ID: 1015353355

View in Genome Browser
Species Human (GRCh38)
Location 6:132248463-132248485
Sequence CAATTCTATAAATCTAATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015353354_1015353355 -8 Left 1015353354 6:132248448-132248470 CCAATAGCTATGACACAATTCTA No data
Right 1015353355 6:132248463-132248485 CAATTCTATAAATCTAATTCTGG No data
1015353351_1015353355 20 Left 1015353351 6:132248420-132248442 CCCTTAGCAGATAATACGGATGC No data
Right 1015353355 6:132248463-132248485 CAATTCTATAAATCTAATTCTGG No data
1015353352_1015353355 19 Left 1015353352 6:132248421-132248443 CCTTAGCAGATAATACGGATGCG No data
Right 1015353355 6:132248463-132248485 CAATTCTATAAATCTAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015353355 Original CRISPR CAATTCTATAAATCTAATTC TGG Intergenic
No off target data available for this crispr