ID: 1015315789

View in Genome Browser
Species Human (GRCh38)
Location 6:131814615-131814637
Sequence TCTTAACTCTAGAATATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015315786_1015315789 -8 Left 1015315786 6:131814600-131814622 CCTTATGATCCATTATCTTAACT 0: 1
1: 0
2: 1
3: 17
4: 278
Right 1015315789 6:131814615-131814637 TCTTAACTCTAGAATATGGAAGG No data
1015315783_1015315789 3 Left 1015315783 6:131814589-131814611 CCTTTTCCTTCCCTTATGATCCA 0: 1
1: 0
2: 3
3: 61
4: 1142
Right 1015315789 6:131814615-131814637 TCTTAACTCTAGAATATGGAAGG No data
1015315784_1015315789 -3 Left 1015315784 6:131814595-131814617 CCTTCCCTTATGATCCATTATCT 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1015315789 6:131814615-131814637 TCTTAACTCTAGAATATGGAAGG No data
1015315785_1015315789 -7 Left 1015315785 6:131814599-131814621 CCCTTATGATCCATTATCTTAAC 0: 1
1: 0
2: 0
3: 17
4: 186
Right 1015315789 6:131814615-131814637 TCTTAACTCTAGAATATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015315789 Original CRISPR TCTTAACTCTAGAATATGGA AGG Intronic
No off target data available for this crispr