ID: 1015315785

View in Genome Browser
Species Human (GRCh38)
Location 6:131814599-131814621
Sequence GTTAAGATAATGGATCATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015315785_1015315789 -7 Left 1015315785 6:131814599-131814621 CCCTTATGATCCATTATCTTAAC 0: 1
1: 0
2: 0
3: 17
4: 186
Right 1015315789 6:131814615-131814637 TCTTAACTCTAGAATATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015315785 Original CRISPR GTTAAGATAATGGATCATAA GGG (reversed) Intronic
903092290 1:20932038-20932060 GCTAAGATAATTGATGATAGTGG - Intronic
906683767 1:47749340-47749362 CCTAAGATAATGGATATTAATGG + Intergenic
908617553 1:65939162-65939184 GAGAAGAGAATGGATCTTAATGG - Intronic
909154833 1:72060773-72060795 GTTTACAGAATGGAACATAATGG - Intronic
909884931 1:80929474-80929496 TTTCAGATAATTGAACATAATGG - Intergenic
910566043 1:88643876-88643898 CTTAAGATTCTGGAGCATAAAGG - Intergenic
911934961 1:103959039-103959061 GTAAAATTAAAGGATCATAATGG - Intergenic
912191231 1:107343311-107343333 GTTAATATAGTAGATCATCATGG - Intronic
912281485 1:108319584-108319606 GCTAAGAGAATAGATCTTAAAGG - Intergenic
916011307 1:160708451-160708473 GTTAGGATAGTGGATCATTGTGG + Intronic
916778761 1:167999534-167999556 GCTAAGATAATTGATCAAAGTGG - Intronic
917049436 1:170902826-170902848 GTAAAGATAATATAACATAAAGG - Intergenic
917850116 1:179055188-179055210 GTTAAGATAATGGAAAACAGAGG - Intronic
917964599 1:180170349-180170371 GTTAAGGTAATGGATCCTCATGG + Intronic
918262749 1:182810609-182810631 GTAAAGATAAAGAATCATTAGGG - Intronic
920887708 1:209947866-209947888 ATTAGGATAATGGATGATGAAGG - Intronic
921099272 1:211914306-211914328 GTTTAGAGCATGGATCCTAATGG - Intergenic
922106991 1:222521079-222521101 GTTAAGTTACTGGATCACAGTGG - Intergenic
1063327533 10:5119769-5119791 CTTCAGATAATGGATAACAAGGG + Intronic
1063750427 10:8938893-8938915 GGTAAGATAAAGGAATATAAAGG + Intergenic
1066018494 10:31272379-31272401 ATCATGATAATTGATCATAATGG - Intergenic
1066985878 10:42466061-42466083 GTCAGGATAAGGGATCAAAAGGG + Intergenic
1068709386 10:60116903-60116925 GTTACGATGATGTACCATAATGG - Intronic
1071963404 10:90829106-90829128 GTTAATATAATGTATCACATTGG - Intronic
1072564632 10:96607327-96607349 GATAAGAAAATGGAGCAGAAAGG - Intronic
1073941286 10:108701319-108701341 GTGATGATAATGGGTAATAAAGG + Intergenic
1074791894 10:116897576-116897598 GCTGGGATAATGGATCATCAAGG - Intronic
1076128039 10:127991797-127991819 ATAAAGATTATGGATCAGAAAGG - Intronic
1078128352 11:8591401-8591423 GTAAAAGCAATGGATCATAAAGG + Intronic
1078804383 11:14682605-14682627 GTTAATATGATGGATTATATTGG + Intronic
1079491031 11:20989469-20989491 GATAAGGTAATGGAACAGAAAGG - Intronic
1079908395 11:26278355-26278377 ATTAGGATAATGGATCAGACAGG + Intergenic
1082267683 11:50137319-50137341 GGTAATATAATTTATCATAAAGG - Intergenic
1085990957 11:81843747-81843769 CTTAACATAATGGGCCATAATGG - Intergenic
1086575415 11:88334485-88334507 TTTAAGATAATGAATCATTTAGG + Intronic
1087504840 11:99006426-99006448 GTTAAGAGAATATAACATAATGG - Intergenic
1088518531 11:110667118-110667140 GCTAAGATAATTGATGAAAATGG + Intronic
1092726887 12:11495773-11495795 GATAAGAAAATGCATCATAAAGG - Intronic
1093002516 12:14013646-14013668 GCTAAGATAATGAATGAAAATGG - Intergenic
1095892176 12:47245126-47245148 GTAAAGCTAATGGAAGATAAAGG - Intergenic
1096375037 12:51102036-51102058 TATAAGAAAATGGATGATAAAGG + Intronic
1097317376 12:58186447-58186469 TTAAAGTTAATGGATCTTAAAGG - Intergenic
1098910811 12:76206584-76206606 GTTAACTTAGTGGACCATAAAGG - Intergenic
1099277435 12:80595046-80595068 GCAAAGATTCTGGATCATAAAGG - Intronic
1100921985 12:99498583-99498605 GTTAAAATTAAGGATAATAAGGG - Intronic
1101803813 12:108046056-108046078 CTTAATATTATGTATCATAAAGG + Intergenic
1106716977 13:32400699-32400721 GTCAACATACTGCATCATAAGGG + Intergenic
1107474813 13:40725539-40725561 GTTAAAATATTTTATCATAATGG + Intergenic
1108920346 13:55665330-55665352 GTTAAGATTATGGGTAATAGAGG + Intergenic
1109735469 13:66478850-66478872 GCTAAGATAATTGATGACAATGG + Intronic
1110152736 13:72274571-72274593 GATAAGACTATGGATCATGAAGG + Intergenic
1110350951 13:74506703-74506725 GTTAAGATTATGAGTGATAAAGG + Intergenic
1111555782 13:89879837-89879859 TTTAAGAGAATGGAATATAAGGG - Intergenic
1111946083 13:94667446-94667468 GTTAAGTCAATGGAACATACAGG + Intergenic
1113074660 13:106455564-106455586 GTTGAGAAAATGGAGCACAAAGG - Intergenic
1114825532 14:26073598-26073620 GTCAGGATAATGGATTTTAAAGG - Intergenic
1114980055 14:28151876-28151898 GTAAAGATAACTGATCAAAACGG - Intergenic
1115038590 14:28891654-28891676 GGTAAGATAATGTATGAAAAGGG - Intergenic
1117226018 14:53659775-53659797 GGTAAGATCATGAATGATAAGGG - Intergenic
1120012314 14:79430523-79430545 GAGAAGCTAATGAATCATAAAGG + Intronic
1123628263 15:22242636-22242658 GTTTAGATCATAGATCCTAATGG + Intergenic
1123963456 15:25431963-25431985 ATAAAGCTAATGGGTCATAAGGG - Intronic
1124152826 15:27197353-27197375 GCTCACATAATGGATCAAAAAGG - Intronic
1124598034 15:31107360-31107382 ATTAATACAAAGGATCATAAGGG - Intronic
1125445239 15:39747132-39747154 GTTAGGATTATGGTTTATAAAGG - Intronic
1125451120 15:39808549-39808571 GATATGATAATGGAGCATAATGG - Intronic
1125639461 15:41217956-41217978 GTCAAGATGAAGGATAATAATGG - Intronic
1126645960 15:50875028-50875050 GTTAAGAAAAAGGATCATAGAGG + Intergenic
1129057118 15:72828178-72828200 CATAAGATAAGGTATCATAAGGG + Intergenic
1131748097 15:95471835-95471857 TTTAAGATAATGGATTCTAACGG + Intergenic
1132015802 15:98315382-98315404 TTTATGATAATGGTTCATACAGG - Intergenic
1135061932 16:19278492-19278514 TTTACCATAATGGATCACAAAGG - Intergenic
1135460896 16:22641919-22641941 GCAAAGATACTGGATCATATTGG - Intergenic
1137869849 16:51939588-51939610 TGCAAGATAATGGATCATTACGG + Intergenic
1138094534 16:54201642-54201664 GCTGAGACAGTGGATCATAATGG - Intergenic
1140305695 16:73800626-73800648 GTTAAAATAATGAAACATCAGGG + Intergenic
1141933644 16:87221824-87221846 GTGATGATAATGGATGATGATGG - Intronic
1141933776 16:87222485-87222507 GTGATGATAATGGATCACGATGG - Intronic
1141975682 16:87514688-87514710 GTTTAGATCATAGATCCTAATGG - Intergenic
1143929805 17:10410446-10410468 GTGGACATCATGGATCATAATGG + Intronic
1144117167 17:12108063-12108085 GTTAACACAATAGGTCATAATGG + Intronic
1144393213 17:14815411-14815433 GTTAAGTGAATAGATCAAAATGG + Intergenic
1147851868 17:43449947-43449969 GTTAATAAAATGGATCCAAAGGG - Intergenic
1150164742 17:62931072-62931094 GGTAAGATGATGGAACATTAGGG - Intergenic
1150792095 17:68206791-68206813 GTTAAGGAAATGGATCATTTGGG + Intergenic
1158806564 18:60980526-60980548 GTTCAGATGATGGAGCCTAATGG - Intergenic
1159198896 18:65157367-65157389 GTTAAGATAATTGATGAAGATGG + Intergenic
1162839706 19:13347328-13347350 GTTAGAATTATAGATCATAATGG + Intronic
1166495634 19:43301286-43301308 CTGAAGACAATGGCTCATAATGG + Intergenic
925578741 2:5387652-5387674 CTTAAGATAATGCATCATCGTGG + Intergenic
925708796 2:6717057-6717079 GCTAAGATAATGGATGGTAAAGG + Intergenic
927069408 2:19510900-19510922 CTCAGGATAATGGATAATAATGG + Intergenic
928926549 2:36585676-36585698 GTAAACATAATATATCATAATGG + Intronic
935893177 2:107702973-107702995 GGTAAGAAAATAAATCATAATGG + Intergenic
936971083 2:118176976-118176998 GATAAGATAATGGCTCATCTTGG - Intergenic
938763715 2:134446632-134446654 GTTAAGGTCATGAATCATGAAGG - Intronic
939704141 2:145431123-145431145 ATTAAGACCATGGATCAAAATGG - Intergenic
940299777 2:152164778-152164800 GTTGAGAGAATTGAGCATAAGGG + Intronic
942184645 2:173413468-173413490 TTTAAAAGAATTGATCATAAAGG - Intergenic
942437150 2:175991655-175991677 GTTTAGACATTGGATTATAATGG - Intronic
942627503 2:177917491-177917513 GTTAAGACAATGGAGCACATTGG - Intronic
943070329 2:183134024-183134046 GTTAAGACACTGAATAATAAAGG + Intronic
943173047 2:184429581-184429603 TTAAAGATGATGGAGCATAAAGG + Intergenic
943544316 2:189255837-189255859 ATTAAGATAATGTTTCATAAAGG + Intergenic
943785370 2:191872101-191872123 GGTAAGATAATTGAGAATAAAGG + Intergenic
943901163 2:193438851-193438873 GTGAAGAAAATGGATTATAAGGG + Intergenic
944563593 2:200965172-200965194 GTTAAGAAAATGGAAGAGAAAGG + Intergenic
947947842 2:234121675-234121697 GTTAAAATAATGAAAAATAATGG - Intergenic
1169167885 20:3440427-3440449 GTCCACATGATGGATCATAATGG + Intergenic
1170868108 20:20178284-20178306 ATGAAGAAAATGTATCATAAAGG - Intronic
1172990915 20:39036060-39036082 GTCAAGAGAAGGGATCAGAAAGG + Intronic
1173717399 20:45220989-45221011 TTTAAGTTATTGGATCAGAAAGG + Intergenic
1174677108 20:52369142-52369164 GTTAAAATAAATGAACATAAAGG + Intergenic
1184945440 22:47800104-47800126 ATTAATATAATCAATCATAATGG + Intergenic
949975055 3:9449069-9449091 GTGATGATAGTGGATAATAACGG - Intronic
950280796 3:11706253-11706275 GATAAGATAATGGGTATTAAAGG + Intronic
951305047 3:21049614-21049636 GTTAATAAAATGTAACATAATGG - Intergenic
955605860 3:60702330-60702352 GTTAATATAATTTATCAGAATGG - Intronic
956561006 3:70574614-70574636 GATAAGATAATTGAAAATAAAGG - Intergenic
957271929 3:78041478-78041500 AGTAGGATCATGGATCATAAAGG - Intergenic
959223780 3:103555589-103555611 GCTAAGATAATAGATCTTAAGGG - Intergenic
959455202 3:106551228-106551250 AATAAGATTATGGATTATAATGG - Intergenic
959626069 3:108453087-108453109 TTAGAGAGAATGGATCATAAAGG + Intronic
960494540 3:118359259-118359281 GTTTTGCTAATGGATCATTAGGG + Intergenic
962903870 3:139784320-139784342 GTTAAGCTATTGGATGATGAAGG - Intergenic
964543432 3:157804948-157804970 ATTAAGATAATGGATTTTAAAGG + Intergenic
965236681 3:166133956-166133978 GTTAAAATAATGGGTTACAAGGG - Intergenic
966642564 3:182206823-182206845 GTTACGAAAATGGATAATTAAGG - Intergenic
967029112 3:185589093-185589115 GTGAATATAATTGATCATAAGGG + Intronic
967886970 3:194340072-194340094 GTTAAGATAAAGGATCGTGGAGG + Exonic
970637959 4:18030620-18030642 GGTAAGAGATTGGATCATGAGGG - Intergenic
971003445 4:22348424-22348446 GTTAAGATAAATAATCAAAATGG + Intronic
972837386 4:42889579-42889601 GTTAAGATAATTGATGAAAATGG + Intergenic
973290633 4:48466859-48466881 ATTAAGATAATGCATCTAAAGGG - Intergenic
974714018 4:65642453-65642475 TTTAAGATAATAGAACATAAAGG - Intronic
975591683 4:76006830-76006852 ATTAAGATAATGTATTTTAAGGG - Intronic
976565183 4:86545061-86545083 ATTAAGATATTGGATAATAAAGG + Intronic
979091740 4:116492181-116492203 AGTAACATAATGGAACATAATGG - Intergenic
981192168 4:141876972-141876994 ATTATGATATTGTATCATAAAGG + Intergenic
982460585 4:155665067-155665089 GTAATGAAAATGGTTCATAACGG - Intergenic
984398276 4:179228119-179228141 GTTATGATCATGGATAATGATGG - Intergenic
986367974 5:7054268-7054290 GTTAAAATACTGGATTAAAATGG - Intergenic
986410839 5:7477144-7477166 CTAATGATAATGGATTATAAAGG + Intronic
986544146 5:8876949-8876971 CTTAAGATCATTGATCATCAAGG - Intergenic
987584376 5:19835582-19835604 GTTAAAATAATGGCACAGAAGGG + Intronic
988674000 5:33412485-33412507 GTGGAGATAATTGATCATAAGGG + Intergenic
989077059 5:37574951-37574973 GTCCACATGATGGATCATAATGG - Intronic
989430408 5:41348256-41348278 TTTAAGATAATGGTACATTAGGG - Intronic
990002990 5:50916663-50916685 GCTAAGATAATTGATGAAAATGG - Intergenic
991191768 5:63882713-63882735 GTTAAGATGATGGATAAGGATGG - Intergenic
991326087 5:65434856-65434878 GTAGAGCTAATGGGTCATAAGGG - Intronic
991513433 5:67406519-67406541 GTTAAAATAATGTATCTTGATGG + Intergenic
991939719 5:71838812-71838834 GTTAGGAGAATGTAGCATAAGGG - Intergenic
992947026 5:81821201-81821223 GTTAAGATCTGAGATCATAAAGG - Intergenic
994820446 5:104644074-104644096 GTTAAAATAATGTAACATATTGG + Intergenic
995602601 5:113814559-113814581 GTTAAGACAGTGGTTCATCATGG + Intergenic
996302059 5:121999312-121999334 TTTATGTTCATGGATCATAAAGG - Intronic
996875877 5:128239967-128239989 TTTAAAATAAAGGATCATCAGGG + Intergenic
1000139579 5:158388969-158388991 ATGAAGATAATGGATCTGAACGG - Intergenic
1000894929 5:166844130-166844152 GTGAAGATGATGGATAATTAAGG + Intergenic
1001369553 5:171184594-171184616 GCTAAGAGAATGGATGTTAAGGG + Intronic
1010339767 6:74735194-74735216 GTTAAAATTTTGGATGATAATGG + Intergenic
1011502274 6:88004163-88004185 GATATGTTAATGGATCCTAATGG + Intergenic
1012092286 6:94914406-94914428 AATGAGATACTGGATCATAAAGG - Intergenic
1012108063 6:95191071-95191093 GTTAAGAAAAGCAATCATAATGG - Intergenic
1013734026 6:113204963-113204985 ATTAAGACAATGGTTGATAAAGG + Intergenic
1013817700 6:114118511-114118533 GTCAAGATAATGGTAAATAATGG - Intronic
1014337615 6:120157069-120157091 GTTAAGATAATTGATGAAACTGG - Intergenic
1014615712 6:123596439-123596461 GCTAAGATGATGGATGAAAATGG + Intronic
1015315785 6:131814599-131814621 GTTAAGATAATGGATCATAAGGG - Intronic
1016463238 6:144300673-144300695 TTTAAGATTAAGGATCAAAAAGG + Intronic
1017476297 6:154797348-154797370 ATTAAAATGATGGATCAAAAAGG - Intronic
1018594782 6:165467275-165467297 GCTAAGATAATGGATGAAAGTGG + Intronic
1018699643 6:166416337-166416359 GTGAAGATAATGGAAGGTAATGG - Intronic
1020806018 7:12791290-12791312 GTTAAGAAAATTGATTAAAAAGG + Intergenic
1022842471 7:34177884-34177906 GTTAAGTGAATGGAACCTAAAGG + Intergenic
1027938047 7:84634105-84634127 GGTAAGATAATCTATCATAGTGG + Intergenic
1028900550 7:96095266-96095288 GTAAAGATTATGGAACATTAAGG - Intronic
1030565307 7:111146718-111146740 ATTAAGTTAATGGATGAAAAAGG + Intronic
1032513748 7:132492105-132492127 ACTCAGAAAATGGATCATAATGG - Intronic
1034060779 7:148086189-148086211 GTTATGATAATTGATGACAAAGG + Intronic
1036115453 8:5955374-5955396 GTTAAGATAATTGATGAAAGTGG + Intergenic
1041682913 8:60611198-60611220 GTTTAGAGAATGAATCACAAGGG - Intronic
1042905316 8:73766427-73766449 GCTAAGAAAGTGGATAATAAAGG + Intronic
1043099278 8:76019634-76019656 GTTAAGAAAATTGATAATACTGG + Intergenic
1043160318 8:76838753-76838775 GTTAAGACAATGGGAAATAAGGG + Intronic
1043730025 8:83665723-83665745 TTTAAGATAATGGTTATTAATGG + Intergenic
1044143483 8:88684173-88684195 GTTAAGATCATATATCATTATGG + Intergenic
1044504065 8:92996530-92996552 GTTAAGAAAATGGCTAATAAAGG + Intronic
1045424409 8:102049769-102049791 GTTAACATAATCTATCATTAGGG - Intronic
1045694271 8:104790233-104790255 GTTTACATAATTAATCATAAGGG + Intronic
1047160044 8:122367992-122368014 GTTAAGACAATGCATCTTATGGG + Intergenic
1047783531 8:128131356-128131378 ATTAAGACATTGGATCAAAAGGG - Intergenic
1048920080 8:139220520-139220542 GTTAATATGATGAATTATAATGG - Intergenic
1050466288 9:5927682-5927704 GTAAAGAAAATGTTTCATAAAGG - Intronic
1051309634 9:15756663-15756685 CTTAGGATAATGGCTAATAATGG + Intronic
1052075256 9:24133759-24133781 GTGAAGATAATGGGACATTAAGG - Intergenic
1052505639 9:29350373-29350395 TTTAAGACAATGGAACAAAAGGG + Intergenic
1186101029 X:6156950-6156972 GTAAAGATAATGGTTCAAAATGG - Intronic
1188462540 X:30445358-30445380 ATTAAGATAATTAATAATAATGG + Intergenic
1192533491 X:71909725-71909747 GTTTTGCTAATGGATTATAAAGG + Intergenic
1200410164 Y:2852956-2852978 TATGAGATAATGGAACATAAAGG - Intronic
1201468179 Y:14308162-14308184 GTTAAGAAAATGGTTTTTAAAGG + Intergenic
1201903228 Y:19064388-19064410 ATAAATATAATGGATCAGAAGGG - Intergenic