ID: 1015328577

View in Genome Browser
Species Human (GRCh38)
Location 6:131951306-131951328
Sequence GCTGCCGTCGAGCTGGAGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015328563_1015328577 21 Left 1015328563 6:131951262-131951284 CCGGGACGCGCCGGGCTGTCGTC 0: 1
1: 0
2: 1
3: 4
4: 33
Right 1015328577 6:131951306-131951328 GCTGCCGTCGAGCTGGAGGGTGG 0: 1
1: 0
2: 0
3: 17
4: 141
1015328567_1015328577 11 Left 1015328567 6:131951272-131951294 CCGGGCTGTCGTCTCGGGGCTGT 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1015328577 6:131951306-131951328 GCTGCCGTCGAGCTGGAGGGTGG 0: 1
1: 0
2: 0
3: 17
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015328577 Original CRISPR GCTGCCGTCGAGCTGGAGGG TGG Exonic
900150304 1:1175863-1175885 GCTGCCGTGCAGGTGGAGAGAGG + Intronic
900205855 1:1431602-1431624 GGTGCAGCCGAGCTGCAGGGTGG + Intergenic
900206483 1:1433945-1433967 GCTGATGGCGAGCTGAAGGGAGG + Intergenic
900422677 1:2562395-2562417 GCTGCCGCCTGGCTGGAGGATGG - Intronic
902374763 1:16025177-16025199 GCTGGCCTGGAGCTGGAGGAAGG - Intronic
906147822 1:43570314-43570336 GATGCCATCGTGCAGGAGGGAGG + Intronic
907222773 1:52919632-52919654 GCTGCCTTTGAGCTTGAGGTTGG - Intronic
907411270 1:54285381-54285403 GCTGCCGTTGAGCTGCAGGAGGG - Intronic
908816253 1:68038284-68038306 GCTGCTGTCAAGGTGGAGGTGGG - Intergenic
913186307 1:116373372-116373394 GCTGCCGCGGGGCGGGAGGGTGG - Intronic
913531137 1:119735166-119735188 GCTGCCGTCCAGCAGGAGAGAGG + Intronic
916588420 1:166167020-166167042 GCTGCCGTCCGGGTGGGGGGGGG + Intergenic
919663473 1:200270318-200270340 GCTGCCTGCGAGCTGGCTGGAGG - Intergenic
920311503 1:205051576-205051598 GCTGCAGTCGGGGTGGAGGAGGG + Intronic
922213617 1:223503556-223503578 TCTGCCTCCCAGCTGGAGGGTGG + Intergenic
923181211 1:231521738-231521760 GCTGGGGTGGAGGTGGAGGGGGG - Intergenic
1062944490 10:1450152-1450174 GCTCCCGTCGAGAGGGAGGGAGG + Intronic
1063368640 10:5507142-5507164 GCTGCTGTCGGGCCAGAGGGAGG - Intergenic
1064143280 10:12807786-12807808 CCTGCAGTGGAGCTGGACGGAGG - Intronic
1065650376 10:27882665-27882687 GCTACTGTGGAGCTGGAGAGAGG - Intronic
1070751240 10:78965246-78965268 GCAGCCGGCCAGCGGGAGGGCGG + Intergenic
1072569030 10:96642610-96642632 GATGCCGTGTAGCTGGAAGGAGG - Intronic
1075743238 10:124708736-124708758 GCTGCCGTAGAGCTGAATTGGGG - Intronic
1076871468 10:133197047-133197069 GCTGCCGCACACCTGGAGGGAGG - Exonic
1076911280 10:133391374-133391396 TCTGCTGTCGGGATGGAGGGAGG + Exonic
1077471400 11:2762464-2762486 TTTGCCGTCGAGCTGGCGGAAGG - Intronic
1079350898 11:19691076-19691098 GCTACAGTAGAGCTGGAGAGTGG + Intronic
1081908995 11:46688184-46688206 GCTGTGGTCGAGCTGGTGGCTGG + Exonic
1085322703 11:75584396-75584418 GCTGCCCTGGGGCTGGGGGGAGG - Intergenic
1090667783 11:128926188-128926210 CCTGCAGCCGAGCTGGAAGGAGG + Intergenic
1090776938 11:129974040-129974062 GCTGCTGGTGAGCTGGAGGCGGG - Intronic
1091237972 11:134034295-134034317 GCTGCTGCAGAGCTGGAGGAGGG + Intergenic
1092488052 12:8919852-8919874 GCTGCCGTCCAGCAGGTGAGAGG + Exonic
1096946637 12:55414555-55414577 GCTGCCGTCCAGCAGGTGAGAGG - Intergenic
1102074384 12:110048336-110048358 GCGGCCCTCGGGCTGGCGGGCGG - Intronic
1104860644 12:131921641-131921663 GCTGCCCTGGGGCTAGAGGGTGG - Exonic
1104984119 12:132587093-132587115 GCGGCAGTGCAGCTGGAGGGAGG + Intergenic
1104984125 12:132587116-132587138 GCGGCAGTGCAGCTGGAGGGTGG + Intergenic
1105312219 13:19222539-19222561 TCTGCCGTCAGGCTGGAGTGCGG + Intergenic
1105472170 13:20704028-20704050 GCTGCCGCCGAGCTGGGCCGCGG + Exonic
1105822492 13:24091943-24091965 GCTACCATGGAGCTGGAGAGAGG + Intronic
1106683418 13:32031454-32031476 GCTGGAGCCGAGCTGGTGGGCGG + Exonic
1109141758 13:58721094-58721116 GCAGCACTCAAGCTGGAGGGAGG - Intergenic
1112380269 13:98882351-98882373 GCTGTCTTTGAGATGGAGGGAGG + Intronic
1112506824 13:99980743-99980765 CCCGGCCTCGAGCTGGAGGGAGG + Intergenic
1113568341 13:111334936-111334958 GCTACCATGGAGCTGGAGGGTGG + Intronic
1113666183 13:112143372-112143394 GATGCCCTGGACCTGGAGGGGGG - Intergenic
1118316192 14:64727645-64727667 GCTGCCATCCTGGTGGAGGGAGG - Exonic
1118482380 14:66180228-66180250 GTAGCCGTAGAGATGGAGGGGGG - Intergenic
1121584321 14:95052408-95052430 GCTTCCGACGAGGAGGAGGGCGG - Intergenic
1122410897 14:101525692-101525714 GCTGCCGTTGCGGTGCAGGGAGG + Intergenic
1124917298 15:33988103-33988125 GCTGCCTTTGGGCTGGAGGCAGG - Intronic
1129599462 15:76989857-76989879 GCTGACACCAAGCTGGAGGGCGG - Intergenic
1130678300 15:85973834-85973856 CCTGCCTTAGAGCTGGTGGGAGG + Intergenic
1130994100 15:88894733-88894755 GCTGCCAACGAGCTGGTGGCAGG + Intronic
1131010829 15:89017050-89017072 GCTGGCGTCGGGGTGGAGGGTGG + Intergenic
1131274495 15:90969483-90969505 GCTGAAGTTGCGCTGGAGGGGGG + Exonic
1132252010 15:100341459-100341481 GCTGGCGGCCAGCGGGAGGGCGG - Intronic
1132765211 16:1531039-1531061 GGTGCCCTCGAGCAGGAGGCTGG - Intronic
1133784546 16:8963959-8963981 GCGGGCGCCGAGCCGGAGGGCGG + Intronic
1134136396 16:11679264-11679286 GCTGCCAGGGAGCTGGGGGGTGG + Exonic
1136117082 16:28101327-28101349 GCTGCCGCCAAGCTGCAGGGTGG + Intronic
1138207499 16:55135510-55135532 GCTCCCATCAAGCTGTAGGGAGG + Intergenic
1141659720 16:85435432-85435454 GCTGCAGTCGAGGGAGAGGGAGG - Intergenic
1141805299 16:86337756-86337778 GCAGCCAGCGAGCTGGAGGGCGG - Intergenic
1142836749 17:2593479-2593501 GCTGCCTTCTAGCGGGCGGGCGG - Intronic
1142961890 17:3556645-3556667 GCTCCCTTTGAGTTGGAGGGCGG - Intronic
1143402353 17:6654890-6654912 GCTGCCGTCGCCCTGGAGACAGG - Intergenic
1143483652 17:7240827-7240849 GCTGCCCCTGAGCTGGAGGGGGG - Exonic
1144793768 17:17877414-17877436 GCTGCCCTCCAGCTTGATGGAGG + Intronic
1147166470 17:38596185-38596207 GCTGCAGAGGAGCTGGAGAGAGG + Intronic
1148397836 17:47324139-47324161 GGAGCCTTCGAGGTGGAGGGTGG + Intronic
1148778683 17:50109871-50109893 GCTGCCGCTGAGCTGGGGTGGGG + Intronic
1152110110 17:78353189-78353211 GCGGCCGCCGGGCTGGCGGGCGG - Intergenic
1152292611 17:79448821-79448843 GCTGCCGTCCAGGTGGGGAGAGG - Intronic
1152535656 17:80949115-80949137 GATGCCCTGGAGCTGGAGGGAGG + Intronic
1152566934 17:81104531-81104553 GCTGCCATGGAGCTCGAGCGAGG - Exonic
1152616618 17:81340919-81340941 TCTGCCCTCGAGCTGCAGTGGGG - Intergenic
1153480707 18:5543712-5543734 GGTCCCGGCGAGCGGGAGGGCGG + Intronic
1160779372 19:871042-871064 GAGGCCGTCGAGCTGCAGGGTGG + Exonic
1160873163 19:1286072-1286094 GCCGCCGCCGAGCGGGCGGGCGG - Intergenic
1161371335 19:3913601-3913623 GCTGTCATCGGGCGGGAGGGAGG + Intronic
1163466401 19:17470603-17470625 GCTGCCGTGGACCTGGAGCGCGG + Exonic
1165346971 19:35254573-35254595 GCTGCAGTGCAGCTGGAGGTGGG - Intronic
1166873832 19:45885601-45885623 GCTGCGCTTGAGCTGGCGGGCGG + Exonic
1167500516 19:49844374-49844396 GTTGCGGTCGAGCTGGTGGCTGG + Intergenic
931192796 2:60022077-60022099 GCTGCTGAAGGGCTGGAGGGAGG + Intergenic
931398062 2:61905682-61905704 GCGGCGGGCGAGCTTGAGGGTGG + Exonic
935088262 2:99869409-99869431 TCAGCTGTAGAGCTGGAGGGTGG + Intronic
935806651 2:106754986-106755008 GCTGCTGGGGAGGTGGAGGGAGG + Intergenic
936321993 2:111474967-111474989 GCTGCGGTGGAGCAGGAGGCTGG - Intergenic
936407360 2:112217998-112218020 GCTGCTGTGGAGGTGGAGGCAGG - Intronic
936437804 2:112523032-112523054 GCGGCCTTGGAGGTGGAGGGAGG - Intronic
938181489 2:129188991-129189013 GCTGCCCTAGAGTTGGAGGCAGG - Intergenic
938391681 2:130911769-130911791 GCTGGCGTCTTGCTGGGGGGAGG - Intronic
942637818 2:178027495-178027517 CCAGCCGTCAAGCTGGAGGTGGG + Intronic
944399266 2:199306808-199306830 GCTGCCATCCAGATGAAGGGAGG + Intronic
946400799 2:219467467-219467489 GGTGCCCAAGAGCTGGAGGGAGG + Intronic
948157966 2:235799934-235799956 GCTGCCCTCGGGGTGGAGGTGGG + Intronic
1172066790 20:32227077-32227099 TCTTCCCTCCAGCTGGAGGGGGG - Intronic
1172093301 20:32448398-32448420 GCTTCTGTCCAGCTGGAGAGAGG + Intronic
1173736516 20:45365484-45365506 GCTGCCGTACAGATGTAGGGAGG + Intronic
1175217155 20:57397383-57397405 GCTGCCATCTAGCCAGAGGGAGG - Intronic
1179576174 21:42309896-42309918 TCTGCCGTCGGGCTGGGGGGTGG + Intergenic
1179654627 21:42837639-42837661 GCTGCCGGCCAGCGGGAGGGAGG - Intergenic
1179914058 21:44464907-44464929 GCTGCCTTGGAGGTGGAGGGGGG + Intergenic
1182772533 22:32805538-32805560 GCTGCTATCCAGCTGGAGGAGGG + Intronic
1183444532 22:37844321-37844343 GCTGTCAGCGAGCTGGCGGGCGG + Exonic
1185056071 22:48578925-48578947 GCCGCTGTCCAGCAGGAGGGAGG + Intronic
950657183 3:14443906-14443928 GCCGCCTTAGAGCTGGAGGCTGG + Intronic
950703559 3:14766561-14766583 GCAGCCGGCGAGGGGGAGGGGGG + Intronic
953732540 3:45462613-45462635 TCTGTAGTTGAGCTGGAGGGGGG + Intronic
961012880 3:123448019-123448041 GCGGCCGACGAGCTGGAGGCCGG - Exonic
961754636 3:129120889-129120911 GCTGCCATCGCGGTGGATGGAGG + Intronic
965371132 3:167863734-167863756 GCAGCCCTTGAGGTGGAGGGCGG + Intergenic
966840485 3:184083489-184083511 GCTGCAGCCCAGCTGAAGGGTGG - Intergenic
969236223 4:5866677-5866699 GCTGACGTCTACCTGGAGGATGG - Exonic
969462370 4:7335580-7335602 GCTGCAGTCTTGCTGGAGGCGGG + Intronic
976182794 4:82415041-82415063 GCTACCATGGAGCTGGAGAGAGG + Intergenic
986501695 5:8407664-8407686 GCTGTTGTCCAGCTGGCGGGTGG + Intergenic
987579274 5:19767985-19768007 GCTGCAGTGGAGGTGGAGGGAGG - Intronic
987990201 5:25200055-25200077 GGTGCCGTGGAGCAGGGGGGTGG + Intergenic
988381271 5:30499558-30499580 GCTGCAGTCTAGCTGGGGGAGGG - Intergenic
992591819 5:78303440-78303462 GCTGCCCTGGAGATGGAGGAAGG - Intergenic
998093569 5:139384412-139384434 GCTGCTGCCCAGCTGGAGAGCGG - Intronic
1002694304 5:181073907-181073929 GCTGCCGTGGAGGTGGGAGGTGG - Intergenic
1006190472 6:32204480-32204502 GATGCTGTTGAGCTGGAAGGTGG - Intronic
1006860517 6:37169456-37169478 GCTGACGTCGCGCTGTAGGCTGG - Intergenic
1007093818 6:39201045-39201067 GCGGCTGTGGAGCTGGAGGCAGG - Intronic
1011625725 6:89282036-89282058 GATGCAGTCGTGATGGAGGGAGG - Intronic
1013117436 6:107114344-107114366 GCTGCCCAGGAGCTGGAGGCGGG - Exonic
1015328577 6:131951306-131951328 GCTGCCGTCGAGCTGGAGGGTGG + Exonic
1017009558 6:150054101-150054123 GGGGTCGTGGAGCTGGAGGGCGG - Intergenic
1019994071 7:4711954-4711976 GGTGCCGCCGAGCAGGAGGGAGG + Intronic
1022112040 7:27237805-27237827 GTGGCCTTTGAGCTGGAGGGAGG + Intergenic
1023846269 7:44122438-44122460 GGTGCCGGAGAGCTGGATGGAGG - Exonic
1024201035 7:47105988-47106010 GTTGCAGGAGAGCTGGAGGGAGG - Intergenic
1025199211 7:56951295-56951317 GCTGCTGTCTAGGTGGAGGTGGG + Intergenic
1025672735 7:63625638-63625660 GCTGCTGTCTAGGTGGAGGTGGG - Intergenic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1031400857 7:121325188-121325210 GCTACCATAGGGCTGGAGGGAGG - Intergenic
1032074491 7:128830165-128830187 GGTGCCGCCGCGCTGGAAGGTGG - Intergenic
1033252119 7:139769288-139769310 GCGGCCGTGGAGATGGAGGTGGG - Intronic
1034313114 7:150107572-150107594 GCTGCCGTGAAGCAGGAGTGTGG + Intergenic
1036501584 8:9319384-9319406 GCTGCCCTGGAGCTGAAGAGGGG - Intergenic
1042591604 8:70403047-70403069 GCGGCCGGCGAGCTGCAGCGCGG - Intronic
1049154161 8:141056789-141056811 GCTCCCGTAGATTTGGAGGGAGG - Intergenic
1049154646 8:141059350-141059372 GTTGCCATGGTGCTGGAGGGAGG - Intergenic
1056369704 9:85941497-85941519 GCTGTCGCCGCGCGGGAGGGCGG - Intronic
1057130047 9:92648746-92648768 GCTGCCTTAGAGTTGGAGGAGGG + Intronic
1057214215 9:93219147-93219169 CCTGCCATCAGGCTGGAGGGAGG - Intronic
1057793925 9:98142607-98142629 GCTGCCCTCGGGCTGACGGGAGG + Intronic
1061725945 9:132582154-132582176 GCTGCCGCCGAGGAGCAGGGAGG + Intergenic
1062027542 9:134347473-134347495 GCTTCTGCCGAGCAGGAGGGGGG + Intronic
1062278597 9:135742104-135742126 GCTGCTGGCGTGGTGGAGGGTGG + Intronic
1062404687 9:136389827-136389849 GCTGGAGTGAAGCTGGAGGGAGG + Intronic
1187294185 X:17983315-17983337 ACTGCCTTATAGCTGGAGGGAGG - Intergenic
1192201862 X:69071324-69071346 GCTGCCTTCCAGCTCGTGGGTGG - Intergenic
1192234013 X:69284839-69284861 CCTGGGGTAGAGCTGGAGGGTGG + Intergenic