ID: 1015319245

View in Genome Browser
Species Human (GRCh38)
Location 6:131853668-131853690
Sequence GTGTGTGAGGGTAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5497
Summary {0: 1, 1: 0, 2: 14, 3: 219, 4: 5263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015319239_1015319245 1 Left 1015319239 6:131853644-131853666 CCTTGTGGGGTTGCTTTTGTGTT 0: 1
1: 0
2: 2
3: 24
4: 291
Right 1015319245 6:131853668-131853690 GTGTGTGAGGGTAAGGTGGGAGG 0: 1
1: 0
2: 14
3: 219
4: 5263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015319245 Original CRISPR GTGTGTGAGGGTAAGGTGGG AGG Intronic
Too many off-targets to display for this crispr