ID: 1015343637

View in Genome Browser
Species Human (GRCh38)
Location 6:132130696-132130718
Sequence CAGGAAAAGAAGGCAGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015343637_1015343643 0 Left 1015343637 6:132130696-132130718 CCAGCATCTGCCTTCTTTTCCTG No data
Right 1015343643 6:132130719-132130741 TGGAAATAGAACTTACGGGCAGG No data
1015343637_1015343645 17 Left 1015343637 6:132130696-132130718 CCAGCATCTGCCTTCTTTTCCTG No data
Right 1015343645 6:132130736-132130758 GGCAGGAGAAAGGACATATTTGG No data
1015343637_1015343642 -4 Left 1015343637 6:132130696-132130718 CCAGCATCTGCCTTCTTTTCCTG No data
Right 1015343642 6:132130715-132130737 CCTGTGGAAATAGAACTTACGGG No data
1015343637_1015343644 7 Left 1015343637 6:132130696-132130718 CCAGCATCTGCCTTCTTTTCCTG No data
Right 1015343644 6:132130726-132130748 AGAACTTACGGGCAGGAGAAAGG No data
1015343637_1015343640 -5 Left 1015343637 6:132130696-132130718 CCAGCATCTGCCTTCTTTTCCTG No data
Right 1015343640 6:132130714-132130736 TCCTGTGGAAATAGAACTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015343637 Original CRISPR CAGGAAAAGAAGGCAGATGC TGG (reversed) Intergenic
No off target data available for this crispr