ID: 1015329556

View in Genome Browser
Species Human (GRCh38)
Location 6:131961649-131961671
Sequence GTGTTGGAGGTGGAGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015329544_1015329556 11 Left 1015329544 6:131961615-131961637 CCCCACCAAATCTCATGTAAGAT No data
Right 1015329556 6:131961649-131961671 GTGTTGGAGGTGGAGCTGGTGGG No data
1015329547_1015329556 6 Left 1015329547 6:131961620-131961642 CCAAATCTCATGTAAGATTGTAA No data
Right 1015329556 6:131961649-131961671 GTGTTGGAGGTGGAGCTGGTGGG No data
1015329546_1015329556 9 Left 1015329546 6:131961617-131961639 CCACCAAATCTCATGTAAGATTG No data
Right 1015329556 6:131961649-131961671 GTGTTGGAGGTGGAGCTGGTGGG No data
1015329545_1015329556 10 Left 1015329545 6:131961616-131961638 CCCACCAAATCTCATGTAAGATT No data
Right 1015329556 6:131961649-131961671 GTGTTGGAGGTGGAGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015329556 Original CRISPR GTGTTGGAGGTGGAGCTGGT GGG Intergenic
No off target data available for this crispr