ID: 1015326877

View in Genome Browser
Species Human (GRCh38)
Location 6:131933478-131933500
Sequence ATTAAGAAGGAGAATGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015326873_1015326877 3 Left 1015326873 6:131933452-131933474 CCAGAGATATTAATCAGGCATCA No data
Right 1015326877 6:131933478-131933500 ATTAAGAAGGAGAATGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015326877 Original CRISPR ATTAAGAAGGAGAATGAGGG TGG Intergenic
No off target data available for this crispr