ID: 1015331343

View in Genome Browser
Species Human (GRCh38)
Location 6:131982929-131982951
Sequence TCACACTCATAGTCTCTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015331340_1015331343 18 Left 1015331340 6:131982888-131982910 CCCAGGACATCTCTCCACTCAAC No data
Right 1015331343 6:131982929-131982951 TCACACTCATAGTCTCTGCTTGG No data
1015331341_1015331343 17 Left 1015331341 6:131982889-131982911 CCAGGACATCTCTCCACTCAACT No data
Right 1015331343 6:131982929-131982951 TCACACTCATAGTCTCTGCTTGG No data
1015331342_1015331343 4 Left 1015331342 6:131982902-131982924 CCACTCAACTTTTATTCTTTTGA No data
Right 1015331343 6:131982929-131982951 TCACACTCATAGTCTCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015331343 Original CRISPR TCACACTCATAGTCTCTGCT TGG Intergenic
No off target data available for this crispr