ID: 1015321270

View in Genome Browser
Species Human (GRCh38)
Location 6:131878080-131878102
Sequence TTTTTGATGAAAAGGACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 433}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015321270_1015321277 30 Left 1015321270 6:131878080-131878102 CCTTCTGTCCTTTTCATCAAAAA 0: 1
1: 0
2: 2
3: 43
4: 433
Right 1015321277 6:131878133-131878155 ACCTGTAATCCCAGTACTTTGGG 0: 2350
1: 84226
2: 315899
3: 244687
4: 145410
1015321270_1015321272 -6 Left 1015321270 6:131878080-131878102 CCTTCTGTCCTTTTCATCAAAAA 0: 1
1: 0
2: 2
3: 43
4: 433
Right 1015321272 6:131878097-131878119 CAAAAATGTAACTTCTGTCCAGG 0: 1
1: 0
2: 2
3: 34
4: 356
1015321270_1015321276 29 Left 1015321270 6:131878080-131878102 CCTTCTGTCCTTTTCATCAAAAA 0: 1
1: 0
2: 2
3: 43
4: 433
Right 1015321276 6:131878132-131878154 CACCTGTAATCCCAGTACTTTGG 0: 2228
1: 77841
2: 214563
3: 255990
4: 203013
1015321270_1015321273 -1 Left 1015321270 6:131878080-131878102 CCTTCTGTCCTTTTCATCAAAAA 0: 1
1: 0
2: 2
3: 43
4: 433
Right 1015321273 6:131878102-131878124 ATGTAACTTCTGTCCAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015321270 Original CRISPR TTTTTGATGAAAAGGACAGA AGG (reversed) Intronic
905455651 1:38086172-38086194 GTTATGATGAAAATGACAGGCGG - Intergenic
906265089 1:44422601-44422623 TTTCTCATGAAGAGGACAGTGGG - Intronic
907023151 1:51087974-51087996 ATTTTGATGAAAATAACTGAAGG - Intergenic
907790366 1:57657961-57657983 TTGTTGAAGAAAAGGAAGGATGG - Intronic
908335589 1:63119768-63119790 TTTTTAATGAAAAGCAGAGATGG - Intergenic
908566193 1:65358690-65358712 ATTTTGCAGAAAAGTACAGAAGG - Intronic
909108171 1:71439331-71439353 TTATTGAAGGAAAGGACATACGG - Intronic
909458104 1:75873270-75873292 TTTTTGATGAAAATTGCAGCTGG - Intronic
909671397 1:78192853-78192875 TTATTGAGGAAAATGACAAATGG - Intergenic
910267658 1:85356338-85356360 TTTATCAGGAAATGGACAGAAGG - Intronic
910560501 1:88584848-88584870 TTATTGATAAGAAGGAAAGAAGG - Intergenic
911053874 1:93694738-93694760 TGTTTGATCATAAGGACACATGG - Intronic
911266235 1:95747260-95747282 ATTTTAATGAAAAGCACAGCAGG - Intergenic
911583009 1:99657100-99657122 TTTTTTATGAAAAGAAAAGGAGG - Intronic
911746032 1:101442689-101442711 TTTTTGATGTAAAGGATCCATGG - Intergenic
913488338 1:119354814-119354836 ATTTTGGTGAAAATGACAAAAGG - Intergenic
914954861 1:152152752-152152774 TTTTTGAATAAGTGGACAGATGG - Intergenic
915789660 1:158654579-158654601 TTTTTGATGGAAAGATTAGAAGG + Intronic
916715764 1:167445530-167445552 TTTTTAATGAAGATGACAAAAGG - Intronic
917549593 1:176010664-176010686 TTTATACTGAAAAGGCCAGAAGG - Intronic
921650140 1:217668248-217668270 TTTTTAATTAAAAGAGCAGATGG + Intronic
922280863 1:224122651-224122673 TTTTTGAAGACTAGGCCAGATGG + Intronic
923367254 1:233274845-233274867 TTCATGATGAAGAGCACAGAAGG + Intronic
923914402 1:238485926-238485948 TTTTGGGTGAAAAGGAAAAATGG + Intergenic
924424221 1:243935855-243935877 TTTTCTATCAAAAAGACAGAGGG - Intergenic
1062863833 10:832444-832466 TTTCTGAAGAAAAGGACAAAAGG + Intronic
1062913929 10:1233144-1233166 TTGCTGATGGAGAGGACAGAGGG + Intronic
1063502425 10:6567277-6567299 TGTTTCATGAACAGGACATAGGG + Intronic
1063592229 10:7406546-7406568 TTTATGATGAAAACGAAACAGGG + Intronic
1064010144 10:11729162-11729184 TTTTTTATGTTAAGGGCAGAGGG - Intergenic
1064822426 10:19352763-19352785 TTTTAGGTTAAAAGGACATATGG - Intronic
1067771919 10:49132472-49132494 TTTTTCAGGAAATGGGCAGAGGG - Intronic
1067924703 10:50496522-50496544 TTGTTGAGGAACAGGACAAATGG - Intronic
1068219358 10:54024833-54024855 TTTTTGGTGAAAAAGGGAGAAGG - Intronic
1068717445 10:60204019-60204041 TTTTTTAAAAAAGGGACAGAAGG + Intronic
1070251884 10:74780244-74780266 TGTATGATCAAAGGGACAGATGG + Intergenic
1071200220 10:83213645-83213667 TTTTTGTTGTAAATGAAAGAGGG + Intergenic
1071735436 10:88293775-88293797 TTTTCCATGAAAGGGAGAGATGG + Intronic
1071980104 10:90996848-90996870 TTTTTAAAAAAAAGAACAGATGG + Intergenic
1072333939 10:94380647-94380669 ATTTTGATGAATAGGAGAAAAGG + Intergenic
1073378535 10:103058732-103058754 TGTTTGATGAACAGGACTTACGG + Intronic
1073659386 10:105457323-105457345 TTGTTGAAGAAAAACACAGATGG - Intergenic
1073927456 10:108533450-108533472 TTTTTGATGATGGTGACAGATGG - Intergenic
1074016948 10:109544004-109544026 TTTTTAAAGACAAGGGCAGAAGG + Intergenic
1074482535 10:113838265-113838287 TTTGTGAGGACAAGGGCAGAAGG - Intronic
1074616861 10:115078367-115078389 TTTCTCATGAAAAAGAAAGAGGG - Intergenic
1075414370 10:122251235-122251257 CTTAGGATGAAAAAGACAGATGG + Intronic
1075780600 10:125014869-125014891 TTATTGCTGAAAAGGACAGAAGG - Intronic
1076248257 10:128964340-128964362 TTCTTGAGGACAAGTACAGAGGG + Intergenic
1077814408 11:5671620-5671642 TTTCTGATTTAAAGAACAGAGGG + Intronic
1077990130 11:7400001-7400023 TTTTTGATGAAAATTTCAGCTGG - Intronic
1078387754 11:10907998-10908020 TTTTTGAAGGACAGGGCAGATGG + Intergenic
1078457574 11:11487069-11487091 TTATGGATGCAAAGGAAAGAAGG - Intronic
1079375641 11:19889272-19889294 ATTTTGCTGAAAATGTCAGACGG + Intronic
1082651139 11:55795452-55795474 TCTTTGATTAAAAGGAAAAAAGG - Intergenic
1083332412 11:61905053-61905075 TCTTTGGTGCAAAGGGCAGAAGG - Intronic
1084621331 11:70271742-70271764 TTTTTCAGGAAAAGCACAGAAGG - Intronic
1084988983 11:72905249-72905271 TTTTTGAAAAAAAGGAGAGCGGG - Intronic
1085058071 11:73419577-73419599 TTTTAGGGGGAAAGGACAGAGGG - Intronic
1085148789 11:74230550-74230572 TTTTTGATGACATGGAAAAATGG - Intronic
1086356138 11:86001792-86001814 TTTTTGATAAAAGGGAAAGGAGG - Intronic
1086517675 11:87631801-87631823 TTTTTAATGAAAAAGACAGAAGG + Intergenic
1086722304 11:90135462-90135484 TTTTTGGGGGGAAGGACAGAGGG + Intronic
1086775311 11:90823856-90823878 TTTTAGCTGAAATGGACAGGAGG - Intergenic
1086775694 11:90830129-90830151 TTTTTTAAGAAAAAGGCAGAGGG + Intergenic
1089759478 11:120712474-120712496 ATTTAGAAGAAAAGCACAGAAGG - Intronic
1089896648 11:121936758-121936780 TCATAGATGAGAAGGACAGAGGG + Intergenic
1090243212 11:125198318-125198340 TTTTGGATAGAAAGGCCAGAAGG + Intronic
1090580094 11:128150004-128150026 TGTTTTATAAAAAGGACAAATGG + Intergenic
1090818811 11:130322049-130322071 TTTTTGGGGCAAAGGACAAATGG + Intergenic
1090920193 11:131200114-131200136 TTTTTGAAAAAAAGGAAAGAAGG + Intergenic
1091529766 12:1342793-1342815 ATTTTGAGGAAAAGGCTAGAAGG + Intronic
1092735088 12:11574570-11574592 ATTTTGATTAAAATAACAGATGG - Intergenic
1093390235 12:18609949-18609971 TTTTTGAGGAGAAGGAAATATGG - Intronic
1094428781 12:30343527-30343549 TATTTGATGAAAATCTCAGACGG - Intergenic
1094439151 12:30455820-30455842 TTTATGAAGAAAAGGCCAGTGGG + Intergenic
1095109133 12:38271946-38271968 TTTTTGATGAAAAGTTCAGTAGG - Intergenic
1095383892 12:41627815-41627837 CTTTTGAAGAAAAGGAGAAAAGG + Intergenic
1096027142 12:48376431-48376453 TTTTAGCTGTAAAAGACAGATGG + Intergenic
1099015054 12:77334512-77334534 TTGTTGGGGAAAAGGATAGATGG + Intergenic
1099234264 12:80063867-80063889 TTTTGGATGAAGAGCACAGGTGG - Intergenic
1101005430 12:100396977-100396999 TTCCTGATGAAAGGGACAGATGG - Intronic
1101180156 12:102207643-102207665 TTTTTCATTAAGAGAACAGATGG + Intergenic
1101918559 12:108914857-108914879 TTTTTTAACAAAAGGAAAGAAGG - Intronic
1103860435 12:124008239-124008261 TTTTTAATGGAAAGAACTGAAGG - Intronic
1105565125 13:21538013-21538035 TTGTTGATGAGAAGGAGAGGTGG - Intronic
1106305925 13:28509461-28509483 TTCTAGATGAAAATGACAGATGG + Intergenic
1106314705 13:28583063-28583085 GTTTTGACGCAAGGGACAGAGGG + Intergenic
1106755852 13:32822021-32822043 TTTGTGCTGCAAAGGAAAGAAGG - Intergenic
1106975572 13:35208581-35208603 TTTTTAATTAAAAGAAGAGAGGG + Intronic
1107425109 13:40284647-40284669 CTTTGGATGAAAAGGAAACAGGG - Intergenic
1107884074 13:44859623-44859645 TTTTTTATCAGAAGGACAGTGGG + Intergenic
1108292066 13:48971921-48971943 TTGGTGATGAAGAGGAGAGATGG - Intergenic
1108782102 13:53848928-53848950 ATGTTGATGAAAAGGGAAGATGG + Intergenic
1109368301 13:61387585-61387607 TTTTTGATAAAAGGGAAAGAAGG + Intergenic
1109683359 13:65782867-65782889 TTTTAGATGAAAAAGCCTGATGG - Intergenic
1109706287 13:66096533-66096555 TTTGGACTGAAAAGGACAGAGGG + Intergenic
1110150756 13:72250380-72250402 TTGTTGAGGAAAAGGAGTGATGG + Intergenic
1110544568 13:76742058-76742080 TTTTTGATGAAAAGTTCAGGTGG - Intergenic
1110604717 13:77418702-77418724 TTTTTGCAGAGAAGAACAGATGG - Intergenic
1110624363 13:77635642-77635664 TTTTTAATTAATAGGATAGATGG + Intronic
1110733549 13:78908960-78908982 TCTTTGATGATAAGGAAAGGGGG - Intergenic
1110769996 13:79331303-79331325 TTTTATATCAAAAGGAAAGAGGG - Intronic
1110779197 13:79445130-79445152 TTTCTGAGAAAAAGGAAAGAAGG + Intergenic
1110865775 13:80394233-80394255 CTTTTACTGAAAGGGACAGAGGG + Intergenic
1111922426 13:94426554-94426576 TTTTAATTGAAAATGACAGATGG + Intergenic
1112194682 13:97213553-97213575 TTTCTGAAGAAAAGGACCCAGGG - Intergenic
1112308918 13:98300674-98300696 TTTTAGAAAAAAAGTACAGAGGG - Intronic
1112386885 13:98948052-98948074 TTTCTTTTCAAAAGGACAGATGG + Intronic
1112638442 13:101244302-101244324 TATATTATCAAAAGGACAGATGG + Intronic
1112736582 13:102427308-102427330 TTTTTGATGAGAAAAACAAATGG - Intergenic
1113334256 13:109363081-109363103 TATTTGAAGAAAAGGAAGGAGGG + Intergenic
1114924029 14:27370915-27370937 TTTTTAGTGAAAATGACAGTTGG + Intergenic
1115745142 14:36428953-36428975 ATTGTGATGGAAAAGACAGAAGG + Intergenic
1116904112 14:50388669-50388691 TTTTTGCTGAGGAGGGCAGAGGG - Intronic
1117420646 14:55541629-55541651 TTCCTAGTGAAAAGGACAGACGG + Intergenic
1117476240 14:56097923-56097945 TTTTTGATGAACAAGAAATATGG - Intergenic
1117969831 14:61240752-61240774 TTTTGGGTAAAAAGGACAAATGG - Intronic
1118002890 14:61540070-61540092 TTTTTGCTGGAAAAGATAGAAGG - Intronic
1118858715 14:69645055-69645077 TTTATGATGAAGAGGACAGGAGG + Intronic
1120125632 14:80739100-80739122 TATTTGGAGAAAAGGAGAGAAGG - Intronic
1120333657 14:83125876-83125898 ATTTTCAGGAAAAGGAGAGAAGG + Intergenic
1124178319 15:27448123-27448145 TTTTTTAAAAAAAGGACAAATGG + Intronic
1124682590 15:31747846-31747868 TTTTTGATGCAATGCACTGAGGG + Intronic
1126271602 15:46825986-46826008 GTTTTGATGCTAAGGAGAGATGG - Intergenic
1127331418 15:57943727-57943749 TTGATGCTGCAAAGGACAGAGGG + Intergenic
1127453397 15:59137568-59137590 TTTTTGATTTAAAGAACAAAGGG - Intronic
1127530746 15:59841186-59841208 TTTTTGGTGAAAGTGATAGATGG - Intergenic
1129463430 15:75711202-75711224 ATCTGGATGAAAAGTACAGAGGG - Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1129721457 15:77880200-77880222 ATCTGGATGAAAAGTACAGAGGG + Intergenic
1130937710 15:88484304-88484326 TTTTTGTAGAAAAGGAGAAAAGG + Intergenic
1131031862 15:89193124-89193146 TTTTTGAAGCAAAGGGAAGAGGG - Intronic
1131098110 15:89668726-89668748 TTATTGATGCAGGGGACAGAGGG + Intronic
1131171084 15:90178717-90178739 TATGTGAAGTAAAGGACAGAAGG + Intronic
1131278790 15:91004579-91004601 TTATTGAAAATAAGGACAGATGG + Intronic
1131327319 15:91460738-91460760 GTTTAGATGAAGGGGACAGAAGG + Intergenic
1131413618 15:92232339-92232361 GTTCTGTGGAAAAGGACAGAAGG + Intergenic
1132199995 15:99944749-99944771 TTTTTGATGAAAATAACTAAAGG - Intergenic
1132278995 15:100596199-100596221 GTTTTGAGGAAAAGGAAGGATGG - Intronic
1132887315 16:2188189-2188211 TTTTTTATAAAAAGTAGAGATGG + Intronic
1132912706 16:2323603-2323625 TTTTTCCTGAAAGAGACAGAAGG - Exonic
1133022588 16:2973419-2973441 TGTGTTCTGAAAAGGACAGAGGG - Exonic
1133274034 16:4625837-4625859 TTTGTGGTGGAAAGGAGAGAAGG + Intronic
1133639926 16:7706994-7707016 TTTTTGATAAGAAGGACTGAAGG + Intronic
1133714411 16:8433164-8433186 TTTTTGTTGAAAAGCAAAGTTGG - Intergenic
1133756183 16:8764295-8764317 TTTTTCTTTTAAAGGACAGAAGG + Intronic
1134265242 16:12686880-12686902 TTTTTTTTGAAAAGAACTGATGG + Intronic
1137372558 16:47921943-47921965 TCTTTCATGAAAAGGTCAGTGGG + Intergenic
1137853844 16:51773508-51773530 TTCTTTATCACAAGGACAGAGGG - Intergenic
1138068716 16:53969189-53969211 CTTTTAATATAAAGGACAGATGG - Intronic
1138319404 16:56099080-56099102 TTTTTAGTGAAAGGGACAAAGGG - Intergenic
1139045029 16:63047655-63047677 GTTTTGCTATAAAGGACAGAAGG + Intergenic
1139780108 16:69344285-69344307 CTTTTTATTAAAAGGCCAGATGG + Intronic
1140215948 16:73008752-73008774 TTTTTGATGAAATTTAGAGATGG + Intronic
1140321330 16:73954617-73954639 TATTTCCTTAAAAGGACAGAAGG + Intergenic
1140446104 16:75029442-75029464 TTTTTTAAGAAAAGGTCAGCCGG - Intronic
1140658133 16:77161257-77161279 TTTTTGATGGGAAGAAGAGAGGG + Intergenic
1140718695 16:77750746-77750768 TTTTTTATGAAAAAGATGGATGG + Intergenic
1140994649 16:80245993-80246015 TTTCTATTGAAAAGTACAGAAGG - Intergenic
1141600460 16:85123058-85123080 TTTTTTAATAAAAGGACAAAAGG + Intergenic
1141705996 16:85664949-85664971 TTTTTGGAGAGAAGGACAGCGGG - Intronic
1142340007 16:89515561-89515583 TTTTTTATAAAAAGGTCAGCCGG - Intronic
1145185934 17:20794228-20794250 TTCTTGATAAAAAGAAAAGAAGG - Intergenic
1146602132 17:34226921-34226943 TTTGGGATGAAAAGAAGAGAAGG - Intergenic
1146911380 17:36650608-36650630 TTTTTAATGAGAAGGACCCAAGG + Intergenic
1148411184 17:47468620-47468642 TTCTTGATAAAAAGAAAAGAAGG + Intergenic
1149037561 17:52152466-52152488 GTTTGGATGAAAGAGACAGAGGG - Intronic
1149761115 17:59231195-59231217 TTTTTGATGAGAATGTCAGCTGG - Intronic
1150328480 17:64275551-64275573 ATTTTGCTGTAAAGGACAGCTGG - Intergenic
1150366831 17:64595527-64595549 GTTTTGTTGAAAGGGAGAGAGGG + Intronic
1151688577 17:75665310-75665332 TTTTTCATAGAAAGGACAGGAGG - Intronic
1153312789 18:3693742-3693764 TGTTTATTGAAAAGGACAAAAGG + Intronic
1153581550 18:6578973-6578995 TATTTGATGCCAAGGAGAGAGGG + Intronic
1153840045 18:8999083-8999105 CTTTTGATGACAAGGATAGATGG - Intergenic
1155693562 18:28656058-28656080 ATTATGATGAAAAGGACATAAGG + Intergenic
1156613130 18:38751060-38751082 TTTTTGATGATAGGGAAATAAGG + Intergenic
1156659449 18:39329583-39329605 TCTTTGATGAAGATGACTGAGGG + Intergenic
1156801452 18:41119632-41119654 TTTGTGAACAAAAGGGCAGAAGG + Intergenic
1157695956 18:49723799-49723821 TTTTTGTTTATAAGGAGAGATGG + Intergenic
1157837042 18:50914125-50914147 TTTCTGATGAAAAAGAAAAAAGG + Intronic
1158120088 18:54039283-54039305 TTTTGGAGGAAAAGAATAGAGGG + Intergenic
1158919924 18:62180153-62180175 TTTTTTAAAAAAAGGAAAGAAGG - Intronic
1159478296 18:68953289-68953311 TTTTTGGTGAAAAGGCAAAATGG - Intronic
1159852790 18:73546620-73546642 TGTTTGATGAAAATGACTGGAGG - Intergenic
1161019847 19:2003885-2003907 TTTTTAAGGAATAGAACAGAAGG - Intronic
1161752629 19:6109419-6109441 TTTGGGATGAAAAGGTGAGAAGG + Intronic
1162878264 19:13637241-13637263 ATTCTGATGAAAAGATCAGAAGG - Intergenic
1167116114 19:47489936-47489958 TTTCTGATGAATAGGGCAGCAGG - Intronic
925065421 2:925922-925944 TTTAGTGTGAAAAGGACAGAAGG + Intergenic
925208130 2:2024841-2024863 TTGAAAATGAAAAGGACAGAGGG - Intronic
926932692 2:18056172-18056194 TTTATGAGAAAAAGGACAGGAGG + Intronic
927733339 2:25495486-25495508 ATTATGATGAAGAGGACATAAGG + Intronic
927845294 2:26468484-26468506 GATGAGATGAAAAGGACAGAAGG + Intronic
928615684 2:33037158-33037180 TTTTTTATGAGAGGGACAGGGGG - Intronic
929309987 2:40412253-40412275 TTTTTGGTGAGATGGACTGATGG + Intronic
930505835 2:52281950-52281972 TTTTGAATGAAAAGGCCAGTTGG - Intergenic
932949994 2:76281737-76281759 TCTTTGTAGAAAAGGACTGAGGG + Intergenic
933307766 2:80623334-80623356 TTTTTGTAGAAAAGGATAAAGGG + Intronic
933443744 2:82350077-82350099 TTTCTTTTCAAAAGGACAGAGGG - Intergenic
933472597 2:82745553-82745575 ACTTTGAGGAAAAAGACAGAGGG - Intergenic
934978187 2:98820894-98820916 TCTTGGAGGAAAAGGTCAGAAGG + Intronic
935523040 2:104133004-104133026 TTATTGATGAAAAGAAATGATGG + Intergenic
935856539 2:107280829-107280851 TCTTTGAAGAAAAGGAAAGCAGG + Intergenic
936637160 2:114271988-114272010 ATTTTGATGAAAAGGAAAAAGGG - Intergenic
936687406 2:114843931-114843953 TTTTTGATGAAAAGGGGATTGGG - Intronic
936704629 2:115057567-115057589 ATTTTTATGGAAAGGACAGAAGG + Intronic
936742239 2:115526871-115526893 TTTATGCTGTAAAAGACAGAGGG + Intronic
936768704 2:115885653-115885675 TTTTGACTGAAAAGGAAAGAAGG - Intergenic
936805591 2:116328064-116328086 TTTTCAATGAAGAGGAAAGAAGG + Intergenic
937429733 2:121828107-121828129 TTGATAATGAAAAGGAGAGAGGG + Intergenic
937818362 2:126279078-126279100 TTCTTGATAAATAGGAAAGATGG + Intergenic
938051032 2:128171807-128171829 TTTAAGATGAAAAGCACAAATGG - Intronic
938597620 2:132804131-132804153 ATGTTGAGAAAAAGGACAGAAGG + Intronic
939137961 2:138319458-138319480 TTTTTTACCAAAAGGATAGAGGG - Intergenic
940064520 2:149612126-149612148 GATTTGATGAAAGGGACAAAGGG - Intergenic
940246342 2:151621306-151621328 TGTTTCATGAAAAGGGCAAATGG - Intronic
940312047 2:152289283-152289305 TTTACATTGAAAAGGACAGAAGG + Intergenic
940454318 2:153876081-153876103 ATTTTGATGACAAGAGCAGAGGG - Intronic
941059424 2:160828253-160828275 GTTTTGATGAAAATAACTGAAGG - Intergenic
942027594 2:171925843-171925865 TTTTATATAAAAAGGAAAGACGG + Intronic
942775126 2:179572096-179572118 TTCTTGTTGAACAGGACAGGAGG + Intronic
942955093 2:181764300-181764322 TTTCTTCTGCAAAGGACAGATGG - Intergenic
942963225 2:181858226-181858248 TATTTGATGTAAAGGCAAGAGGG - Intergenic
944535166 2:200702035-200702057 TTTTTGGTGAAAAGTACAGGTGG + Intergenic
945709692 2:213279925-213279947 TTTCTAATTAAAAGGATAGAGGG - Intergenic
946022555 2:216651083-216651105 TTTTTTTTCAAAAGGTCAGAGGG - Intronic
946125092 2:217555708-217555730 TGTTTTATGAAAAGGAAAGATGG + Intronic
946717446 2:222567382-222567404 TTTTGGATAAAATGGACAGAAGG + Intergenic
946918173 2:224548383-224548405 TATTTGAAGAATAGGACATACGG + Intronic
1170402709 20:16005032-16005054 ATTTTGATGAACAGGATATATGG + Intronic
1171417987 20:24996449-24996471 TTTCTGATAAAAGGGACAAATGG + Intergenic
1172221807 20:33279426-33279448 TTTCTGATGACGTGGACAGATGG - Intronic
1172303294 20:33864569-33864591 TAATTGATGAAAAGGACAATTGG + Intergenic
1172464924 20:35149082-35149104 TATTTGCTGAAAAAGTCAGATGG + Intergenic
1174201596 20:48809961-48809983 TTTGAGATGAAAAGGGGAGAAGG - Intronic
1174869051 20:54166729-54166751 TTTTTTAAAAAAAGGACACAGGG + Intronic
1174924362 20:54741282-54741304 TTTTTTATAAAAAGGACTGTGGG - Intergenic
1175649275 20:60703380-60703402 TCTATCATGAAAAAGACAGATGG - Intergenic
1177242906 21:18484011-18484033 TTTTTGAGGAAAAGAAAAGAGGG - Intronic
1177250475 21:18584821-18584843 TCTTTGGTGAAAATAACAGAAGG - Intergenic
1177371856 21:20214867-20214889 TTTTCTTTGGAAAGGACAGATGG + Intergenic
1177380678 21:20338926-20338948 TTTTTTATTAAAAGAAAAGAAGG - Intergenic
1178644014 21:34369699-34369721 GTGGTGATGAAAAGGAGAGATGG + Intronic
1179272517 21:39862373-39862395 TCTTTGATGAAAAGGTCAGTGGG - Intergenic
1181159704 22:20951842-20951864 TTTTAGAGGAAAACCACAGATGG - Exonic
1181714981 22:24718911-24718933 TTTTTGGTGGAAAGGTCATAAGG - Intergenic
1181881615 22:25984965-25984987 TGTGTGAAGAAAAGGACAGGAGG + Intronic
1183096448 22:35554972-35554994 TTGCTGATCAAAAGCACAGATGG - Intergenic
1183757782 22:39785974-39785996 TTCTTGATGAATAGGAAAGAAGG - Intronic
949273287 3:2246700-2246722 TTTACCATGAAAAGGAGAGAGGG + Intronic
949960755 3:9310162-9310184 TTTGTGATGAAAAGGAAACCTGG - Intronic
950288942 3:11767921-11767943 TCTATAATCAAAAGGACAGATGG - Intergenic
952166046 3:30750173-30750195 ATTTTAATGAATGGGACAGAAGG + Intronic
953336967 3:42101709-42101731 TTCTTTATGAAAATAACAGAGGG + Intronic
954040759 3:47885628-47885650 TTTTTGACTAAAAGTACATATGG - Intronic
954985751 3:54790191-54790213 TATGTGATAAAAAGCACAGAAGG - Intronic
955043495 3:55338520-55338542 ATTTTGATAAGAAGTACAGAGGG + Intergenic
956456945 3:69430895-69430917 TTGTTGATGAGAATGACAGTAGG + Intronic
956514120 3:70027509-70027531 TTTTTGATGACAAAGAGGGAAGG - Intergenic
956801913 3:72767181-72767203 TTTCTGATGAAAGGATCAGATGG - Intronic
957192285 3:77024984-77025006 TTTTAAAAAAAAAGGACAGAAGG + Intronic
957563222 3:81852209-81852231 CTTTTGATCAAAATGAAAGAAGG - Intergenic
957569553 3:81928827-81928849 TTTAAAATGGAAAGGACAGAAGG - Intergenic
957927578 3:86834480-86834502 TTTCAGATGAACAGTACAGAAGG + Intergenic
959477228 3:106825710-106825732 GTTCTGAGGAAAAGGACCGAGGG - Intergenic
959588079 3:108044801-108044823 TTGTTGCAGAAAAGGACAAATGG + Intronic
959856980 3:111170833-111170855 TTTATGAGGAAGTGGACAGATGG + Intronic
960216220 3:115041239-115041261 TAATTGAAGAAGAGGACAGATGG - Intronic
962886331 3:139631429-139631451 TATTAGATGATAAGGGCAGATGG - Intronic
963967924 3:151394241-151394263 GATTTGATGAAAAGTACAAAAGG + Intronic
964260159 3:154826341-154826363 TTTTTCTTCAAATGGACAGACGG - Intergenic
964298524 3:155260932-155260954 TTTTTGAGGAAAAGGAAAGGGGG + Intergenic
964586401 3:158309495-158309517 TTAGTGATGGAAATGACAGAAGG + Intronic
964636681 3:158865658-158865680 TTTTTAATTAAAAAGAAAGAAGG - Intergenic
964942778 3:162180529-162180551 CTTTTGATGAAAAGATCAAATGG + Intergenic
964993117 3:162840096-162840118 TTTTTAATTAAAAGTACAGGCGG - Intergenic
965055490 3:163708423-163708445 TTTATTATGAACAAGACAGAAGG - Intergenic
965642904 3:170849772-170849794 TTGATGATGAAATGGAGAGAGGG - Intronic
965721917 3:171671441-171671463 TTTTTGAGGAAAGAGACAAAGGG - Intronic
965749379 3:171960486-171960508 TTTCTTATGAAAAGGATTGATGG - Intergenic
966210276 3:177446023-177446045 GTATTTATGAAAAGGATAGAAGG + Intergenic
966285563 3:178291353-178291375 TTTTTGATGGAAAGGTAAAATGG - Intergenic
966977194 3:185095191-185095213 TTTTTGCAGAGAAGGACAGGAGG - Intronic
968825358 4:2892214-2892236 TGTTTGTTGAAAAGGACTTAAGG - Intronic
969711210 4:8845188-8845210 CTTATGATGCCAAGGACAGATGG + Intergenic
970136721 4:12933131-12933153 TTTTTGGTGAGAAGAAAAGAGGG - Intergenic
970827139 4:20289765-20289787 TTTCTGAAGAAAGGGAGAGAGGG + Intronic
971387259 4:26152281-26152303 TGGTGGATGAAAAAGACAGATGG - Intergenic
971994273 4:33944097-33944119 TGTTTGATGAGAAGAAGAGATGG + Intergenic
972041787 4:34610979-34611001 TAATTGATGAAAAAGCCAGATGG + Intergenic
972917882 4:43903500-43903522 TTTTTTATCACAAGGACAGAGGG - Intergenic
973778129 4:54262376-54262398 ATTTTAATTAAAAGGACAAAAGG + Intronic
974681136 4:65163330-65163352 ATATTAATGAAAAGGAAAGATGG + Intergenic
975303701 4:72822828-72822850 TTATTTATGGAAAGGACACATGG + Intergenic
975316073 4:72954909-72954931 TTTTTGGTGAAATCTACAGAAGG - Intergenic
975995725 4:80311461-80311483 TTTTTGGTAAATAAGACAGATGG + Intronic
976070618 4:81235949-81235971 TTTCTTATCACAAGGACAGAGGG + Intergenic
976800340 4:88983405-88983427 TATATGAGGAAAAAGACAGATGG + Intronic
977072885 4:92414685-92414707 TTTATGATGAAAATGACTGCTGG - Intronic
977174402 4:93802643-93802665 TTTATGATAACAAGTACAGAAGG - Intergenic
977329584 4:95620867-95620889 TACTTGATGAAAAGAACATAAGG + Intergenic
977744791 4:100533878-100533900 TTTTTCATGGAAAAGACATAGGG - Intronic
978975957 4:114872922-114872944 TTGTTGTTGAAAAGGGCAAAAGG - Intronic
979041197 4:115798400-115798422 TTTTTGAAGTATAGGCCAGATGG - Intergenic
979678062 4:123431138-123431160 TTTTGTAGGAAGAGGACAGAAGG - Intergenic
980423311 4:132592863-132592885 TTTTTGATGCAAAGAATAAAAGG + Intergenic
980483723 4:133425464-133425486 TTTTTGATGAAAAGGAGTAGGGG - Intergenic
981563425 4:146072405-146072427 TTCTTGCTGAAAAGAAAAGAGGG - Intergenic
981859550 4:149338496-149338518 TTTTTGATTAACAGAACAGATGG - Intergenic
981891543 4:149744523-149744545 TTTTGCATTAAAAGGACAGTGGG - Intergenic
982101984 4:151977008-151977030 TATATTATGAAAGGGACAGAAGG - Intergenic
982139430 4:152304032-152304054 TTTTTCTTGAAAAGAATAGAAGG + Intergenic
982844731 4:160235914-160235936 TTTTTGGCCAAAAGGACAGATGG - Intergenic
983249896 4:165331540-165331562 TTTGAGATGAGTAGGACAGAAGG + Intronic
983323053 4:166218568-166218590 TTTTTGAGGAAAAAGACTGGAGG - Intergenic
984342219 4:178471651-178471673 TTTTTGTTTATAAGGACAGTGGG - Intergenic
984356800 4:178670330-178670352 TTTTTCATGCAAATGACAAAGGG - Intergenic
985201120 4:187486601-187486623 TTTTTGTTGAAAAGGAGGCAAGG + Intergenic
985822299 5:2168667-2168689 TTTTAGCTGAAGAGGAGAGAGGG + Intergenic
986595984 5:9422488-9422510 TTTTTAAAGAAAAAGACAGTCGG - Intronic
987238641 5:15969607-15969629 TAATTGAGGAAAAGGACTGAGGG + Intergenic
987888811 5:23848549-23848571 TAATTGATGAAAAAGACAAAAGG - Intergenic
988393322 5:30664195-30664217 TTTGTGATAAAAAGGAAAAAGGG + Intergenic
988926593 5:35996626-35996648 CTTTTGATGAAAAAGAGATATGG - Intergenic
989303552 5:39924416-39924438 TATTTAATGAAAAGAAGAGATGG - Intergenic
990026605 5:51199187-51199209 ATTTTGATAAAAAGGAGAGTTGG + Intergenic
990108806 5:52297001-52297023 TTTAAGATAAAAAGGACAGTAGG - Intergenic
990467643 5:56084850-56084872 TTTATGATGAAAAGAACATGAGG - Intergenic
991489494 5:67168122-67168144 TTTTTGAGGAAAAGAACTGGGGG + Exonic
992105376 5:73446475-73446497 TTTTTCATGAAAAGGAAAAATGG - Exonic
993928397 5:93902020-93902042 TATTTGATGGAAAGGAAAAATGG + Intronic
994086868 5:95768611-95768633 CTTTTGAGCAAAAGGACTGAGGG + Intronic
994089119 5:95793071-95793093 GTTTTGTTGAAAAGCACAGATGG + Exonic
994575693 5:101575839-101575861 TTTTTGTGGAAAAGAACAGTGGG + Intergenic
994916873 5:105992107-105992129 TTTTTAATGAAAAGCTCAGAGGG - Intergenic
995712747 5:115051519-115051541 TTTTGGAAGAACAGGATAGAGGG - Intergenic
997696983 5:135869435-135869457 TTTTTGTTGACAAGGCCAGTTGG + Intronic
998012015 5:138702953-138702975 TCTGTGATGCAAAGCACAGAAGG - Intronic
998326650 5:141286788-141286810 TATCTGATAGAAAGGACAGAAGG - Intergenic
998358410 5:141561567-141561589 TTTATAATGAAAAAGACACAGGG - Intronic
999067960 5:148711885-148711907 TTTTTAATTAAAAGAACAGATGG + Intergenic
1000497471 5:162002679-162002701 TTTATGATGAAACGAACAGTTGG - Intergenic
1000638347 5:163669833-163669855 ATTTTGATGAAAACTACAGGTGG - Intergenic
1000725345 5:164762682-164762704 TTTTTTTTGAGAAGGAGAGAAGG - Intergenic
1001095102 5:168770007-168770029 CTCTTGCTGAAAAGTACAGAGGG - Intronic
1001457423 5:171875237-171875259 TTTTTTTTTAAAAGTACAGATGG - Intronic
1002203656 5:177547594-177547616 TTCTTGAAGCAAAGGACAGAAGG + Intronic
1002587591 5:180260851-180260873 TTTTTCATAAAAAAGAAAGATGG - Intronic
1002624038 5:180511946-180511968 CTTTTGATGGAAAGGGAAGAAGG - Intronic
1002656504 5:180753069-180753091 ATTTTGATGAAAATAACTGAAGG + Intergenic
1002664530 5:180812802-180812824 TATATGGTGAAAAGGAGAGAAGG - Intronic
1003418324 6:5933152-5933174 TTTTAGCAGAAAAGGACACATGG + Intergenic
1004250125 6:14016694-14016716 TGTTTGATCAAGAAGACAGAAGG - Intergenic
1004522645 6:16376623-16376645 TTTTAAATGAAAAGGAAAGCGGG - Intronic
1007677011 6:43604509-43604531 TTTTTCATGAAAAAGATAAAAGG + Intronic
1008012012 6:46478046-46478068 TATTTCATGAAAATGACCGATGG - Intronic
1008264051 6:49401974-49401996 TTGTTGATGTAGAGGACAGCAGG - Intergenic
1008893640 6:56525872-56525894 TTTTTTCTGAAGATGACAGAAGG - Intronic
1009044017 6:58216126-58216148 TTTTTGAGGAAATGGAGATATGG - Intergenic
1009371756 6:62913187-62913209 TTTGTGATAAAAAGGAGAAAAGG - Intergenic
1009809397 6:68640627-68640649 TGGTTGAGGAAAAGGAAAGAGGG - Intronic
1010101310 6:72111673-72111695 CTTTTCAAGAAATGGACAGATGG - Intronic
1010551871 6:77233233-77233255 TTTTTTAAGAAAAGGACTAAAGG + Intergenic
1012037126 6:94156501-94156523 TCTTTGAAGATAAAGACAGAGGG - Intergenic
1012171512 6:96022620-96022642 TTTTTCATGTAAAGGTGAGATGG + Intronic
1012360508 6:98372092-98372114 TTTTTCATTTAAAGGACAAAGGG + Intergenic
1012629424 6:101445129-101445151 TTATTGAGGAAAAGGAGAGTAGG - Intronic
1012643014 6:101645640-101645662 TTTTTAAAGAAAATGACAAATGG - Intronic
1013755330 6:113455087-113455109 TTTTTGCTGAAAAGTAGACAAGG - Intergenic
1014938779 6:127413932-127413954 TCTTTGAAGAAAATGACAGTAGG - Intergenic
1015321270 6:131878080-131878102 TTTTTGATGAAAAGGACAGAAGG - Intronic
1016751247 6:147632621-147632643 TTTTGGATAAAAAGGCCACAGGG + Intronic
1016870867 6:148815181-148815203 TCTTTAAAGAAAAGGAAAGAGGG + Intronic
1018054141 6:160036960-160036982 TTTATAATGAAAAGGAAAAATGG - Intronic
1018517496 6:164601779-164601801 TTTTTAAACAAAAGGACAAAAGG - Intergenic
1019368819 7:650213-650235 TCTCTGATGAAGAGGACAGGTGG + Intronic
1020343540 7:7138531-7138553 TGTTTGAGGAATAGCACAGAAGG + Intergenic
1020505049 7:8975625-8975647 TTTCTGATTAAAAGCAAAGAAGG + Intergenic
1020939611 7:14515682-14515704 TTCTAGATGACAAAGACAGAAGG - Intronic
1021048408 7:15952247-15952269 TTTTATATGAATAGGAAAGAAGG - Intergenic
1021062907 7:16135551-16135573 ATTCTGATAAAAAGGCCAGAGGG + Intronic
1021849984 7:24797918-24797940 CTTTTGAGAAAAGGGACAGAAGG + Exonic
1022654500 7:32306398-32306420 GTTTAGATGAAAAAGACAGAGGG - Intergenic
1022746341 7:33176159-33176181 ATTTTGAGCAAAAGGACACAGGG - Intronic
1023129633 7:36989568-36989590 TTTTTGGAGAATGGGACAGAGGG + Intronic
1023342694 7:39238566-39238588 TTTTTCCGGAAAAGGCCAGATGG - Intronic
1024319817 7:48053906-48053928 TCTTTGATTAAGAGGAAAGATGG + Intronic
1024402197 7:48937618-48937640 TTATTTCTAAAAAGGACAGATGG - Intergenic
1028683561 7:93567034-93567056 TTTGTGATTAAGAGGGCAGAGGG + Intronic
1028984655 7:97000171-97000193 TTTTTCATGAGAAAGAGAGAGGG - Intergenic
1030001080 7:105063402-105063424 TTTTTGCTAATAAGGACTGATGG - Exonic
1030832775 7:114247003-114247025 TTTATGTTGAAAAGGAAAGTTGG + Intronic
1031003094 7:116440241-116440263 TTTTTGATGTTAAGGAAAGGGGG - Intronic
1032876178 7:136040836-136040858 CTCTTGATGAAGAGGCCAGATGG - Intergenic
1033251731 7:139766468-139766490 TGTTTGATGAACAGGACAAATGG + Intronic
1033870101 7:145743104-145743126 ATTTTGATGAAATGTACTGAGGG + Intergenic
1034590440 7:152133751-152133773 TGTTTGGTGACTAGGACAGAGGG + Intergenic
1034873827 7:154707097-154707119 TTTTTGAAGGAAAGGGCAGAGGG + Intronic
1035400552 7:158562466-158562488 TTTTTCATGTAAAGGGCAGATGG - Intronic
1036416255 8:8551570-8551592 TTTTCAATGGAAAGGTCAGAGGG + Intergenic
1037447230 8:18978174-18978196 AGTTTGCTGAAAAGGCCAGAGGG + Intronic
1038648769 8:29383456-29383478 TTTTTGATGAAAAACTCAGAGGG - Intergenic
1039084382 8:33765416-33765438 TTTTAGATGGAAAGCAGAGAGGG + Intergenic
1041154521 8:54971584-54971606 TTTCTTATGAAAAACACAGAGGG + Intergenic
1041797989 8:61766835-61766857 GTTCTGATGCAATGGACAGAGGG - Intergenic
1042598218 8:70471881-70471903 TTTCTTATCACAAGGACAGAAGG - Intergenic
1042852431 8:73229296-73229318 TTTTTGGTAAAAAGGCTAGAGGG - Intergenic
1043121828 8:76335650-76335672 GTTTATATGAAAAGGATAGAAGG + Intergenic
1043238438 8:77899567-77899589 TTTCTTATCACAAGGACAGAGGG + Intergenic
1043840638 8:85099558-85099580 ATTTTGATGAAAAATAAAGAAGG - Intergenic
1044125646 8:88456188-88456210 TTATTTAAGAAAAGGATAGAAGG + Intergenic
1044210787 8:89548160-89548182 TTTTTGATGGGTAGTACAGATGG - Intergenic
1045985080 8:108240472-108240494 TTTTTGAAGAAAAACTCAGAGGG + Intronic
1046580222 8:116083093-116083115 TTTGTGATTAAAAAGCCAGAGGG - Intergenic
1046713003 8:117534232-117534254 TTTCAGATGAAAAGTAAAGAGGG - Intronic
1047071063 8:121344132-121344154 TTTTCTATAAAAAGGAGAGATGG - Intergenic
1048829561 8:138463132-138463154 TTTTTGGTGAAAAGCACATATGG + Intronic
1048866240 8:138763787-138763809 ATTTAGATGAAAAGGTCAGGAGG - Intronic
1049982698 9:919509-919531 TTTTTCAGGATAAGGAAAGAAGG - Intronic
1050113935 9:2243470-2243492 TTTGTGAGGAAAAGGAAAAATGG + Intergenic
1050368107 9:4891227-4891249 TGTTTCATGAAAAGGAGAGAGGG - Intergenic
1050961350 9:11737251-11737273 TATATGATGAAAAAGAAAGATGG + Intergenic
1051149523 9:14065339-14065361 TTTGTGATGTAAAATACAGAAGG - Intergenic
1051338913 9:16093194-16093216 TCTTTGATGAAAAGCAAATACGG + Intergenic
1051904008 9:22074419-22074441 TCTTTGATGAAGAGGACATAGGG + Intergenic
1051950470 9:22625214-22625236 TTTTTTCTGTAAATGACAGAAGG + Intergenic
1052099691 9:24430217-24430239 TTTTTGAATATAATGACAGAGGG - Intergenic
1052103338 9:24478960-24478982 TTTTAGCTGAAAAGGAAAAAAGG + Intergenic
1052274360 9:26660978-26661000 TTATTGAATAAATGGACAGATGG + Intergenic
1052742877 9:32410675-32410697 CTTTTGGAGAAAAGGACAAATGG - Intronic
1052747241 9:32452653-32452675 TTTTTACCGAAAAGGACAGAGGG - Exonic
1054821218 9:69522221-69522243 TTTCTGATGCCAAGCACAGAGGG + Intronic
1055471930 9:76620592-76620614 GTTTTGTTGAAAATGACAGGCGG + Intronic
1056251266 9:84750712-84750734 CTTTTGCTGTAAAGGTCAGATGG - Intronic
1056546662 9:87619482-87619504 TTTTTCATGGCAAGGACAGTGGG + Intronic
1056796908 9:89664900-89664922 TTTTTAGAGCAAAGGACAGAGGG - Intergenic
1057597667 9:96429660-96429682 TTTTTGATGAAAATTTCAGCTGG + Intergenic
1057815798 9:98293278-98293300 CTTTGGAGGAAAAGCACAGAAGG - Intronic
1057861142 9:98641836-98641858 TTTTAGAATAAAAGGAGAGAAGG + Intronic
1057945980 9:99328958-99328980 GTTTTAATGAAAAGAACAAATGG + Intergenic
1058101232 9:100919673-100919695 TTTTCCATAAAAAGTACAGATGG + Intergenic
1058311911 9:103514713-103514735 TTTCTTATCACAAGGACAGAGGG + Intergenic
1058478772 9:105369567-105369589 TATTTGAGGCAAAGGAGAGAAGG - Intronic
1058535501 9:105955915-105955937 TTACTCATGGAAAGGACAGAGGG - Intergenic
1058593196 9:106587230-106587252 TTTTTAAGGCAAATGACAGAAGG - Intergenic
1059779845 9:117514873-117514895 TTCTTGATGAATAGGACTCAAGG + Intergenic
1060450237 9:123731267-123731289 TTTTTAATGAAAAACACAGCTGG + Intronic
1061007051 9:127934334-127934356 TTGGTGGTGAAATGGACAGAGGG + Intergenic
1061474420 9:130854452-130854474 TTTATACTGAAAAGGACAGCTGG + Intronic
1186411149 X:9345350-9345372 TTATTGATTAAAAGAACTGAAGG - Intergenic
1187004786 X:15221607-15221629 GTTTTGATGAAGAGATCAGAAGG + Intergenic
1187097300 X:16162042-16162064 TGCCTTATGAAAAGGACAGAGGG - Intergenic
1187191720 X:17042150-17042172 TTTTTAAATAAAAGGAGAGAGGG - Intronic
1187986829 X:24822847-24822869 TTGGTGATGAGAAGAACAGATGG + Intronic
1188832718 X:34920028-34920050 TTTTTGCTGAAAACAAAAGATGG + Intergenic
1189362962 X:40367487-40367509 TTTTTCAAGAACAGTACAGACGG - Intergenic
1189910387 X:45805036-45805058 TTTCTTATGAAAAGGAAAGATGG + Intergenic
1191576763 X:62714728-62714750 TTTATGATGTAAAGGTCAGATGG + Intergenic
1193295111 X:79824531-79824553 CTTTTGATGAAAAAGAGATATGG + Intergenic
1193350192 X:80454804-80454826 ATTTTTTTGAAAAGAACAGATGG + Intergenic
1193640455 X:84005023-84005045 CTTTTGATGAAAAAGAGACATGG - Intergenic
1193898247 X:87141163-87141185 TTCTTTATCAAAAGGACAGAGGG - Intergenic
1194135131 X:90131514-90131536 ATTTTGGAGCAAAGGACAGATGG - Intergenic
1194757396 X:97753285-97753307 TTTTTGCTGAAAAGGAAATAAGG + Intergenic
1194912329 X:99661667-99661689 TTTTGGTGGAAAAGGGCAGAAGG - Intergenic
1195017473 X:100793437-100793459 CTTTTGATGAAAAAGAGATATGG - Intergenic
1195646363 X:107235242-107235264 TTTTTATTTATAAGGACAGAAGG + Intronic
1196285712 X:113877280-113877302 TTTTTCAATAAAAGGAAAGAGGG - Intergenic
1196548968 X:116998610-116998632 CTTTTGATGAACAGGAGTGATGG + Intergenic
1196806192 X:119588496-119588518 GCTTTGATGAAAAGGTCAGTTGG - Exonic
1197622792 X:128769822-128769844 TTTTTAATACAAAGGACAGTTGG + Intergenic
1197635122 X:128905861-128905883 ATTTTGATGTAAAACACAGAAGG - Intergenic
1197674089 X:129311341-129311363 TTTTTCATCAAAACCACAGAGGG - Intergenic
1198271016 X:135056051-135056073 TTCCTTATCAAAAGGACAGAAGG - Intergenic
1198386590 X:136134852-136134874 TTCTTTATCATAAGGACAGAGGG + Intergenic
1198505363 X:137295809-137295831 TATTTGGTGAAAAGGGCAAATGG + Intergenic
1199974902 X:152888505-152888527 TTGTTGATGTAAAGGGAAGAAGG + Intergenic
1200480915 Y:3701606-3701628 ATTTTGGAGCAAAGGACAGATGG - Intergenic