ID: 1015340846

View in Genome Browser
Species Human (GRCh38)
Location 6:132098720-132098742
Sequence TAATTAGGACTTAGGATGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015340841_1015340846 16 Left 1015340841 6:132098681-132098703 CCCCTGCTAAGTTGGGGGAGTCA No data
Right 1015340846 6:132098720-132098742 TAATTAGGACTTAGGATGCATGG No data
1015340843_1015340846 14 Left 1015340843 6:132098683-132098705 CCTGCTAAGTTGGGGGAGTCATT No data
Right 1015340846 6:132098720-132098742 TAATTAGGACTTAGGATGCATGG No data
1015340842_1015340846 15 Left 1015340842 6:132098682-132098704 CCCTGCTAAGTTGGGGGAGTCAT No data
Right 1015340846 6:132098720-132098742 TAATTAGGACTTAGGATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015340846 Original CRISPR TAATTAGGACTTAGGATGCA TGG Intergenic
No off target data available for this crispr