ID: 1015315784

View in Genome Browser
Species Human (GRCh38)
Location 6:131814595-131814617
Sequence AGATAATGGATCATAAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015315784_1015315789 -3 Left 1015315784 6:131814595-131814617 CCTTCCCTTATGATCCATTATCT 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1015315789 6:131814615-131814637 TCTTAACTCTAGAATATGGAAGG No data
1015315784_1015315788 -7 Left 1015315784 6:131814595-131814617 CCTTCCCTTATGATCCATTATCT 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1015315788 6:131814611-131814633 ATTATCTTAACTCTAGAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015315784 Original CRISPR AGATAATGGATCATAAGGGA AGG (reversed) Intronic
903891935 1:26575545-26575567 AGATATTGGGTAATCAGGGAAGG + Intergenic
905932675 1:41800644-41800666 AGATAATGAAACAGAAGGGAAGG + Intronic
908745964 1:67376764-67376786 AGATATTGGAACAGAAGGGAAGG - Intronic
909007646 1:70295974-70295996 AGATAAGGAATTATAATGGATGG - Intronic
909183470 1:72453920-72453942 AGATAATGAATGATAATGGTAGG - Intergenic
909755312 1:79218836-79218858 AGCAAATGGATCATAAGGTCAGG + Intergenic
910390878 1:86742653-86742675 AGATAAAGGATCTTATTGGAGGG - Intronic
911028713 1:93462901-93462923 AGATACTTTATCATAAAGGAGGG - Intronic
914840238 1:151242313-151242335 AGATAAAGGCTCAGAAGGAAGGG - Intronic
916458013 1:164991221-164991243 AGATCATCTATCCTAAGGGAAGG - Intergenic
916488514 1:165280379-165280401 AGATGATGGCTCATCAGGGTGGG - Intronic
918322742 1:183380292-183380314 AGATAAAGGAAAATAAGGGTAGG - Intronic
919249989 1:195042545-195042567 ATATAATCCATCATAAGAGAAGG - Intergenic
920962958 1:210680502-210680524 AGATAATGGTTTATACTGGAAGG + Exonic
922997957 1:229981975-229981997 AGATGATGGATGAGAGGGGAAGG + Intergenic
924625375 1:245693034-245693056 ATATAATGGATGATAGGGGACGG - Intronic
1067021834 10:42807213-42807235 ACATTATGGTTCACAAGGGAAGG - Intronic
1071166107 10:82809150-82809172 ATATATTGGATAATATGGGATGG - Intronic
1071743444 10:88388367-88388389 AGAGAATGGATTTCAAGGGAAGG - Intronic
1077935626 11:6782864-6782886 AGATCATGGATCAAAAGACAGGG + Intergenic
1081021901 11:37958035-37958057 AGTAAATGGATCATGAGGGTGGG - Intergenic
1081450409 11:43166104-43166126 AGATAATGCATAAGTAGGGAAGG + Intergenic
1081825701 11:46049355-46049377 ACCTAATGGATCAAAAGGAATGG - Intronic
1084453600 11:69254538-69254560 AGGAAATGGATCATCAGGGAAGG + Intergenic
1084546275 11:69816599-69816621 AGAGAAGGGAACATCAGGGAAGG + Intronic
1085876822 11:80417503-80417525 AGTTACAGGATGATAAGGGAAGG - Intergenic
1086254326 11:84856500-84856522 AGGTAATGGATTATATGTGAAGG - Intronic
1087929869 11:103964674-103964696 AGACAATGGATCATTTGGGAGGG + Intronic
1088187727 11:107191727-107191749 AGCTAATGAATCACAATGGAAGG - Intergenic
1090970020 11:131633307-131633329 AGTCAATGGGACATAAGGGATGG - Intronic
1091053828 11:132400197-132400219 AGCTCATGGATCCTGAGGGATGG + Intergenic
1091137410 11:133204349-133204371 AGAGAATGGAGAATAAGGGTAGG - Intronic
1098104944 12:67059742-67059764 AGATAATGGTTCAGAAGGATGGG - Intergenic
1100122510 12:91385075-91385097 AGATCAGGAATCATAAGTGAGGG + Intergenic
1100147580 12:91697017-91697039 AGATTATGGTTCACATGGGATGG + Intergenic
1100585236 12:95973277-95973299 AGATAAAGGACCTTCAGGGATGG - Exonic
1101143547 12:101820327-101820349 ACATAATGGAACATAAGGACTGG + Intronic
1101404564 12:104416526-104416548 AGCGAATGGAGCATAGGGGATGG + Intergenic
1101902993 12:108805063-108805085 AGATGATCGAAGATAAGGGAGGG + Exonic
1102416375 12:112766506-112766528 AGAAAAGGGATCACAAGGGAAGG + Intronic
1102804350 12:115766431-115766453 ACAGCATGGATCAGAAGGGATGG - Intergenic
1104108167 12:125682779-125682801 GGAGAATGCATCATAAGTGATGG + Intergenic
1108888758 13:55226301-55226323 AGATATTGGAAAATAAGGCAGGG - Intergenic
1110982843 13:81923668-81923690 AGATAATAAATTATAATGGAGGG + Intergenic
1111263538 13:85775782-85775804 AGATATCTGGTCATAAGGGAGGG + Intergenic
1111615392 13:90655790-90655812 AGGTTATGGTTCATAAAGGATGG + Intergenic
1113228998 13:108192044-108192066 AGAAAATGAATCATAAAGCAAGG + Intergenic
1122338553 14:101009468-101009490 AGATAAAGGAACATGGGGGAAGG - Intergenic
1126230693 15:46320248-46320270 AGATCATGGAAAAGAAGGGAAGG - Intergenic
1128113208 15:65089277-65089299 GGATAATGGCTCATAAATGATGG - Intergenic
1129057120 15:72828182-72828204 AGATAAGGTATCATAAGGGAGGG + Intergenic
1131891681 15:96978930-96978952 AAATAATGAATGACAAGGGAAGG + Intergenic
1133150343 16:3823748-3823770 AGAGACTGGAGCATGAGGGATGG + Intronic
1139155881 16:64441745-64441767 ATATAATGTAACATAATGGAAGG - Intergenic
1139411747 16:66767647-66767669 AGATTCTGGATCTTAATGGAAGG + Intronic
1143745197 17:8988664-8988686 AGATAATGAATCATGGGGGCAGG + Intergenic
1149774649 17:59347773-59347795 AGTTAAAGGATCCTAATGGAAGG + Intronic
1152402885 17:80079629-80079651 AGATACTGGATCACCAGGCACGG + Intronic
1156324953 18:36066917-36066939 TGATAATGGAGGATAAGGGAGGG - Intronic
1156392378 18:36662658-36662680 TAATAATGGATAATAAGGGATGG + Intronic
1163194058 19:15702207-15702229 AGATACTGGCTCCTCAGGGAAGG + Intergenic
1163619150 19:18347937-18347959 AGAGAAAGGATCAGAAGAGACGG - Intronic
1164706529 19:30324165-30324187 AGATAATGGATGATGATGAATGG - Intronic
1167633230 19:50638789-50638811 AGACATGGGTTCATAAGGGAAGG + Intronic
1167807235 19:51796487-51796509 GGAGAATGGATCTTAGGGGAGGG + Intronic
1167915060 19:52734099-52734121 AGATGAAGGATCACAAGGTAGGG - Intronic
930101297 2:47605538-47605560 AGATAATGGGGCATGGGGGAGGG - Intergenic
930380092 2:50617098-50617120 AGATAATGGTTCAGACAGGATGG + Intronic
932305023 2:70695905-70695927 AGATAAGGGTTCATTAGAGATGG - Intronic
933724664 2:85419674-85419696 ACATACTGGATCATCAAGGAAGG + Intronic
937475587 2:122212241-122212263 AGGCATTGGATCTTAAGGGATGG - Intergenic
937765523 2:125656349-125656371 TGATAATGGATGATAATGGATGG - Intergenic
938879816 2:135573564-135573586 AGAGTAGGGATTATAAGGGAGGG + Intronic
941438057 2:165496396-165496418 AGATAATGGCTCAGTAGGAAAGG - Intronic
942091231 2:172493338-172493360 AGAGAAAGGATCCTTAGGGAAGG - Intronic
943111451 2:183611221-183611243 AGATAATGCATGATAATGAAAGG - Intergenic
943151505 2:184119646-184119668 AGCCAATGGATCACAGGGGAGGG - Intergenic
945123323 2:206482562-206482584 AGAGAAAGGGTCATATGGGATGG + Intronic
945156592 2:206846376-206846398 GGAGAATGGATCATGAGGGAAGG - Intergenic
946870140 2:224077387-224077409 AGACAAGGGATCCAAAGGGAAGG - Intergenic
1168977407 20:1977767-1977789 AGATAAAGGATAACAAGGGTAGG - Intergenic
1171247310 20:23621993-23622015 GGTTATTGGATCATAAGGGCAGG + Intergenic
1173100199 20:40080377-40080399 AGATAGTGTATCACAAGGCAAGG + Intergenic
1174669487 20:52293009-52293031 AGATAACGCAACCTAAGGGAAGG - Intergenic
1175358020 20:58384440-58384462 GGGTAATGGATGATCAGGGACGG + Intergenic
1176648924 21:9528542-9528564 AGATAAAGGAGCAAAAGAGATGG - Intergenic
1179175335 21:39004143-39004165 AGATAATGTCTCATAGAGGAAGG + Intergenic
1180578255 22:16802275-16802297 AGATAATGAAAGACAAGGGATGG - Intronic
1182490255 22:30667254-30667276 ACATAATGGACCATAAAGGTCGG - Intronic
1182743056 22:32582823-32582845 AGATAATGGATCAGCAGCCAAGG - Intronic
951164821 3:19472406-19472428 AGATAATGAATCATGTGGGCAGG + Intronic
953339564 3:42122149-42122171 AGATAAAGTATCAAAAGGTAAGG - Intronic
960146332 3:114207861-114207883 ATATAATATATCAAAAGGGATGG + Intergenic
960494542 3:118359263-118359285 TGCTAATGGATCATTAGGGGTGG + Intergenic
960755508 3:121007237-121007259 AGATAATGTATCATAATCAAGGG - Intronic
962477170 3:135765212-135765234 AGTTATTGAATCATGAGGGAGGG + Intergenic
962718428 3:138149302-138149324 GGATAATGGATAATGAAGGAAGG + Intergenic
964075569 3:152687887-152687909 AAATATTGGATCATCAGGTATGG - Intergenic
964736681 3:159925383-159925405 AGCAAATGGATGAGAAGGGAAGG - Intergenic
967155983 3:186692659-186692681 AGATAATAGATCAAATGGAAAGG + Intergenic
967226253 3:187294268-187294290 AGATCATGGGTCATCAGGGGTGG + Intergenic
970859204 4:20682644-20682666 AGAGAAAGGCTCATGAGGGAGGG + Intergenic
972007753 4:34132427-34132449 AGATAATGAATGCTGAGGGAAGG - Intergenic
972782438 4:42297662-42297684 AGAAAATTGACCATAAGGGCTGG + Intergenic
973157583 4:46976136-46976158 AGAGAAGGGAGCTTAAGGGAAGG + Intronic
974279599 4:59775310-59775332 AGATCATGTATCTTAAAGGAAGG - Intergenic
974574591 4:63701630-63701652 AGAGAATGGATAAACAGGGATGG + Intergenic
974689519 4:65278437-65278459 AGGTTCTGGAGCATAAGGGATGG + Intergenic
979527629 4:121734138-121734160 GGTTAATGGATTATCAGGGATGG + Intergenic
981636453 4:146886427-146886449 AGATTATGCATTATAAAGGATGG - Intronic
984127657 4:175832060-175832082 AGATAAGGGAGTATCAGGGAAGG - Intronic
985125225 4:186687022-186687044 AGATAAAGGCTAATGAGGGATGG - Intronic
987300365 5:16591853-16591875 AAAGAATAGATAATAAGGGAAGG + Intronic
995043795 5:107620967-107620989 AAAGAATGGAACATTAGGGAAGG + Intronic
996875878 5:128239971-128239993 AAATAAAGGATCATCAGGGAAGG + Intergenic
998211512 5:140202619-140202641 AGTTGATGGATCATATTGGACGG - Intronic
999056321 5:148581596-148581618 TGATAATACATAATAAGGGAAGG - Intronic
1000427346 5:161107254-161107276 AGAAAATGGACCAGAGGGGATGG + Intergenic
1000929855 5:167238104-167238126 AGATAATGATTCAGAAGGGTTGG + Intergenic
1002419225 5:179137061-179137083 AGATAAAGGCTGAGAAGGGAAGG - Intronic
1002669347 5:180853437-180853459 GGAGAATGGAGCAGAAGGGATGG + Intronic
1003737785 6:8896893-8896915 AGTTAATGGTTCATTAGGAAGGG - Intergenic
1003837039 6:10082617-10082639 AAATAAGGGAACATGAGGGAAGG + Intronic
1004901834 6:20201512-20201534 AGAAAATGGAATATAAGGAAAGG - Intronic
1005834978 6:29702222-29702244 ATGAAATGGATCATAAGAGAAGG - Intergenic
1008365400 6:50673204-50673226 AGGAAATGGAGCAGAAGGGATGG + Intergenic
1011025478 6:82864529-82864551 AGATAATGAATCTTAAAGAAGGG + Intergenic
1013355386 6:109341666-109341688 AGAGAATTCAGCATAAGGGAAGG + Intergenic
1015315784 6:131814595-131814617 AGATAATGGATCATAAGGGAAGG - Intronic
1015582438 6:134740649-134740671 AAGTAATGGATAATAAGAGATGG + Intergenic
1015819972 6:137250284-137250306 AAAAAATGGAACATAAGTGAGGG - Intergenic
1016196061 6:141342080-141342102 AATTAATGGATCATATGGTAAGG + Intergenic
1016460770 6:144278522-144278544 AAATAATGGTTGATAAGGCAGGG + Intergenic
1016475237 6:144420007-144420029 AGATAAGGAATCACGAGGGAAGG + Intronic
1016641813 6:146358405-146358427 AGGAAATGGAGCATAGGGGAGGG + Intronic
1016691000 6:146937584-146937606 AGATAAAGAATGATAAGGAAGGG - Intergenic
1021005323 7:15387883-15387905 AGAGAATGTGTCATTAGGGAGGG - Intronic
1021338759 7:19437209-19437231 ATATAAGGCATTATAAGGGATGG - Intergenic
1027458264 7:78420950-78420972 AGGTAACGGATCAAAAGGTAAGG + Intronic
1027937287 7:84624373-84624395 AGATAAAGGATTTTAGGGGACGG - Intergenic
1029027483 7:97432551-97432573 AGAAAATGGATTCTAAGGAATGG - Intergenic
1030213709 7:107021719-107021741 AGAGAATGGATCATAAGAACGGG + Intergenic
1030398710 7:109020777-109020799 AGATAATGCAGACTAAGGGAGGG - Intergenic
1030689051 7:112514138-112514160 AGATAAAGGAGTATAATGGAGGG + Intergenic
1032912550 7:136450025-136450047 AGATTATAGATCATAAAAGAGGG - Intergenic
1032936915 7:136743706-136743728 AGATAAAAGATCATGAGGAAGGG + Intergenic
1032991548 7:137400057-137400079 AGATATGGGATCATCAGTGAAGG + Intronic
1033413424 7:141141037-141141059 AGATACTGCATCCTAAAGGAGGG - Intronic
1041606546 8:59788455-59788477 AGATAATGGGACTTCAGGGAGGG - Intergenic
1043026639 8:75078873-75078895 GGATAATGCATCCTAAGAGAGGG + Intergenic
1046718320 8:117591313-117591335 AGATAGAGGATCATATGAGATGG + Intergenic
1048062628 8:130936279-130936301 AGATGATGGATCAAGGGGGAAGG - Intronic
1050466286 9:5927678-5927700 AGAAAATGTTTCATAAAGGAGGG - Intronic
1050845315 9:10209439-10209461 TGATAATGGGCCATTAGGGAAGG + Intronic
1058420381 9:104827768-104827790 AGATAACAGAGCATGAGGGAGGG + Intronic
1058814086 9:108667912-108667934 AGAAAATGGAACATTTGGGAGGG + Intergenic
1061291577 9:129653465-129653487 AGATCAGGGACCATAAGGGAGGG - Intergenic
1062589683 9:137267939-137267961 AGAGAATGGAGCAAAGGGGAGGG + Intronic
1203626660 Un_KI270750v1:32091-32113 AGATAAAGGAGCAAAAGAGATGG - Intergenic
1185539888 X:894755-894777 ATAGGATGGATCAGAAGGGATGG + Intergenic
1185738386 X:2510961-2510983 AGATAATAGATAAAATGGGATGG + Intergenic
1186856964 X:13635977-13635999 AGACAATGGATCATGTGTGATGG - Intergenic
1187174977 X:16888156-16888178 AGATAATGAAGCTTAAGGAAAGG - Intergenic
1188288565 X:28360421-28360443 AGAAAATGGATCATAACAGCAGG - Intergenic
1188596021 X:31901060-31901082 AGTAAATGGTTCATAAAGGAAGG - Intronic
1188629190 X:32330244-32330266 AGCAACTGGATCATAAAGGAGGG + Intronic
1188927185 X:36058727-36058749 AGAAAATGGTACAAAAGGGAAGG - Intronic
1190245380 X:48687327-48687349 AGATGATGGATGAGAAGGGCTGG + Intronic
1191122312 X:56919377-56919399 ATATGAAGGATCATAAGTGAAGG - Intergenic
1191132433 X:57029266-57029288 AAATTATGTTTCATAAGGGAAGG - Intergenic
1195804400 X:108747335-108747357 CTATATTGGATCATCAGGGAAGG + Intergenic
1197162078 X:123335211-123335233 AGATAATGTATCTTAAGGCCAGG + Intronic
1199191074 X:144971981-144972003 CGATACTGGATAGTAAGGGAAGG + Intergenic
1199241980 X:145557423-145557445 AGTGATTGGATCATAAGGGTGGG + Intergenic
1200857686 Y:7957226-7957248 AGATAATGCATAAGTAGGGATGG + Intergenic
1201622242 Y:15972945-15972967 TAATAGTGGATCATAAGTGATGG + Intergenic
1202057330 Y:20848577-20848599 AGAGACTGTATCATAAGGAATGG - Intergenic