAAGGAAGGAAAGGG - Intronic
1148151553 17:45399367-45399389 TGGATCATGAGGTCAGGAGATGG + Intronic
1148448340 17:47755480-47755502 TGGATCACAAGGTCAGGAGATGG - Intergenic
1148604550 17:48919205-48919227 TGGATCATAAGGTCAGGAGGTGG - Intronic
1148635171 17:49143560-49143582 TGAATCAAAAGGAAGGGAAAGGG + Intronic
1148833185 17:50449635-50449657 TGGATCATGAGGTCAGGAGATGG - Intronic
1149170721 17:53808063-53808085 TGGATCATGAGGTCAGGAGATGG + Intergenic
1149386660 17:56149395-56149417 TGAATCATAACTAAAGGAAAAGG + Intronic
1149671744 17:58419225-58419247 TGGATCACAAGGTCAGGAGATGG - Intergenic
1149761354 17:59233288-59233310 TGGATCACGAGGTCAGGAAATGG + Intronic
1149806591 17:59623171-59623193 TGGATCAAAGGGGAAAGAACAGG - Intronic
1149920281 17:60651617-60651639 TGGATCATGAGGTCAGGAGATGG - Intronic
1149970626 17:61214459-61214481 TGGATCACAAGGTCAGGAGATGG + Intronic
1149998958 17:61420255-61420277 TGGCTTAAAAGGAAAGGAAATGG + Intergenic
1150079311 17:62222609-62222631 TGGATCACAAGGTCAGGAATTGG - Intergenic
1150184824 17:63169590-63169612 TGGATCATGAGGTCAGGAGATGG + Intronic
1150656114 17:67040792-67040814 TGGATCAATGGGGAGGGAAATGG + Intergenic
1150719501 17:67602456-67602478 TGGAGGAGAAGGAAAGGAAAAGG + Intronic
1150853633 17:68729649-68729671 TGGATCATGAGGTCAGGAGATGG + Intergenic
1150887583 17:69105361-69105383 TGAATCATAAGAGAAGAAAATGG - Intronic
1150891111 17:69151086-69151108 TGGCTCACAAGAGAAGGAAGAGG - Intronic
1150906248 17:69341266-69341288 AGGATCATAAGGTCAGGAGATGG + Intergenic
1151613479 17:75192520-75192542 TGGATCACAAGGTCAGGAGATGG - Intergenic
1151615288 17:75206029-75206051 AGGAACACAAAGGAAGGAAAGGG - Intronic
1151661371 17:75520730-75520752 TGGATCATGAGGTCAGGAGATGG + Intronic
1152429475 17:80240142-80240164 TGGATCACAAGGTCAGGAGATGG + Intronic
1203178031 17_KI270729v1_random:34028-34050 TGGAACAGAAGGGAACGGAATGG + Intergenic
1203178094 17_KI270729v1_random:34606-34628 TGGATCATACTGGAATGGAATGG + Intergenic
1203181200 17_KI270729v1_random:58271-58293 TGGAACAGAACGGAAGGGAACGG + Intergenic
1203195360 17_KI270729v1_random:226481-226503 TGGACCAGAATGGAAGGGAAAGG + Intergenic
1203198210 17_KI270729v1_random:251585-251607 TGGATCAGAATGGAATGGAACGG + Intergenic
1203201097 17_KI270729v1_random:275976-275998 TGGAATAGAAGGGAAGGCAATGG + Intergenic
1203204838 17_KI270730v1_random:26873-26895 TGGACCAGAATGGAAGGGAAAGG + Intergenic
1203207814 17_KI270730v1_random:52339-52361 TGGATCAGAATGGAATGGAACGG + Intergenic
1203210691 17_KI270730v1_random:76677-76699 TGGAATAGAAGGGAAGGCAATGG + Intergenic
1203212995 17_KI270730v1_random:97153-97175 TGGAATATAATGCAAGGAAATGG + Intergenic
1203213283 17_KI270730v1_random:99210-99232 TGGAATATAATGGAAGGGAATGG + Intergenic
1152999467 18:441023-441045 TGGATCACAAGGCCAGGAGATGG + Intronic
1153224504 18:2888490-2888512 TGGATCACAAGGTCAGGAGATGG + Intronic
1153657908 18:7301746-7301768 TGGATCACAAGGTCAGGAAATGG - Intergenic
1153662359 18:7336336-7336358 TGGATCACAAGGTCAGGAGATGG + Intergenic
1153758016 18:8302800-8302822 TGGATAATACTGGAAGGGAATGG - Intronic
1154232877 18:12573960-12573982 TGGATCATGAGGTCAGGAGATGG - Intronic
1154236509 18:12610977-12610999 TGGAGCATAAGTAAAGGAATGGG - Intronic
1155290496 18:24336312-24336334 AGGCTCATAAATGAAGGAAAAGG + Intronic
1155578235 18:27272577-27272599 TGGATCACAAGGTCAGGAGATGG - Intergenic
1155940159 18:31794719-31794741 TGGATCACAAGGACAGGAGATGG - Intergenic
1156177922 18:34569224-34569246 TGAATCGTAAGGGAAAGGAAAGG + Intronic
1156324952 18:36066911-36066933 TGGAGGATAAGGGAGGGAGAAGG - Intronic
1156363223 18:36402707-36402729 TGTGACATAAGGGAAGGGAAAGG - Intronic
1156385236 18:36598770-36598792 TGGATCATGAGGTCAGGAGATGG - Intronic
1157076439 18:44472548-44472570 TGGATCATGAGGTCAGGAGATGG + Intergenic
1157236880 18:45973283-45973305 TGGATCATGAGGTCAGGAGATGG + Intergenic
1157508132 18:48246227-48246249 TGGATCACAAGGTCAGGAGATGG + Intronic
1158192204 18:54843017-54843039 TGGATCATGAGGTCAGGACATGG - Intronic
1158311433 18:56163684-56163706 TGGATCATGAGGTCAGGAGATGG + Intergenic
1158446850 18:57529428-57529450 TGGTTCTCAAGGGAAGGAACGGG + Intergenic
1158498486 18:57978735-57978757 TGGATCACAAGGTCAGGAGATGG - Intergenic
1159493079 18:69163460-69163482 TGGATCACAAGGTCAGGAGATGG - Intergenic
1159655281 18:71025259-71025281 TGGATCACAAGGTCAGGAGACGG + Intergenic
1159713127 18:71788228-71788250 TGTATCACAATGGAATGAAATGG - Intergenic
1159809232 18:72996488-72996510 TGGATCATGAGGTCAGGAGATGG - Intergenic
1160743593 19:699418-699440 TTCACCAAAAGGGAAGGAAATGG - Intergenic
1160829584 19:1097316-1097338 CGGATCATGAGGGCAGGAGATGG - Intergenic
1161475901 19:4485027-4485049 TGGATCATAAGCTCAGGAGATGG - Intronic
1161972057 19:7587756-7587778 TGGATCACAAGGTCAGGAGATGG - Intergenic
1162073801 19:8171289-8171311 CGGATCATAAGGTCAGGAGATGG + Intronic
1162105831 19:8369109-8369131 TGGATGACCAGGGAAGTAAAAGG - Intronic
1162114415 19:8419933-8419955 TGGATCACAAGGTCAGGAGATGG + Intronic
1162278429 19:9676374-9676396 TGGATCATGAGGTCAGGAGATGG - Intergenic
1162769766 19:12942134-12942156 TGGATCACAAGGTCAGGAGATGG + Intronic
1163078104 19:14914397-14914419 TGGATATTATGGGAGGGAAATGG - Intergenic
1163094560 19:15047204-15047226 TGGATCTTAGGGGAAGGAATTGG + Intergenic
1163096927 19:15065433-15065455 TGGATCATGAGGTCAGGAGATGG - Intergenic
1163448894 19:17363967-17363989 TGGATCATGAGGTCAGGAGATGG - Intronic
1163965039 19:20738445-20738467 TGGATCATGAGGTCAGGAGATGG + Intronic
1164245552 19:23425371-23425393 TGGATCATGAGGTCAGGAGATGG + Intergenic
1164308555 19:24026475-24026497 TGGATCATGAGGTCAGGAGATGG - Intergenic
1164397786 19:27880920-27880942 TGTATCAGAAAGGAAGGGAATGG + Intergenic
1164996315 19:32721937-32721959 TGGATCACGAGGTCAGGAAATGG - Intronic
1165429367 19:35763727-35763749 TGGATCACAAGGTCAGGAGATGG - Intronic
1165553745 19:36611063-36611085 TGGATCATGAGGTCAGGAGATGG + Intronic
1166285984 19:41828773-41828795 TGGATCACAAGGTGAGGAGATGG + Intergenic
1167282691 19:48579503-48579525 TGGATCATGAGGTCAGGAGATGG - Intronic
1167474649 19:49692672-49692694 TTCACCATAAGGGAAGGATATGG - Intronic
1167487869 19:49773681-49773703 TGGAAAATGAGGCAAGGAAAGGG + Intronic
1167497470 19:49828004-49828026 TGGATCATGAGGTCAGGAGATGG + Intronic
1167677437 19:50896118-50896140 TGGATCATAAGGTCAGGAGATGG - Intergenic
1167957071 19:53074442-53074464 TGGATCACAAGGTCAGGAGATGG + Intronic
1168087375 19:54058015-54058037 TGGATCACAAGGTCAGGAGATGG + Intronic
1168216947 19:54933366-54933388 TGGATCATGAGGTCAGGAGATGG - Intronic
1168363021 19:55759032-55759054 TGGATTAAAAAGGAGGGAAAGGG + Exonic
1168582196 19:57564825-57564847 TGTATCAGAAAGAAAGGAAACGG - Intergenic
1168589842 19:57624198-57624220 TGTTTCAAAAGGGGAGGAAATGG - Intergenic
925404955 2:3600010-3600032 TGGATCATGAGGTCAGGAGATGG + Intronic
925605896 2:5659532-5659554 TGGATCACAAGGTCAGGAGATGG + Intergenic
926605592 2:14895513-14895535 TGGATCACAAGGTCAGGAGATGG + Intergenic
926683987 2:15684594-15684616 TGGAGCATAGGGGAGGGACAAGG + Intergenic
926864111 2:17340065-17340087 TGGGTCAGAAGGGAAGGTAGGGG - Intergenic
926990171 2:18670746-18670768 TGGATCATGAGGTCAGGAGATGG - Intergenic
927921291 2:26973776-26973798 TGGATCATGAGGTCAGGAGATGG - Intronic
927991575 2:27451538-27451560 TGGATCATGAGGTCAGGAGATGG + Intronic
928468226 2:31544459-31544481 TGGATCAAAAGAGAAAGCAAAGG + Intronic
928653155 2:33422856-33422878 TGGATCACGAGGTCAGGAAATGG + Intergenic
928765866 2:34645097-34645119 TGGATCATGAGGTCAGGAGATGG - Intergenic
928843019 2:35633686-35633708 TGGATCATGAGGTCAGGAGATGG + Intergenic
929032061 2:37658491-37658513 TGGAATATAAGGGAAGGGAAAGG - Intronic
929302850 2:40325708-40325730 TGGATCACAAGGTCAGGAGATGG + Intronic
929309025 2:40400564-40400586 TGGATCACATGAGGAGGAAAGGG + Intronic
929361948 2:41102350-41102372 GGGATCAGAGGGCAAGGAAAAGG + Intergenic
929393623 2:41498041-41498063 TGTATCAGAAAGGAAGGGAATGG + Intergenic
929498919 2:42473117-42473139 TGGATCATGAGGTCAGGAGATGG - Intronic
929721028 2:44367683-44367705 TGGAAGCTAAGTGAAGGAAAGGG + Intronic
930062170 2:47299249-47299271 TGGATCATGAGGTCAGGAGATGG + Intergenic
930189332 2:48441315-48441337 TGGCTGAGAAGGGAAGGGAAAGG + Intronic
930204142 2:48571708-48571730 AGGATTAGGAGGGAAGGAAAGGG + Intronic
930501922 2:52232272-52232294 TGGATCACAAGGTCAGGAGATGG + Intergenic
930657038 2:54016946-54016968 TGGATCATGAGGTCAGGAGATGG - Intronic
930952721 2:57162927-57162949 TGGATCATGAGGTCAGGAGATGG + Intergenic
931023739 2:58083159-58083181 TGGATGATATCTGAAGGAAAGGG - Intronic
931119770 2:59203411-59203433 TGGATCACAAGGTCAGGAGATGG + Intergenic
931627709 2:64271731-64271753 TGGATCACAAGGTCAGGAGATGG + Intergenic
931641734 2:64386560-64386582 TGGATCAGAAAGGAAAGAGAAGG - Intergenic
931918932 2:66991328-66991350 TGAATCATAAGGTTAGGACAGGG - Intergenic
931932127 2:67150405-67150427 TGGATCACAAGGTCAGGAGATGG + Intergenic
932197101 2:69794430-69794452 TGTAACAAAAAGGAAGGAAATGG - Intronic
932691316 2:73916152-73916174 TGGATCACAAGGTCAGGAGATGG + Intronic
932843387 2:75107472-75107494 TGCATAAGAAAGGAAGGAAAGGG + Intronic
933479594 2:82839306-82839328 TGGATGAAAAGGGGAGAAAAAGG + Intergenic
933613460 2:84460248-84460270 TGGATCATAAAGGAAGTATTGGG - Intergenic
933921634 2:87053622-87053644 TGGATCACAAGGTCAGGAGATGG - Intergenic
934169032 2:89324003-89324025 TGGATCACAAGGTCAGGAGATGG - Intergenic
934194305 2:89826909-89826931 TGGAACGGAAGGGAAGGGAAAGG - Intergenic
934198261 2:89858581-89858603 TGGATCACAAGGTCAGGAGATGG + Intergenic
934897149 2:98128870-98128892 TGGATTCCAAGGGAAGGAACAGG - Intronic
935035231 2:99364891-99364913 TGCATCAGAAAGTAAGGAAAGGG - Intronic
935073727 2:99719824-99719846 TGGATCACAAGGTCAGGAGATGG + Intronic
935395968 2:102609616-102609638 TGAATTAAAAGGAAAGGAAAGGG - Intergenic
935740472 2:106143183-106143205 CGGATCATGAGGGCAGGAGATGG + Intronic
935835745 2:107051148-107051170 TGGATCACAAGGGCAGGAGATGG - Intergenic
936395919 2:112129848-112129870 TGGATCACAAGGTAAGGAGATGG + Intergenic
936478085 2:112858540-112858562 TGGATCATGAGGTCAGGAGATGG + Intergenic
936687928 2:114850021-114850043 GGGAAGAAAAGGGAAGGAAAGGG - Intronic
936899535 2:117467997-117468019 TGGATCATGAGGTCAGGAGATGG - Intergenic
937101409 2:119273556-119273578 TGGATCACAAGGTCAGGAGATGG - Intergenic
937218452 2:120327490-120327512 GGGATTATAGGGGAAGGAAAGGG + Intergenic
937783941 2:125873428-125873450 TGGATCACAAGGTCAGGAGATGG - Intergenic
937832862 2:126443068-126443090 TGGATCAAAATGGAAGGCATTGG - Intergenic
938542863 2:132300005-132300027 TGGATCACAAGGTCAGGAGATGG - Intergenic
938625644 2:133106068-133106090 TGGATCATGAGGTCAGGAGATGG + Intronic
939204725 2:139086250-139086272 GGGATGAGAAGGGAAGGAATGGG - Intergenic
939604367 2:144235664-144235686 TGGATCATCAGGTAAGCAGATGG - Exonic
939658815 2:144861625-144861647 TGGATCATGAGGTCAGGAGATGG - Intergenic
939705332 2:145445957-145445979 TGGATCACAAGGTCAGGAGATGG - Intergenic
940210357 2:151250371-151250393 TGGATCACAAGGTCAGGAGATGG + Exonic
940513316 2:154647547-154647569 TGGATAATGAGGTCAGGAAATGG - Intergenic
940910159 2:159203426-159203448 TGGATCATGAGGTCAGGAGATGG - Intronic
940989653 2:160084809-160084831 TGTATCAGAAAGGAAGGAAATGG - Intergenic
941044077 2:160652902-160652924 TGGAGAATAAAGGAAAGAAATGG - Intergenic
941366350 2:164616199-164616221 TGGATCATGAGGTCAGGAGATGG + Intronic
941707155 2:168671186-168671208 TGGATCATGAGGTCAGGAGATGG - Intronic
941708010 2:168680363-168680385 TGGAGAATAATGCAAGGAAAGGG + Intronic
941900701 2:170675605-170675627 TGGATCACAAGGTCAGGAGATGG + Intergenic
941963068 2:171272850-171272872 TGGATCACAAGGTCAGGAGATGG - Intergenic
942339028 2:174923361-174923383 TGGATCACAAGGCCAGGAGATGG - Intronic
943143634 2:184015119-184015141 TAGACCATAAGAGAAGGAAGGGG + Intergenic
943143766 2:184016203-184016225 TGGATTAAAATGGCAGGAAATGG + Intergenic
943258524 2:185628958-185628980 TGGGTGAAAAGGGAAAGAAAGGG + Intergenic
943322924 2:186467901-186467923 TGGATCACAAGGTCAGGAGATGG - Intergenic
943860397 2:192854771-192854793 TGAAGCATAAGGTAAGGAATAGG - Intergenic
943864235 2:192908268-192908290 CGGATCACAAGGTCAGGAAATGG + Intergenic
943894951 2:193345814-193345836 TGGCTTATAAGGGAAAGCAAAGG + Intergenic
944165635 2:196717110-196717132 TGGATCATGAGGTCAGGAGATGG - Intronic
944241639 2:197491381-197491403 TGGATCATGAGGTCAGGAGATGG - Intronic
944301786 2:198131988-198132010 TTGCTCTTAAGGCAAGGAAAGGG - Intronic
944774102 2:202944502-202944524 TGGATCATAAAGGAGCAAAATGG - Intronic
944789331 2:203108624-203108646 TGGATCATGAGGTCAGGAGATGG - Intronic
945088207 2:206155336-206155358 TGGATCATGAGGTCAGGAGATGG - Intronic
945179493 2:207077274-207077296 TGCATCAAAGGGGAAAGAAATGG - Exonic
945278007 2:208007830-208007852 TGGATCACAAGGTCAGGAGATGG + Intronic
945303634 2:208237695-208237717 TGGATCATGAGGTCAGGAGATGG + Intronic
945566800 2:211411128-211411150 TGGATCATGAGGTCAGGAGATGG - Intronic
945571625 2:211474797-211474819 TGAATGAGAAGGGAAGGCAATGG + Intronic
945588999 2:211705173-211705195 TGGATCATGAGGTCAGGAGATGG - Intronic
945731356 2:213540271-213540293 TGGATCACAAGGTCAGGAGATGG - Intronic
945953498 2:216063394-216063416 TGGATCACAAGGTCAGGAGATGG + Intronic
946124124 2:217544956-217544978 TGACTCATAATGCAAGGAAAAGG + Intronic
946764327 2:223025883-223025905 TGGATCACGAGGTCAGGAAATGG + Intergenic
946894103 2:224305622-224305644 TGGATCACAAGGTCAGGAGATGG - Intergenic
946957203 2:224943984-224944006 TGGATCACAAGGTCAGGAGATGG - Intronic
947073577 2:226318004-226318026 TGGAACAGAAGGGAAGGGAAGGG + Intergenic
947103203 2:226643669-226643691 TGTATGATTAGGGAAAGAAAGGG + Intergenic
947148041 2:227086482-227086504 TGGGGCACTAGGGAAGGAAAGGG - Intronic
947454077 2:230237201-230237223 AGGCCCATAAGGAAAGGAAATGG - Exonic
947499281 2:230660325-230660347 TGGACCAGCAGGGAAGGAAAAGG + Intergenic
947684582 2:232071603-232071625 TGGTGTATAATGGAAGGAAATGG + Intronic
948961568 2:241342757-241342779 TGGATCACAAGGTCAGGAGATGG - Intronic
1169000989 20:2167931-2167953 TGGATCATGAGGTCAGGAGATGG - Intronic
1169033686 20:2432644-2432666 TGGATCATGAGGGACTGAGAGGG + Exonic
1169225961 20:3857183-3857205 TGGATTAGGAGAGAAGGAAAAGG - Intronic
1169426214 20:5499226-5499248 TGAATCACAAAGGGAGGAAATGG + Intergenic
1170128254 20:12989373-12989395 TGGATCACAAGGTCAGGAGATGG + Intergenic
1170129174 20:13000447-13000469 TGCATCATGTGGGAAGGCAAGGG - Intergenic
1170233061 20:14071481-14071503 TGGATCACGAGGTCAGGAAACGG - Intronic
1171871738 20:30532838-30532860 TGGATCACAAGGTCAGGAGATGG - Intergenic
1171922441 20:31161931-31161953 TGGAACAGAATGGAATGAAATGG + Intergenic
1171923317 20:31168475-31168497 TGGAATGTAATGGAAGGAAATGG + Intergenic
1171926114 20:31189975-31189997 TGGAAGATAATGGAAGGGAATGG + Intergenic
1171928238 20:31207117-31207139 TGGAACGTAACGGAATGAAATGG + Intergenic
1171928908 20:31212172-31212194 TGGATCACAATGGAATGGAATGG + Intergenic
1171931401 20:31232349-31232371 TGGAGTATAAGGGAATGGAAAGG + Intergenic
1171931447 20:31232718-31232740 TGGAACAGAATGGAATGAAATGG + Intergenic
1172000939 20:31776301-31776323 TGGATCATGAGGTCAGGAGATGG - Intronic
1172267111 20:33625877-33625899 TGGATCATGAGGTCAGGAGATGG + Intronic
1172455666 20:35070619-35070641 TGGATCACAAGGTTAGGAGATGG - Intronic
1172539705 20:35701528-35701550 TGGATCACAAGGTCAGGAGATGG + Intergenic
1172670618 20:36632431-36632453 TGGTTCATATGGGCAGGACACGG + Intronic
1172921491 20:38486572-38486594 AGAATCATCAGGGGAGGAAAGGG - Intronic
1173039013 20:39442639-39442661 TGGATCACAAGGTCAGGAGATGG - Intergenic
1173311539 20:41900623-41900645 TTGATGAGAATGGAAGGAAAGGG + Intergenic
1173455719 20:43199680-43199702 TGGATCATGAGGTCAGGAGATGG + Intergenic
1173531019 20:43769601-43769623 TAGATCAAAAGGAAAAGAAATGG - Intergenic
1174117896 20:48240222-48240244 TGGATCACAAGGTCAGGAGATGG + Intergenic
1174583097 20:51586619-51586641 TGGATCATGAGGTCAGGAGATGG + Intergenic
1175316061 20:58047514-58047536 TGGATCATGAGGTCAGGAGATGG - Intergenic
1176526918 21:7926600-7926622 TGGAACATAATGGAATGGAATGG - Intergenic
1176528360 21:7938762-7938784 TGGAACACAATGGAATGAAATGG - Intergenic
1176531038 21:7958003-7958025 TGGAACAGAATGGAAGGGAATGG - Intergenic
1176657907 21:9604456-9604478 TGGATCACAAGGTCAGGAGATGG + Intergenic
1176749785 21:10681811-10681833 TGGATCCTAATGGAATGGAATGG - Intergenic
1177105491 21:16950211-16950233 TGGATCATGAGGTCAGGAGATGG + Intergenic
1177112620 21:17047144-17047166 TGGATCATGAGGTCAGGAGATGG - Intergenic
1177488674 21:21792450-21792472 TGCATCATAAAGGAAAGAATAGG + Intergenic
1177845573 21:26284052-26284074 TGGATCACAAGGTCAGGAGATGG + Intergenic
1178016185 21:28348243-28348265 CGGATCACAAGGTCAGGAAATGG - Intergenic
1178454570 21:32736408-32736430 TGGATCATGAGGTCAGGAGATGG - Intronic
1178849410 21:36200618-36200640 TGGATCACAAGGTCAGGAGATGG + Intronic
1178975892 21:37220982-37221004 TGGCTCAGAATGGAAGGAAACGG - Intergenic
1179259480 21:39745511-39745533 TGGGTCAGAAGGAAAGGTAAGGG + Exonic
1180283620 22:10724515-10724537 CGGAACATAATGGAATGAAATGG - Intergenic
1180531968 22:16356940-16356962 TGGATTAGAGGGGAATGAAATGG + Intergenic
1180539282 22:16426768-16426790 TGGATCAGAAGGTCAGGAGAAGG - Intergenic
1181172712 22:21018842-21018864 TGGATCATGAGGTCAGGAGATGG - Intronic
1181280724 22:21718238-21718260 TGGATCATGAGGTCAGGAGATGG + Intronic
1181379793 22:22492661-22492683 TGGATCACAAGGTTAGGAATTGG + Intronic
1181478964 22:23185440-23185462 TGGATCACAAGGGCAGGAGATGG + Intronic
1181488918 22:23249204-23249226 TGGATCACAAGGTCAGGAGATGG + Intronic
1181814197 22:25424897-25424919 TGGATCATGAGGTCAGGAGATGG - Intergenic
1181831239 22:25562472-25562494 TGGATCACAAGGTCAGGAGATGG - Intergenic
1182232035 22:28845670-28845692 TGGATCATGAGGTCAGGAGATGG - Intergenic
1182580978 22:31310782-31310804 TGGATCACAAGGTCAGGAGATGG - Intergenic
1183004229 22:34887469-34887491 TTGATCAGAAGGGGGGGAAAAGG + Intergenic
1183077430 22:35435864-35435886 TGAATGAAAATGGAAGGAAATGG + Intergenic
1183199950 22:36379282-36379304 TGGATCATGAGGTCAGGAGATGG + Intronic
1183203855 22:36404939-36404961 CGGATCATAAGGTCAGGAGATGG + Intergenic
1183462569 22:37961070-37961092 TGGATCACAAGGTCAGGAGATGG - Intronic
1184046521 22:41975909-41975931 TGGATTTTAATGGAAGGTAATGG - Intergenic
1184527060 22:45030596-45030618 TGTTTTATCAGGGAAGGAAATGG - Intergenic
1184917138 22:47577486-47577508 TGGATCATGAGGTCAGGAGATGG + Intergenic
1185140616 22:49099161-49099183 TGGATCACAAGGTCAGGAAATGG - Intergenic
1185401233 22:50618742-50618764 TGGATCACGAGGGCAGGAGATGG - Intergenic
1203291227 22_KI270735v1_random:41115-41137 TGGAATAGAAGGGAATGAAATGG - Intergenic
1203317674 22_KI270737v1_random:28847-28869 TGGATTAGAGGGGAATGAAATGG - Intergenic
949758000 3:7435923-7435945 TGGATCACAAGGTCAGGAGATGG - Intronic
949854004 3:8443452-8443474 TGGAGCAAAAGGGCAGGAGAAGG + Intergenic
949922324 3:9012826-9012848 TGGAACATTTGGGAAGGAAAGGG + Intronic
950632931 3:14295517-14295539 TGGATCATGAGGTCAGGAGATGG - Intergenic
950893075 3:16422405-16422427 TGGATCATGAGGTCAGGAGATGG + Intronic
951043976 3:18018061-18018083 TGTAGCAGAAGGGATGGAAAAGG + Intronic
951114827 3:18847210-18847232 TGGATCAAAAGGTCAGGAGATGG - Intergenic
951271105 3:20625420-20625442 TGGATCATGAGGTCAGGAGATGG + Intergenic
951562970 3:23986703-23986725 TGGATCATGAGGTCAGGAGATGG + Intergenic
951727437 3:25775482-25775504 TGCATCATCATGGATGGAAATGG + Intronic
951854046 3:27175039-27175061 TGGATCAAAAAGGATGGAAGTGG + Intronic
952141395 3:30482414-30482436 TGGATCACAAGGTCAGGACATGG - Intergenic
952367487 3:32687674-32687696 CGGATCACAAGGTCAGGAAATGG - Intronic
952571297 3:34720658-34720680 TGGATACTAAAGGATGGAAAAGG - Intergenic
953156850 3:40383403-40383425 TGGATCAGAGAGGAAGAAAATGG + Intergenic
953634503 3:44651238-44651260 TGGATCAGAAGAGGAAGAAAAGG + Exonic
953647345 3:44767670-44767692 TGGATCATGAGGTCAGGAGATGG + Intronic
954321603 3:49835714-49835736 TGGATCACAAGGTCAGGAGATGG + Intronic
954560531 3:51552483-51552505 TGGATCATGAGGTCAGGAGATGG - Intronic
954742444 3:52764406-52764428 TGGATCATGAGGTCAGGAGATGG + Intronic
954855369 3:53639607-53639629 TGGATCATGAGGTCAGGAGATGG - Intronic
955010581 3:55010730-55010752 GGGATCTTAAGGGAAAGGAAAGG - Intronic
955018596 3:55096551-55096573 TGGATCACAAGGTCAGGAGAGGG - Intergenic
955283851 3:57619629-57619651 TGGATCATGAGGTCAGGAGATGG + Intergenic
955851592 3:63225573-63225595 GGGAGCAGAAGGGAAGGGAAGGG + Intergenic
955867958 3:63405473-63405495 TGAATCATAAAGGATGGAGAAGG + Intronic
955915380 3:63902576-63902598 TGGATGCTAAGGGTGGGAAAAGG + Intronic
956300892 3:67771212-67771234 TGGATCACAAGGTCAGGAGACGG - Intergenic
956557419 3:70539062-70539084 TGTGTCATAAAGGAAGGGAATGG - Intergenic
956579479 3:70794377-70794399 TAGAGCATAACTGAAGGAAATGG - Intergenic
956666008 3:71642663-71642685 TGTCTCAGAAGGGAAGGGAAGGG - Intergenic
956667564 3:71656544-71656566 TGGATCATGAGGTCAGGAGATGG - Intergenic
956968327 3:74489971-74489993 TGGAACAGAAGAGAAGCAAAGGG - Intronic
956976114 3:74582181-74582203 TGGATCACAAGGTCAGGAGATGG + Intergenic
957091535 3:75735046-75735068 TGGATCATGAGGTCAGGAGATGG - Intronic
957271928 3:78041468-78041490 TGGATCATAAAGGAAATAAATGG - Intergenic
957358196 3:79118644-79118666 TGGATCATGAGGTCAGGAGATGG + Intronic
957716906 3:83939535-83939557 TGGATCACAAGGTCAGGAGATGG - Intergenic
958516254 3:95120226-95120248 TGGATCATGAGGTCAGGAGATGG - Intergenic
958633755 3:96715445-96715467 TGGATCATGAGGTCAGGAGATGG + Intergenic
959706512 3:109343101-109343123 TGGATCATGAGGTCAGGAGATGG + Intergenic
959708705 3:109362838-109362860 TGGATCACAAGGTCAGGAGATGG - Intergenic
959964316 3:112336181-112336203 TGTTTCATAAGGAAAGAAAAGGG + Intronic
959974689 3:112445514-112445536 GAGATCATAGTGGAAGGAAAGGG - Intergenic
960333185 3:116387868-116387890 TGGATCACAAGGTCAGGAGATGG + Intronic
961723766 3:128912492-128912514 TGGAGCATCTGGGAAGGAAAAGG - Exonic
961863181 3:129934268-129934290 TGCATTATAGGGGAAAGAAACGG - Intergenic
961898727 3:130191304-130191326 TGGATCACAAGGGCAAGAGATGG - Intergenic
962508699 3:136076723-136076745 TGGATCACAAGGTCAGGAGATGG + Intronic
962758011 3:138482507-138482529 TGGGTCATAGGGGAAACAAAGGG - Intergenic
963248280 3:143082873-143082895 TCAATGATAAGGGAAGGAAATGG - Intergenic
963328834 3:143892026-143892048 GGGAAGAAAAGGGAAGGAAAGGG - Intergenic
963516499 3:146316097-146316119 TGGATCACAAGGTCAGGAGATGG + Intergenic
963834802 3:150047582-150047604 TGGATCATAACAGAAAAAAATGG - Intronic
963936816 3:151062088-151062110 TGGATCACAAGGTCAGGAGATGG + Intergenic
964746626 3:160018578-160018600 TGGATCATGAGGTCAGGAGATGG - Intronic
965173111 3:165293961-165293983 TGGAAGGGAAGGGAAGGAAAGGG + Intergenic
965529017 3:169751939-169751961 AAGAGCAAAAGGGAAGGAAATGG - Intergenic
965573822 3:170197792-170197814 TGGATCATGAGGTCAGGAGATGG + Intergenic
965909391 3:173752940-173752962 TGGAGTATAAGGGAAGGGATGGG - Intronic
966120021 3:176510808-176510830 TGTATCACAAAGGAAGGGAATGG - Intergenic
966249076 3:177841903-177841925 TTGAGAATAAGGGAAGGATAAGG + Intergenic
966395581 3:179499380-179499402 TGGATCACAAGGTCAGGAGATGG - Intergenic
966500640 3:180635079-180635101 TGAATCATGATGGAAGGCAAGGG + Intronic
966579240 3:181540951-181540973 TAGATGAGAAGGGAAGGAACTGG + Intergenic
966682372 3:182656442-182656464 TGGATGAGAAGAGAAGGCAATGG + Intergenic
967073751 3:185983903-185983925 TTGAGATTAAGGGAAGGAAAGGG + Intergenic
967357001 3:188582832-188582854 TTGATAATAAGGGAAAGAGAGGG - Intronic
967465810 3:189805188-189805210 TGGATATTAAGGAAAAGAAAGGG - Intronic
967611384 3:191509953-191509975 TGGATCATGAGGTGAGGAGATGG + Intergenic
968026710 3:195448767-195448789 TGGATCACAAGGTCAGGAGATGG + Intergenic
968028214 3:195460989-195461011 TGGATCACAAGGTCAGGAGATGG + Intergenic
968315741 3:197723522-197723544 TTGATCATAAAGATAGGAAAAGG + Intronic
968564629 4:1304660-1304682 TGGATCATGAGGTCAGGAGATGG - Intronic
968796600 4:2710394-2710416 TGGATCATGAGGTCAGGAGATGG - Intronic
969458477 4:7314560-7314582 TGGATCACAAGGTCAGGAGATGG - Intronic
969488477 4:7485597-7485619 TGGAAAACACGGGAAGGAAACGG + Intronic
969596855 4:8154183-8154205 TGGATCACAAGGTCAGGAGATGG - Intronic
970047202 4:11868215-11868237 TAGATGATATGGAAAGGAAAGGG - Intergenic
970563941 4:17312607-17312629 TGGATCATGAGGTGAGGAGATGG - Intergenic
970851132 4:20604568-20604590 CGGATCACAAGGTCAGGAAATGG - Intronic
971678808 4:29670175-29670197 TGGATCACAAGGTCAGGAGATGG - Intergenic
971799295 4:31267572-31267594 TGGATCACAAGGTCAGGAGATGG - Intergenic
971859637 4:32087559-32087581 TGAATCAGAAAGGAAGAAAATGG - Intergenic
971996724 4:33974813-33974835 TGGATCACAAGGTCAGGAGATGG + Intergenic
972268370 4:37484555-37484577 ATAATCATAAGGGAAGGCAAAGG - Intronic
972449965 4:39187195-39187217 TGGATCATGAGGTCAGGAGATGG + Intronic
972500737 4:39675615-39675637 TGGATCATGAGGTCAGGAGATGG + Intergenic
972770064 4:42189460-42189482 TGGATAATGAGGGAAGGAAAGGG - Intergenic
972770151 4:42190114-42190136 TGGATAATGAGGGAAGGAAAGGG - Intergenic
972952141 4:44340529-44340551 TGGATCATGAGGTCAGGAAATGG - Intronic
973160422 4:47009085-47009107 TGGATCATGAGGTCAGGAGATGG - Intronic
973214213 4:47650623-47650645 TGGAGCATGAGGGAAAGACATGG - Intronic
973323839 4:48837194-48837216 TGGATCACAAGGTCAGGAGATGG - Intronic
973354066 4:49121024-49121046 TGGAACAGAACGGAATGAAATGG - Intergenic
973402260 4:49645387-49645409 TGGAATAAAAGGGAATGAAATGG + Intergenic
973402283 4:49645527-49645549 TGGAATAAAAGGGAATGAAATGG + Intergenic
973901395 4:55476397-55476419 TGAATGGCAAGGGAAGGAAAAGG - Intronic
974031586 4:56781304-56781326 TGGATCATGAGGTCAGGAGATGG - Intergenic
974188788 4:58475820-58475842 TGGATCATGAGGTCAGGAGATGG + Intergenic
974630132 4:64478547-64478569 TGGATCATGAGGTCAGGAGATGG + Intergenic
975105008 4:70557712-70557734 TGGATCATGAGGTCAGGAGATGG + Intergenic
975133001 4:70846832-70846854 TGGATCACGAGGTCAGGAAATGG + Intergenic
975375281 4:73636744-73636766 GGGAACAGAAGGGAAGGGAAGGG + Intergenic
975499858 4:75072752-75072774 TGGATCATGAGGTCAGGAGATGG + Intergenic
975750067 4:77513673-77513695 TGGATCACAAGGTCAGGAGATGG - Intronic
975840598 4:78469827-78469849 AGGATGATAAGGGATGGGAACGG + Intronic
975867405 4:78738072-78738094 GGGAACAGAAGGGAAGGGAAGGG + Intergenic
975867429 4:78738150-78738172 GGGAAGAGAAGGGAAGGAAAAGG + Intergenic
976081127 4:81356113-81356135 TGAAAAAAAAGGGAAGGAAAGGG + Intergenic
976533681 4:86186250-86186272 TGGCTAATAAGGGATAGAAATGG + Intronic
976756337 4:88502019-88502041 TGGATCATGAGGTCAGGAGATGG - Intronic
976763082 4:88570979-88571001 TGGATCACAAGGTCAGGAGATGG - Intronic
976936047 4:90634665-90634687 TGGATAATTAGAGAAGGAAATGG + Intronic
977221686 4:94344897-94344919 TGGATCACAAGGTCAGGAGATGG + Intergenic
978164576 4:105591450-105591472 TGGATCACAAGGTCAGGAGATGG - Intronic
978312944 4:107406013-107406035 ATGAACATAAGGGAATGAAAAGG + Intergenic
978370070 4:108020875-108020897 AGGAGGATAAAGGAAGGAAAAGG - Intronic
978430741 4:108630613-108630635 TGGATCATGAGGTCAGGAGATGG + Intergenic
978491680 4:109317049-109317071 TGTATCAAAAAGGAAGGAAATGG + Intergenic
978504106 4:109437844-109437866 TGGATCACAAGGTCAGGAGATGG - Intronic
978790988 4:112663343-112663365 TGGATCACAAGGTCAGGAATAGG - Intergenic
978963975 4:114719322-114719344 TGGATTATAAGATAATGAAAGGG - Intergenic
979730572 4:124018413-124018435 AGGAAGAGAAGGGAAGGAAAGGG - Intergenic
980009122 4:127576772-127576794 TGGATCATACAGGGAGGTAAAGG - Intergenic
980525875 4:133990820-133990842 TAGATAATAAGGGAATGTAAAGG - Intergenic
981119244 4:141029971-141029993 TGGATCACAAGGTCAGGAGATGG + Intronic
981281019 4:142958667-142958689 AGGGTCATAATGAAAGGAAAAGG + Intergenic
981325259 4:143438894-143438916 TGGGACAGAAGGGCAGGAAATGG + Intronic
981388134 4:144155569-144155591 TGGATCATGAGGTCAGGAGATGG - Intergenic
981559230 4:146028939-146028961 TGGAGCAGAAGGAAAGCAAAAGG + Intergenic
981602557 4:146507202-146507224 TGGATCATTAGGGAAAAAACTGG - Intronic
981728534 4:147873214-147873236 TGGACCAGAAGGTAAGGAACTGG + Intronic
981961289 4:150542432-150542454 TGTATCACAAATGAAGGAAAAGG - Intronic
981984876 4:150841877-150841899 TGGATCACAAGGCCAGGAGATGG - Intronic
982736722 4:159014229-159014251 CGGATCACAAGGTCAGGAAATGG + Intronic
983071919 4:163277954-163277976 TGGATCATGAGGTCAGGAGATGG + Intergenic
984008175 4:174338752-174338774 TGGATCACGAGGTAAGGAGATGG - Intergenic
984041768 4:174744045-174744067 GGGCTCACAAGGGAAGGAGAGGG + Intronic
984611885 4:181850097-181850119 TGGGAAATATGGGAAGGAAAAGG - Intergenic
985016153 4:185638175-185638197 TGAAGGAAAAGGGAAGGAAAAGG + Intronic
985033752 4:185818410-185818432 TGGATCACAAGGTCAGGAGATGG - Intronic
985227891 4:187781983-187782005 TGGATCATGAGGTCAGGAGATGG + Intergenic
985257930 4:188087872-188087894 TGGATCATGAGGTCAGGAGATGG + Intergenic
986473151 5:8095359-8095381 TGGATCATGAGGTCAGGAGATGG - Intergenic
986814544 5:11394154-11394176 TGGTTTCTATGGGAAGGAAATGG - Intronic
986895527 5:12362173-12362195 TGGATCACAAGGTCAGGAGATGG - Intergenic
987319352 5:16753388-16753410 TGGATCACAAGGTCAGGAGATGG - Intronic
987350821 5:17020273-17020295 TGGATCATGAGGTCAGGAGATGG + Intergenic
987394369 5:17408176-17408198 TGGATCATGAGGTCAGGAGATGG + Intergenic
987598034 5:20026733-20026755 TGGATCATGAGGTCAGGAGATGG + Intronic
988000644 5:25343366-25343388 TGGATCATGAGGTCAGGAGATGG - Intergenic
988246326 5:28687403-28687425 TGGATCATGAGGTGAGGAGATGG + Intergenic
988337320 5:29923209-29923231 TGTATCAGAAAGGAAGGGAATGG - Intergenic
988442247 5:31246131-31246153 TGGATCATGAGGTCAGGAGATGG - Intronic
989357185 5:40556922-40556944 TGTGACAGAAGGGAAGGAAAGGG - Intergenic
989527282 5:42468131-42468153 TGGATCAGAAGAGGAAGAAAAGG - Intronic
989821345 5:45798171-45798193 TGTCTCAGAAGGGAAGGGAATGG + Intergenic
989909227 5:49601791-49601813 TGGAATATAAGGGAATGGAATGG + Intergenic
989982527 5:50661687-50661709 TGGATCATGAGGTCAGGAGATGG + Intergenic
989985857 5:50697043-50697065 TGGATCATGAGGTCAGGAGATGG + Intronic
990011844 5:51008812-51008834 TGGATCATGAGGTTAGGAGATGG + Intergenic
990117816 5:52410893-52410915 TGTATCATAAGAAAAAGAAAAGG + Intergenic
990488648 5:56282979-56283001 TGGGTGAGAAGGGGAGGAAAGGG + Intergenic
990787059 5:59433456-59433478 TGGCCCTTAAGGGAAGAAAATGG + Intronic
990802359 5:59619252-59619274 TGGATGAGATGGGAAGGGAATGG + Intronic
990890295 5:60641547-60641569 TGGATCACAAGGTCAGGAGATGG - Intronic
991166255 5:63567572-63567594 TGTATCAGAAAAGAAGGAAATGG + Intergenic
991271346 5:64785939-64785961 TGGATCATGAGGTCAGGAGATGG + Intronic
991811661 5:70480733-70480755 TGGATCACAAGGTCAGGAGATGG - Intergenic
991872198 5:71121445-71121467 TGGATCACAAGGTCAGGAGATGG + Intergenic
992061544 5:73053470-73053492 TGGATCACAAGGTCAGGAGATGG + Intronic
992699239 5:79324010-79324032 TGCACCTTAAGGCAAGGAAATGG - Exonic
992717571 5:79526184-79526206 TGGATCACAAGGTCAGGAGATGG - Intergenic
992734111 5:79701902-79701924 TGGATCATGAGGTCAGGAGATGG + Intronic
992796185 5:80256515-80256537 TGGCAGATGAGGGAAGGAAAGGG - Intergenic
993085896 5:83363404-83363426 AGGATCTTAAGGGCAGTAAAGGG + Intergenic
993236151 5:85312745-85312767 TGGATCACAAGGTGAGGAGATGG - Intergenic
994410944 5:99406883-99406905 TGGATCACAAGGTCAGGAGATGG + Intergenic
994515508 5:100767695-100767717 TGGATCATTAGTGAAGCAGAAGG + Intergenic
994753478 5:103766644-103766666 TGGATCATGAGGTCAGGAGATGG + Intergenic
995232234 5:109780280-109780302 TGGATCATGAGGTCAGGAGATGG - Intronic
995281825 5:110344526-110344548 TGGATCATGAGGTCAGGAGATGG + Intronic
996394764 5:123002407-123002429 TGGATCATGAGGTCAGGAGATGG + Intronic
996514366 5:124353613-124353635 TGGATTATGAAGGAAGGAAAAGG + Intergenic
996835401 5:127786476-127786498 CTGATCAAAAAGGAAGGAAATGG - Intergenic
996866360 5:128127342-128127364 TGGATCACAAGGTCAGGAGATGG - Intronic
997018079 5:129961688-129961710 TGGATCAGAAAGGAAGAAAGAGG - Intronic
997028760 5:130097778-130097800 CGGATCACAAGGTCAGGAAATGG + Intronic
997198575 5:131995760-131995782 TTGCTCATAAGAGAAGGAGAAGG - Intronic
997422336 5:133779361-133779383 TGGATCACAAGGTCAGGAGATGG + Intergenic
997549889 5:134742959-134742981 TGGATCATGAGGTCAGGAGATGG - Intronic
998553582 5:143101543-143101565 TGGATGTTAAGGAAAGGAGAGGG - Intronic
998835547 5:146199854-146199876 TGGATCATGAGGTCAGGAGATGG + Intergenic
998997395 5:147880560-147880582 AGGATCATAAGGTAAAGAAGAGG - Intronic
1000265768 5:159634902-159634924 TGGATCATGAGGTAAGGATATGG + Intergenic
1000317358 5:160105323-160105345 TGGATCACAAGGTCAGGAGATGG + Intronic
1000458231 5:161479809-161479831 TGGATCACAAGGTCAGGAATTGG - Intronic
1001034010 5:168283909-168283931 TGGATCATGAGGTCAGGAGATGG + Intergenic
1001112656 5:168910518-168910540 TGGATCACAAGGTCAGGAGATGG + Intronic
1001693148 5:173647590-173647612 TGGACCATATAGGAAGGAATGGG - Intergenic
1002016047 5:176323761-176323783 TGGATCATGAGGTCAGGAGATGG + Intronic
1002114453 5:176947593-176947615 TGGATCATGAGGTCAGGAGATGG + Intronic
1002205640 5:177560639-177560661 TGGATCACGAGGGCAGGAGATGG - Intergenic
1002969561 6:2000256-2000278 TGGATCACAAGGTCAGGAGATGG - Intronic
1002986506 6:2193944-2193966 TGGATCATGAGGTCAGGAGATGG - Intronic
1003137994 6:3447809-3447831 TGGATCATGAGGTCAGGAGATGG - Intronic
1003745391 6:8995763-8995785 CAAATGATAAGGGAAGGAAATGG + Intergenic
1003821116 6:9898295-9898317 TGGATCATGAGGTCAGGAGATGG - Intronic
1004047704 6:12042302-12042324 TGGATCATGAGGTCAGGAGATGG - Intronic
1004701126 6:18080418-18080440 TGGATCATGAGGTCAGGAATTGG + Intergenic
1004933663 6:20486493-20486515 TGGATCATGAGGTCAGGAGATGG - Intronic
1004936389 6:20512380-20512402 TGGATCACAAGGTCAGGAGATGG + Intergenic
1005074319 6:21891564-21891586 TTGAACAGAAAGGAAGGAAATGG - Intergenic
1006195999 6:32242808-32242830 TGGATGAAGAGGGAAGGAGATGG + Intergenic
1006210439 6:32389071-32389093 TGGATCACAAGGTAAAGAGATGG - Intergenic
1006244117 6:32715237-32715259 TGGATCATGAGGTCAGGAGATGG + Intergenic
1006270680 6:32964618-32964640 TGGATCATGAGGTCAGGAGATGG + Intronic
1006315759 6:33290573-33290595 GGGGTTAAAAGGGAAGGAAAGGG - Intronic
1007107277 6:39292479-39292501 GGGAAGAGAAGGGAAGGAAAGGG - Intergenic
1007162789 6:39805773-39805795 TGGATCATGAGGTCAGGAGATGG - Intronic
1007189088 6:39998250-39998272 TGCATCATAAAGGGAGGAATGGG - Intergenic
1007560079 6:42800284-42800306 TGGATCACAAGGTAAGGAGTTGG - Intronic
1008034471 6:46731950-46731972 TGGATTACAGGGGAAGGAGAGGG - Intronic
1008053535 6:46923680-46923702 TTGCTCCTCAGGGAAGGAAAGGG - Intronic
1008073462 6:47120452-47120474 TGGATCACAAGGTCAGGAGATGG + Intergenic
1008094115 6:47321314-47321336 TGGATCACAAGACCAGGAAATGG + Intergenic
1008289532 6:49696876-49696898 TAGATCATGAGGGAAGCCAAGGG - Intronic
1008604050 6:53123041-53123063 TGGATCACAAGGTCAGGAGATGG + Intergenic
1008630173 6:53356987-53357009 TTTATCATAAGGAAAGTAAATGG - Intergenic
1008950712 6:57155600-57155622 AGAAGCATAAGAGAAGGAAAGGG - Intronic
1009483464 6:64190747-64190769 AGGATCATAAGGTAAGAAAATGG + Intronic
1009573071 6:65414541-65414563 TGGATTTAAAGTGAAGGAAAAGG + Intronic
1009607233 6:65887345-65887367 TGGATCACAAGGTCAGGAGATGG - Intergenic
1009700841 6:67178116-67178138 TGGATCACAAGGTCAGGAGATGG - Intergenic
1009783972 6:68307126-68307148 TGGAAGATTAGGGAAGGAAGGGG - Intergenic
1009972242 6:70636995-70637017 TGGATCACAAGGTCAGGAGATGG + Intergenic
1010061016 6:71623469-71623491 TGGATCATAAGGGAGATACAGGG - Intergenic
1010222621 6:73461005-73461027 TGGATCACAAGGTCAGGAGATGG - Intergenic
1010573839 6:77509048-77509070 TGTATCAGAAAGGAAGGGAATGG - Intergenic
1010711123 6:79175669-79175691 TGGATCATGAGGTCAGGAGATGG + Intergenic
1010885005 6:81225637-81225659 CGGATCATAAGGTCAGGAGATGG - Intergenic
1010935040 6:81850740-81850762 TGGATCATGAGGTCAGGAGATGG + Intergenic
1011007493 6:82663090-82663112 GGGATCTTCAGGGGAGGAAATGG - Intergenic
1011029478 6:82906237-82906259 TGGAGAAAAAGGGAAGGAAGAGG - Intronic
1011441132 6:87388500-87388522 TGGATCATGAGGTCAGGAGATGG - Intronic
1011508843 6:88077940-88077962 TGGATCACAAGGTCAGGAGATGG + Intergenic
1011563498 6:88648105-88648127 TGGTTCCTAAGAGAAAGAAATGG - Intronic
1011838555 6:91466324-91466346 TGGATCATAAGCATATGAAAAGG - Intergenic
1012460575 6:99455909-99455931 TGGATCATGAGGTCAGGAGATGG + Intronic
1013284081 6:108665222-108665244 TGGATGAGAAGAGAAGGAGAGGG + Intronic
1013707908 6:112861056-112861078 TGGATCATGAGGTCAGGAGATGG + Intergenic
1014483911 6:121975524-121975546 TGGATCATGAGGTCAGGAGATGG - Intergenic
1014568256 6:122977594-122977616 TGGATCATGAGGTCAGGAGATGG + Intergenic
1015248835 6:131105400-131105422 TGTCTGTTAAGGGAAGGAAAAGG + Intergenic
1015315783 6:131814589-131814611 TGGATCATAAGGGAAGGAAAAGG - Intronic
1015352955 6:132244564-132244586 TGGATCATGAGGTCAGGAGATGG - Intergenic
1015412871 6:132914451-132914473 TGGATCATGAGGTCAGGAGATGG - Intergenic
1015699886 6:136024261-136024283 TGAAACATAAGGAAAAGAAATGG + Intronic
1016772599 6:147868955-147868977 TAGATCATAAATGATGGAAAGGG + Intergenic
1017253555 6:152308052-152308074 TGGATCATGAGGTCAGGAGATGG - Intronic
1017419908 6:154262995-154263017 TGGATCACAAGGTCAGGAGATGG - Intronic
1017617601 6:156261564-156261586 TGGATCACAAGGTCAGGAGATGG + Intergenic
1018014283 6:159698049-159698071 TGGATCATGAGGTCAGGAATTGG + Intronic
1018147920 6:160910745-160910767 TGGATCATGAGGTCAGGAGATGG - Intergenic
1018560836 6:165099487-165099509 TGTATCAGAATGGAAGGGAATGG + Intergenic
1018745152 6:166756065-166756087 TGGATCATGAGGTCAGGAGATGG + Intronic
1019059944 6:169249805-169249827 TGGATCATGAGGTCAGGAGACGG + Intronic
1020015792 7:4830789-4830811 TGGATCACAAGGTCAGGAGATGG + Intronic
1020019256 7:4852842-4852864 TGGTTCAAAAGTGAGGGAAATGG - Intronic
1020232651 7:6331601-6331623 TGGATCATGAGGTCAGGAGATGG - Intronic
1020332012 7:7028308-7028330 CGGATCACAAGGTAAGGAGATGG - Intergenic
1020446813 7:8277321-8277343 TGGATCATGAGGTCAGGAGATGG - Intergenic
1020569913 7:9846245-9846267 TGGATCACAAGGTCAGGAGATGG + Intergenic
1020763337 7:12293102-12293124 TGTATCACAAAGGAAGGAAATGG + Intergenic
1020783739 7:12548340-12548362 TGGATCATGAGGTCAGGAGATGG - Intergenic
1020966669 7:14878520-14878542 TGGATCACAAGGTCAGGAAATGG + Intronic
1021154412 7:17192640-17192662 TGTACAATTAGGGAAGGAAAGGG + Intergenic
1021686269 7:23189687-23189709 TGGATCATGAGGTCAGGAGATGG + Intronic
1022183228 7:27942156-27942178 TTGATCATTAGGAAAGGAAAAGG - Intronic
1022401666 7:30044226-30044248 TGGATCATGAGGTCAGGAGATGG - Intronic
1022532419 7:31075385-31075407 GGGATCATAAAGGAAGGCTATGG - Intronic
1023222868 7:37938211-37938233 CGGATCACAAGGTAAGGAGATGG - Intronic
1023344475 7:39257180-39257202 TGGTACCCAAGGGAAGGAAAAGG + Intronic
1023413035 7:39906769-39906791 TGGATCAAAAAGTAAGGTAAAGG + Intergenic
1023607714 7:41945231-41945253 TGGATCATGAGGTCAGGAGATGG - Intergenic
1023930212 7:44700787-44700809 TGGATCATGAGGTCAGGAGATGG + Intronic
1024078663 7:45837423-45837445 TGGATCATGAGGTCAGGAGATGG - Intergenic
1024271353 7:47644584-47644606 TGGATCACAAGGTCAGGAGATGG + Intergenic
1024575751 7:50762892-50762914 TGGATCATGAGGTCAGGAGATGG + Intronic
1024593123 7:50907175-50907197 TGGATCATGAGGTCAGGAGATGG + Intergenic
1024731858 7:52262102-52262124 TGGATCATGAGGTCAGGAGATGG + Intergenic
1024753321 7:52495994-52496016 TGGATCACAAGGTCAGGAGATGG - Intergenic
1024774814 7:52771674-52771696 GGTAGCAAAAGGGAAGGAAATGG + Intergenic
1024849463 7:53693950-53693972 TGGATCATGAGGTCAGGAGATGG + Intergenic
1025126129 7:56346516-56346538 TGGATCATGAGGTCAGGAGATGG + Intergenic
1025795239 7:64733512-64733534 TGGATCATAAGGTCAAGAGATGG + Intergenic
1025959537 7:66207792-66207814 TGGAGAGAAAGGGAAGGAAAAGG - Intronic
1026001034 7:66558828-66558850 TGGATCTTCTGGGCAGGAAAGGG + Intergenic
1026008939 7:66621690-66621712 TGGATCACAAGGTCAGGATAAGG + Intergenic
1026243640 7:68598799-68598821 TGGATCATAAGGATAGGAAGGGG - Intergenic
1026377041 7:69762241-69762263 AGGATCATAAGTGAAAGAACTGG - Intronic
1026552239 7:71378588-71378610 TTGATCATAAGAGAAGCAGAGGG + Intronic
1026630891 7:72037371-72037393 TGGATCACAAGGTCAGGAGATGG - Intronic
1026665704 7:72337847-72337869 TGGATCCGATGGGAAGGAGAGGG + Intronic
1027584191 7:80036590-80036612 AGGATCATAAGGAAGGGAGAAGG - Intergenic
1027747272 7:82092614-82092636 TGGATCATGAGGTGAGGAGATGG - Intronic
1028642645 7:93060495-93060517 TGGATCACAAGGTCAGGAGATGG + Intergenic
1030004509 7:105104046-105104068 TGGATCACAAGGTCAGGAGATGG - Intronic
1030333523 7:108298420-108298442 AGGATCACAAGGGCAGGAGATGG + Intronic
1030548206 7:110924982-110925004 TGCATGATAAGGGAATAAAAAGG + Intronic
1031090959 7:117353581-117353603 TGGATCAGAAGGTCAGGAGATGG + Intergenic
1031446802 7:121864736-121864758 TGGATCACAAGGTCAGGAGATGG + Intergenic
1032209545 7:129900971-129900993 TGGATCATGAGGTCAGGAGATGG - Intronic
1032904423 7:136347954-136347976 TGGATCAGATTGGAAGGAAGAGG + Intergenic
1033198744 7:139350342-139350364 TGGATCATGAGGTCAGGAGATGG - Intronic
1033300848 7:140183831-140183853 TGGATCACAAGGTCAGGAGATGG + Intergenic
1033321758 7:140346154-140346176 TGGATCACAAGGTCAGGAGATGG + Intronic
1033410067 7:141109262-141109284 TGGACCAAAAGGACAGGAAAAGG + Intronic
1033841080 7:145374153-145374175 TGGATCACAAGGTCAGGAGATGG + Intergenic
1033926020 7:146461178-146461200 TGGATCATGAGGTCAGGAGATGG + Intronic
1033970163 7:147029184-147029206 TGGATCATGAGGTCAGGAGATGG - Intronic
1034231287 7:149530574-149530596 TGTATCAAAAAGGAAGGGAATGG + Intergenic
1034586236 7:152094968-152094990 TTGTTAATAAGGGAAAGAAATGG + Intronic
1034916118 7:155040856-155040878 TGGATCATGAGGTCAGGAGATGG + Intergenic
1035487197 7:159235181-159235203 TGGGTCTTAAGGAAAGGAATGGG + Intergenic
1035721261 8:1795011-1795033 TGGATCATGAGGTCAGGAGATGG - Intergenic
1035852046 8:2930079-2930101 TGGAAAATAAGGAAAAGAAAAGG - Intergenic
1036641590 8:10587733-10587755 TGGAACAGAACGGGAGGAAATGG - Intergenic
1036683678 8:10894247-10894269 GGGGTCATTAGGGAATGAAAAGG + Intergenic
1036994492 8:13639696-13639718 TGGATCATGAGGTCAGGAGATGG + Intergenic
1037007237 8:13797491-13797513 TGGATCATGAGGTCAGGAGATGG + Intergenic
1037486389 8:19351378-19351400 TGGATCACAAGGTCAGGAGATGG + Intronic
1037631908 8:20665650-20665672 TGAATGCAAAGGGAAGGAAAGGG - Intergenic
1038061799 8:23922307-23922329 TGGATCATGAGGTCAGGAGATGG - Intergenic
1038579547 8:28735790-28735812 TCAATCATAAGGGACAGAAAAGG + Intronic
1038633487 8:29266974-29266996 TGGATCACAAGGTCAGGAGATGG + Intergenic
1038889639 8:31705267-31705289 TGGATCACAAGGTCAGGAGATGG - Intronic
1039529651 8:38249323-38249345 TGGATCATGAGGTCAGGAGATGG - Intronic
1039563040 8:38528469-38528491 TGGGACAGAAGGGAAGGAAAGGG - Exonic
1040353745 8:46594968-46594990 TGTATTAAAATGGAAGGAAATGG - Intergenic
1040972577 8:53152947-53152969 TGGATCATGGGGGAAGTAATTGG + Intergenic
1041146868 8:54885303-54885325 TGGGTGAAAAGGGAAGAAAAAGG + Intergenic
1041225200 8:55690729-55690751 TGGATAAAAAGTCAAGGAAAGGG - Intergenic
1043069029 8:75615169-75615191 TGGAACAGGATGGAAGGAAAAGG - Intergenic
1043470788 8:80560258-80560280 TGGATCACAAGGTCAGGAGATGG + Intergenic
1043816119 8:84803649-84803671 TGAATCATAATGGCAGAAAAGGG - Intronic
1043838906 8:85078326-85078348 TGGATCATATGGTAAGAATATGG + Intergenic
1043942903 8:86215862-86215884 TGCATCAGAAAGGAAGGCAAGGG - Intronic
1044526148 8:93253635-93253657 TGGATCATGAGGCCAGGAGATGG + Intergenic
1044736394 8:95283398-95283420 TGGATCATGAGGTCAGGAGATGG + Intergenic
1044952656 8:97449198-97449220 TGGATCACAAGGTCAGGAGATGG - Intergenic
1045428364 8:102089169-102089191 TGGATCACAAGGTCAGGAGATGG + Intronic
1045752097 8:105497206-105497228 TGGATCACAAGGTCAAGAAATGG - Intronic
1046200502 8:110921595-110921617 TGGATCAAAAGGGAATAAGATGG + Intergenic
1046286468 8:112099231-112099253 TGGATCACAAGGTCAGGAGATGG - Intergenic
1046563503 8:115868966-115868988 AGGATCACAAGGTCAGGAAATGG - Intergenic
1046820272 8:118627168-118627190 AGGAACAGAAGGGAAGGGAAAGG - Intergenic
1046908939 8:119604994-119605016 TGGATCACAAGGTCAGGAGATGG - Intronic
1046916486 8:119683133-119683155 TGGATCATGAGGTCAGGAGATGG - Intergenic
1047240710 8:123085630-123085652 TGGATCACAAGGTCAGGAGATGG - Intronic
1047504442 8:125467881-125467903 TGGATCATGAGGTCAGGAGATGG - Intergenic
1047724684 8:127673725-127673747 TGGATCATGAGGTCAGGAGATGG + Intergenic
1048175745 8:132150493-132150515 TGGCTAATAAGGGAATTAAAAGG + Intronic
1048336546 8:133506864-133506886 TGGATCACAAGGTCAGGAGATGG + Intronic
1048450514 8:134529360-134529382 TGTATTTTAAGGGGAGGAAAGGG + Intronic
1048894737 8:138981191-138981213 TGGATCACAAGGTCAGGAGATGG - Intergenic
1049164665 8:141118588-141118610 TGGATCACAAGGTCAGGAGATGG - Intronic
1049696916 8:143988689-143988711 TGGATCACAAGGTCAGGAGATGG - Intronic
1049725578 8:144144173-144144195 TGGGGCATAAGGACAGGAAAAGG + Intergenic
1049972251 9:831602-831624 TGGATCACAAGGTCAGGAGATGG + Intergenic
1050494933 9:6230643-6230665 TGGCTGATAAGGAGAGGAAATGG - Intronic
1050587720 9:7130434-7130456 TGGTTCACAGAGGAAGGAAATGG - Intergenic
1050880420 9:10692991-10693013 TGGATCATGAGGTCAGGAGATGG + Intergenic
1051259134 9:15244911-15244933 TGGATCATGAGGCAAATAAAAGG - Intronic
1051270570 9:15351302-15351324 TGGATCATAAGGGATTGAGTAGG + Intergenic
1051747862 9:20312088-20312110 TAAATCATAAGGGAATGAAAGGG + Intergenic
1051823906 9:21197745-21197767 TGGATCATGAGGTCAGGAGATGG + Intergenic
1052235426 9:26207895-26207917 GGGATCATAAAGCAAGCAAATGG + Intergenic
1052392053 9:27891532-27891554 TGGATTAAAAGGGAGGGAACTGG - Intergenic
1052919232 9:33950292-33950314 TGGATCACAAGGTCAGGAGATGG - Intronic
1053024888 9:34721161-34721183 TGGTTCAGAAGTGAAGGAATGGG - Intergenic
1053233737 9:36434012-36434034 TGGATCACAAGGTAAGGAGATGG + Intronic
1053251760 9:36580249-36580271 TGGATCACAAGGTCAGGAAATGG - Intronic
1053465516 9:38304783-38304805 TGGATCATGAGGTCAGGAGATGG - Intergenic
1053543533 9:38998977-38998999 TGGATTATATGGGAAGAAGAGGG - Intergenic
1053583636 9:39433820-39433842 TGGATCATGAGGTCAGGAGATGG + Intergenic
1053585445 9:39453295-39453317 TGGATCACAAGGTCAGGAGATGG - Intergenic
1053794888 9:41717308-41717330 TGGATCACAAGGTCAGGAGATGG - Intergenic
1054105216 9:60992563-60992585 TGGATCATGAGGTCAGGAGATGG + Intergenic
1054183297 9:61929371-61929393 TGGATCACAAGGTCAGGAGATGG - Intergenic
1054580868 9:66911931-66911953 TGGATCACAAGGTCAGGAGATGG + Intronic
1054655209 9:67659103-67659125 TGGATCACAAGGTCAGGAGATGG + Intergenic
1054833613 9:69652765-69652787 TGGATCATAAGGTCAGGAGATGG + Intronic
1055042847 9:71893864-71893886 TGGATCACAAGGTCAGGAGATGG + Intronic
1055070793 9:72163713-72163735 TGGATCACAAGGTCAGGAGATGG - Intronic
1055107206 9:72525625-72525647 TGGATCATCACTGAAAGAAAGGG + Intronic
1055521963 9:77090434-77090456 TGGATCATGAGGTCAGGAGATGG - Intergenic
1056007679 9:82290096-82290118 TGGATCACAAGGTCAGGAGATGG + Intergenic
1056364374 9:85888702-85888724 TGGATCATGAGGTCAGGAGATGG - Intergenic
1056471086 9:86904890-86904912 TAGCTCATTAGGGAAGGAGAAGG - Intergenic
1056555671 9:87685256-87685278 TGGATCCTAAGGGCAGGATTAGG - Intronic
1057029147 9:91760408-91760430 TGGATCATGAGGTCAGGAGATGG + Intronic
1057177765 9:93011933-93011955 TGGATCATGAGGTCAGGAGATGG + Intronic
1057584303 9:96315654-96315676 TGGATCACAAGGTCAGGAGATGG - Intergenic
1057637498 9:96783546-96783568 TGGTTCATTTGGGAAGGAATGGG + Intergenic
1058260542 9:102824392-102824414 TGGATCAAAAGGGAGGAAAAAGG + Intergenic
1059120210 9:111634886-111634908 TGGGTAATAATGGAAGGCAAAGG + Intronic
1059568576 9:115409297-115409319 TGGATCAGAAGGGAAGCCACTGG + Intergenic
1059748256 9:117223666-117223688 TGAACAATAAGGGAAGAAAAAGG + Intronic
1061095587 9:128455326-128455348 TGGATCATGAGGTCAGGAGATGG + Intronic
1061162057 9:128901239-128901261 TGGATCATGAGGTCAGGAGATGG + Intronic
1061533300 9:131231412-131231434 TGGATCATGAGGTCAGGAGATGG - Intronic
1062166784 9:135111936-135111958 TGGATCATGAGGTCAGGAGATGG - Intronic
1062456568 9:136642286-136642308 TGGATCACAAGGTCAGGAGATGG - Intergenic
1062671619 9:137713492-137713514 TGGATCATGAGGTCAGGAGATGG - Intronic
1203722528 Un_GL000216v2:24005-24027 TGGAACATAATGGAAAGGAATGG - Intergenic
1203727516 Un_GL000216v2:62228-62250 TGGATTAGAACGGAATGAAATGG - Intergenic
1203727560 Un_GL000216v2:62578-62600 TGGATCGTAATGGAATGGAATGG - Intergenic
1203728038 Un_GL000216v2:66565-66587 TGGAATACAAGGGAATGAAATGG - Intergenic
1203385378 Un_KI270438v1:46234-46256 TGGAACAGAATGGAAGGGAATGG + Intergenic
1203390543 Un_KI270438v1:93368-93390 TGGAACAGAATGGAATGAAATGG + Intergenic
1203395184 Un_KI270512v1:21318-21340 TGGAACAGAATGGAAGGGAATGG + Intergenic
1203395280 Un_KI270512v1:21873-21895 TGGAACAGAATGGAATGAAAAGG + Intergenic
1203403377 Un_KI270519v1:137442-137464 TGGAACACAAAGGAAGGCAATGG + Intergenic
1203677150 Un_KI270756v1:32375-32397 TGGAACATAATGGAATCAAACGG - Intergenic
1203677827 Un_KI270756v1:38136-38158 TGGAATGGAAGGGAAGGAAAAGG - Intergenic
1203679563 Un_KI270756v1:52139-52161 TGGAATATAATGGAATGAAATGG - Intergenic
1203680015 Un_KI270756v1:56093-56115 TGGAACAGAATGGAATGAAATGG - Intergenic
1203680702 Un_KI270756v1:61666-61688 TGGATCAGAAGGGAATGGAATGG - Intergenic
1185651016 X:1648132-1648154 TGGATCACAAGGTCAGGAGATGG + Intergenic
1185816761 X:3163521-3163543 TGGATCACAAGGTCAGGAGATGG - Intergenic
1186183144 X:6992493-6992515 TGGATCATGAGGTCAGGAGATGG - Intergenic
1186219136 X:7331054-7331076 AGGATCATAAGAGAAAGAAAAGG - Intronic
1186630229 X:11340504-11340526 TGGATCATGAGGTCAGGAGATGG + Intronic
1187114054 X:16331338-16331360 TGGAAAAAAAGGGAAGGAAAGGG - Intergenic
1187483058 X:19675625-19675647 TGGATCATGAGTTCAGGAAATGG - Intronic
1187894329 X:23966502-23966524 TGGATCACAAGGTCAGGAGATGG - Intergenic
1188218174 X:27504890-27504912 TGGAGCTTAAGGTAAGGACAGGG - Intergenic
1188248861 X:27866764-27866786 TGGATAATCAGGAGAGGAAATGG - Intergenic
1188641527 X:32511298-32511320 TGGATCACAAGGTCAGGAGATGG + Intronic
1188765800 X:34089238-34089260 TGCATCAGAAAGGAAGGAAATGG + Intergenic
1188846001 X:35073253-35073275 TGGATCATGAGGTCAGGAGATGG + Intergenic
1189084563 X:38008071-38008093 AGTATGTTAAGGGAAGGAAAAGG + Intronic
1189258325 X:39658023-39658045 TGGATCATGAGGTCAGGAGATGG + Intergenic
1189341312 X:40206661-40206683 TGGATCATGAGGTCAGGAGATGG + Intergenic
1190231437 X:48585337-48585359 TGGATCATGAGGTCAGGAGATGG - Intergenic
1190754202 X:53387216-53387238 TGGATCACAAGGTCAGGAGATGG - Intronic
1190792514 X:53713279-53713301 TGGATCATGAGGTCAGGAGACGG - Intergenic
1190930327 X:54943526-54943548 TGGATCATGAGGTCAGGAGATGG + Intronic
1192337305 X:70232759-70232781 TAAAGCATAAGGAAAGGAAAGGG + Intergenic
1192462535 X:71329562-71329584 TGGATCATGAGGTGAGGAGATGG - Intergenic
1192463170 X:71335370-71335392 TGGATCACAAGGTCAGGAGATGG + Intergenic
1193254409 X:79330125-79330147 TGGGTGAAAAGGGAAGTAAAGGG + Intergenic
1193560466 X:83011246-83011268 TGTATCAGAAAGGAAGGGAACGG - Intergenic
1193958329 X:87891125-87891147 TGGATCATGAGGTCAGGAGATGG - Intergenic
1194710918 X:97235380-97235402 TGGATCATGAGGTCAGGAGATGG + Intronic
1194967304 X:100303265-100303287 TGGAAAAGAAAGGAAGGAAATGG + Intronic
1195715004 X:107809997-107810019 TGGATCATGAGGTCAGGAGATGG + Intergenic
1195912844 X:109905894-109905916 TGGAGAATCAGGGAAGGACAGGG + Intergenic
1196551666 X:117034071-117034093 TGAATCACTAGGAAAGGAAAGGG + Intergenic
1196655984 X:118217549-118217571 TGGATCATGAGGTCAGGAGATGG - Intergenic
1196800266 X:119536737-119536759 TGGATCACAAGGTCAGGAGATGG + Intergenic
1196948685 X:120854036-120854058 TGGATAACAAGGTCAGGAAATGG + Intergenic
1197353936 X:125411778-125411800 AGGAGCATAATGGAAGGAATGGG - Intergenic
1197355731 X:125436031-125436053 TGTATCAGAAAGGAAGGGAATGG - Intergenic
1197384488 X:125786555-125786577 TGTGTCATAAAGGAAGGAAATGG - Intergenic
1197659551 X:129155404-129155426 GGCATAATAAGAGAAGGAAATGG + Intergenic
1197941891 X:131799067-131799089 AAAATCATATGGGAAGGAAAGGG + Intergenic
1198087753 X:133296487-133296509 TGAATCATTAGGAAAGGACAAGG - Intergenic
1198105990 X:133461903-133461925 TGGATCATGAGGTCAGGAGATGG - Intergenic
1198840561 X:140852777-140852799 TGGATCACAAGGTGAGGAGATGG - Intergenic
1199092108 X:143704608-143704630 TGGAAGATAAGAGAAGGGAAAGG + Intergenic
1199342237 X:146694448-146694470 TGGATCATGAGGTCAGGAGATGG - Intergenic
1199446569 X:147929995-147930017 TGGATCATAAGTTACAGAAAAGG - Exonic
1199779133 X:151042267-151042289 TGGATCACGAGGTAAGGAGATGG + Intergenic
1200219172 X:154382603-154382625 TGGATCATGAGGTCAGGAGATGG - Intergenic
1200842947 Y:7802205-7802227 TGGATCACGAGGTAAGGAGATGG + Intergenic
1200945463 Y:8830906-8830928 GCCATCAAAAGGGAAGGAAAGGG + Intergenic
1201099380 Y:10659928-10659950 TGGAACAGAAGGGAATGTAATGG - Intergenic
1201099468 Y:10660562-10660584 TGGAACAGAAGGGAATGGAATGG - Intergenic
1201104269 Y:10751878-10751900 TGGAGCGGAATGGAAGGAAATGG - Intergenic
1201105368 Y:10759507-10759529 TGGAACATAACGGAATGGAAGGG - Intergenic
1201110075 Y:10792792-10792814 TGGAATATAAGGGAATGGAATGG - Intergenic
1201113173 Y:10815420-10815442 TGGAACAGAAGGGAAAGGAACGG - Intergenic
1201116249 Y:10837519-10837541 TGGATCAGAATGGAATGGAAAGG - Intergenic
1201118791 Y:10857246-10857268 TGGAACGGAAGGGAAGGGAATGG - Intergenic
1201119524 Y:10862334-10862356 TGGAATAGAAGGGAGGGAAATGG - Intergenic
1201120654 Y:10870266-10870288 TGGAGCAGAATGGAATGAAATGG - Intergenic
1201123313 Y:10889719-10889741 TGGAATATAATGGAAGGGAACGG - Intergenic
1201128745 Y:10936706-10936728 TGGAACAGAATGGAAGGGAATGG - Intergenic
1201174233 Y:11298096-11298118 TGGATTGGAATGGAAGGAAATGG - Intergenic
1201195916 Y:11494486-11494508 TGGAACAGAATGGAATGAAAAGG + Intergenic
1201198472 Y:11517416-11517438 TGGAACAGAAGGGAATGGAATGG + Intergenic
1201209134 Y:11663235-11663257 TGGATCGGAAGGGAATGGAATGG + Intergenic
1201214149 Y:11707409-11707431 TGGAACAGAATGGAATGAAATGG + Intergenic
1201214314 Y:11708807-11708829 TGGAACAGAATGGAAGGGAATGG + Intergenic
1201215890 Y:11722269-11722291 TGAATCAAAATGGAACGAAATGG + Intergenic
1201216632 Y:11728464-11728486 TGGAGCAGAATGGAATGAAATGG + Intergenic
1201217249 Y:11733910-11733932 TGGAACAGAATGGAATGAAATGG + Intergenic
1201280164 Y:12335550-12335572 TGGATCATGAGGTCAGGAGATGG + Intergenic
1201357451 Y:13112459-13112481 TGCATCACAAGGGAAGAAATGGG + Intergenic
1201772883 Y:17634549-17634571 TGGATCACAAGGTCAGGAGATGG - Intergenic
1201828672 Y:18271437-18271459 TGGATCACAAGGTCAGGAGATGG + Intergenic
1202585841 Y:26426288-26426310 TGGATCACAAGGTCAGGAGATGG - Intergenic