ID: 1015328577

View in Genome Browser
Species Human (GRCh38)
Location 6:131951306-131951328
Sequence GCTGCCGTCGAGCTGGAGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015328563_1015328577 21 Left 1015328563 6:131951262-131951284 CCGGGACGCGCCGGGCTGTCGTC 0: 1
1: 0
2: 1
3: 4
4: 33
Right 1015328577 6:131951306-131951328 GCTGCCGTCGAGCTGGAGGGTGG 0: 1
1: 0
2: 0
3: 17
4: 141
1015328567_1015328577 11 Left 1015328567 6:131951272-131951294 CCGGGCTGTCGTCTCGGGGCTGT 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1015328577 6:131951306-131951328 GCTGCCGTCGAGCTGGAGGGTGG 0: 1
1: 0
2: 0
3: 17
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015328577 Original CRISPR GCTGCCGTCGAGCTGGAGGG TGG Exonic