ID: 1015360780

View in Genome Browser
Species Human (GRCh38)
Location 6:132336686-132336708
Sequence CCTCATGTGCTTTAGCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015360780_1015360785 20 Left 1015360780 6:132336686-132336708 CCTGTCAGCTAAAGCACATGAGG 0: 1
1: 0
2: 1
3: 5
4: 112
Right 1015360785 6:132336729-132336751 GTGGGAAAGAGATGAAGAAAAGG No data
1015360780_1015360786 24 Left 1015360780 6:132336686-132336708 CCTGTCAGCTAAAGCACATGAGG 0: 1
1: 0
2: 1
3: 5
4: 112
Right 1015360786 6:132336733-132336755 GAAAGAGATGAAGAAAAGGAAGG 0: 1
1: 3
2: 48
3: 641
4: 4498
1015360780_1015360784 2 Left 1015360780 6:132336686-132336708 CCTGTCAGCTAAAGCACATGAGG 0: 1
1: 0
2: 1
3: 5
4: 112
Right 1015360784 6:132336711-132336733 ATGGCAAGAAGAGATGAAGTGGG No data
1015360780_1015360783 1 Left 1015360780 6:132336686-132336708 CCTGTCAGCTAAAGCACATGAGG 0: 1
1: 0
2: 1
3: 5
4: 112
Right 1015360783 6:132336710-132336732 GATGGCAAGAAGAGATGAAGTGG 0: 1
1: 0
2: 6
3: 40
4: 581

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015360780 Original CRISPR CCTCATGTGCTTTAGCTGAC AGG (reversed) Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
907826929 1:58026917-58026939 GCTCATGTGCAATAGCTGTCAGG - Intronic
909738436 1:78997117-78997139 CCTCCTGTGCTTTATCTCAAAGG - Intronic
917274974 1:173322306-173322328 CCCCATGTGCATTAGCTGTAAGG + Intergenic
920096773 1:203491672-203491694 CCTCCTGTGTTTTGGATGACAGG - Intergenic
921948319 1:220904286-220904308 CATCTTCTGCTTTAGCTGATGGG - Intergenic
922484481 1:225962618-225962640 CTTCAGGTGCTTTTGCTGAACGG + Intergenic
1064218355 10:13418880-13418902 CCTCCTGTCCTTTAGATGAGTGG - Intergenic
1069748477 10:70730890-70730912 GCCCATGTGGTTTAGCAGACAGG + Intronic
1073817937 10:107228094-107228116 CCTCATCTTCTGTAGCTGAAGGG + Intergenic
1074127845 10:110544075-110544097 ACTCATGTGCCTTGGCTCACTGG + Intergenic
1082655577 11:55852642-55852664 CCTCATCTAATTTAGCTGGCTGG + Intergenic
1084211057 11:67622753-67622775 CCTCAAGTGATTTGGGTGACAGG - Intergenic
1086894911 11:92301077-92301099 CCTCATGTGCTTTTGGTGACGGG + Intergenic
1087180202 11:95134533-95134555 CCTCATGTCCATTTGCTGTCTGG + Intergenic
1088688993 11:112309084-112309106 CCAGAGGTGCTTTAGCTGAGTGG + Intergenic
1090797377 11:130146579-130146601 CCTCAGGTGCTGGTGCTGACAGG + Intergenic
1091884884 12:4009458-4009480 CTTGATGTGTTTTTGCTGACAGG + Intergenic
1092085949 12:5760351-5760373 CCTCTTGTGTTTTATCTCACAGG - Intronic
1096721761 12:53528297-53528319 CCTCTTTATCTTTAGCTGACTGG + Intronic
1097714033 12:62946209-62946231 CCTCAGGTGATTTACCTGCCTGG + Intergenic
1100549896 12:95637619-95637641 CCAAATATTCTTTAGCTGACTGG - Intergenic
1104113152 12:125723107-125723129 CCTCTGGGGCTTTAGCTGAATGG + Intergenic
1104692048 12:130833734-130833756 CCTTTTCTGCTTTAGCTGATGGG + Intronic
1115285407 14:31709218-31709240 CCTCAAGTGATTTGGTTGACAGG + Intronic
1119108285 14:71945440-71945462 CCTCATTTCCTTTACCTAACTGG - Intronic
1119206775 14:72800303-72800325 CCTCATTTACTTTACCTGCCTGG + Intronic
1125886900 15:43235974-43235996 CCTCATGTGCTTTCCCAGGCAGG + Intronic
1128930769 15:71703205-71703227 CCTCAGGTGATCTAGCTGCCTGG + Intronic
1129630611 15:77255859-77255881 CCTGATGTGCCTTAGCATACTGG - Intronic
1129728962 15:77918628-77918650 CCTGATGAGCTGTAGCTCACAGG + Intergenic
1131963898 15:97817546-97817568 TTACATGTGCTTTAGGTGACAGG + Intergenic
1132331346 15:101014318-101014340 CCTCATGTTCTTGAGGTTACAGG + Exonic
1134425535 16:14140383-14140405 CCTCAGGTTCTTTATCTAACAGG - Intronic
1139832850 16:69814096-69814118 CCTCAAGTGGTTTAGCTTACTGG - Intronic
1140907659 16:79423045-79423067 CCTCTTGGGCTTTACCTGGCTGG - Intergenic
1142783993 17:2205595-2205617 CCTCTTTTGCTTTGCCTGACAGG - Intronic
1147982649 17:44284051-44284073 CCTCCTGTGATTTAGCAGAGAGG + Intergenic
1151085689 17:71378044-71378066 CATCCTGTGCATTGGCTGACGGG + Intergenic
1152515109 17:80818622-80818644 CCTCATCAGCTTTTGCTCACTGG + Intronic
1152602385 17:81270962-81270984 CCTCATCTGCTTCATCTGCCCGG - Exonic
1159950278 18:74478054-74478076 CCTCAGGTGCTGGAGCTGACAGG - Intergenic
1160088786 18:75806430-75806452 CCTCATGTCCTATACCAGACTGG - Intergenic
1165491504 19:36126063-36126085 CCTCATCTGCTGTAGCTACCAGG + Intergenic
928172381 2:29012016-29012038 CCCCAGGAGCTTTAGCTGTCAGG + Intronic
929882690 2:45850992-45851014 CATCGTGTGCTTTAGCTGTTGGG + Intronic
937925050 2:127161794-127161816 CCTAAAGAGCTTTAGCTTACAGG - Intergenic
940740864 2:157505958-157505980 CTTCATCTGATTTAGATGACAGG - Intergenic
940841969 2:158594211-158594233 CCTCATGTCCTGTTGCTGATGGG + Intronic
944256510 2:197628068-197628090 CCCCATGTGCTTTAGATGTCAGG + Intronic
944897479 2:204179764-204179786 CCTCTTTTGCTTTAGCTGCCTGG - Intergenic
945365061 2:208942426-208942448 ACTGATGTGCTGTAGTTGACCGG + Intergenic
1170268498 20:14497633-14497655 CCTCAAGTGCTTTGACAGACTGG - Intronic
1177832050 21:26149993-26150015 CCTCATGTGCTGAACCTAACAGG - Intronic
1178832410 21:36067468-36067490 CACCATGTGCTATTGCTGACTGG + Intronic
963641304 3:147864066-147864088 CCTCATGGCCTTGAGCTGAAGGG + Intergenic
963970590 3:151425203-151425225 CAGCATATGCTTTCGCTGACGGG + Intronic
964168705 3:153740352-153740374 CTTCATGGGGTTTAGCTGAATGG - Intergenic
966612994 3:181886785-181886807 CCTCACATTCTTTAGCTGTCTGG + Intergenic
967234535 3:187371235-187371257 CCTCTTTTGCCTCAGCTGACTGG - Exonic
967261090 3:187643150-187643172 TCTCATTTCCTTTAGCTGTCAGG - Intergenic
967583646 3:191188153-191188175 CCTCAAGTGATTCAGGTGACAGG - Intergenic
972037356 4:34542958-34542980 CATCAGGTTCTTTAGCAGACTGG - Intergenic
973045890 4:45534169-45534191 CCTCAAGTGATTTGGGTGACAGG - Intergenic
974174528 4:58307070-58307092 CCTCAAGTGATTTGGGTGACAGG - Intergenic
974187345 4:58460813-58460835 CCTCAAGTGATTTGGGTGACTGG - Intergenic
974537166 4:63187352-63187374 CCTCAAGTGATTTGGATGACAGG - Intergenic
982350482 4:154409518-154409540 CCTCCTGAGCCTGAGCTGACAGG + Intronic
983630069 4:169841072-169841094 CCTTATGGTCTTTAGCTGTCAGG + Intergenic
987281124 5:16414649-16414671 CCTGATGGGCTTTGGCTGAAGGG - Intergenic
991096266 5:62743293-62743315 ACTCATTTACTTTAACTGACTGG - Intergenic
991265807 5:64715648-64715670 CCTAAAGTGCTTTAGCAGACAGG + Intronic
995152882 5:108870950-108870972 CCTCACATGCTCTACCTGACTGG - Intronic
995410268 5:111849317-111849339 CCTCAATTTCTTCAGCTGACTGG - Intronic
996942668 5:129027402-129027424 CCACATATGCTTTAGCTTTCAGG + Intronic
999330089 5:150667593-150667615 CAGCATGTGCGTTAACTGACGGG - Intronic
999715621 5:154357730-154357752 CCACATATGCCTTAGCTGCCTGG + Intronic
999911068 5:156199897-156199919 CCTCATGGACTTTAGGTCACTGG + Intronic
1003537321 6:6986750-6986772 CCTTGTGTGCTTTAGTTAACTGG + Intergenic
1006618671 6:35347027-35347049 CCCCAACAGCTTTAGCTGACAGG - Intronic
1007068007 6:39012598-39012620 CCTAATGTGTTTTGGATGACTGG + Exonic
1010269837 6:73906517-73906539 CCTCAAGTGATTTGGGTGACAGG - Intergenic
1011934833 6:92763365-92763387 CCTCATGTGCTGTAACTCTCTGG - Intergenic
1012617443 6:101294049-101294071 GCTGCTGTGCTTTAGCAGACTGG - Intergenic
1013778606 6:113705767-113705789 CTACATGTACTTTAGCTCACAGG + Intergenic
1015360780 6:132336686-132336708 CCTCATGTGCTTTAGCTGACAGG - Intronic
1016397728 6:143643905-143643927 CCTCATGTGATGTTGCTTACTGG + Intronic
1016675921 6:146767848-146767870 CCTCATGAGCTAGAGCTGTCTGG - Intronic
1017704659 6:157111056-157111078 CCCCAGTTGCTTTAGGTGACTGG - Intronic
1018816968 6:167340379-167340401 CCTCATGTGCTTCAGGTGTTTGG - Exonic
1026829854 7:73603815-73603837 CCACATGTGCTTCTACTGACAGG + Intronic
1033307143 7:140232993-140233015 ACTCAAGTGATTTAGATGACTGG + Intergenic
1035270148 7:157714989-157715011 CCCCATGTGCTTTTCCTGAATGG + Intronic
1039974477 8:42349911-42349933 CTTCATGTCTTTTAGCAGACTGG + Intronic
1045227545 8:100264378-100264400 CCTTATGTGCATTACCTGAAAGG - Intronic
1047243791 8:123120057-123120079 CCTTATCTGCATTAGCTCACTGG + Exonic
1048544872 8:135377424-135377446 CCTCATGTGATCTACCTGCCTGG + Intergenic
1049751462 8:144286292-144286314 TGTCCTGTGCTTTAGCTGAGGGG - Intronic
1049751477 8:144286357-144286379 TGTCCTGTGCTTTAGCTGAGGGG - Intronic
1049751494 8:144286422-144286444 TGTCCTGTGCTTTAGCTGAGGGG - Intronic
1049751511 8:144286487-144286509 TGTCCTGTGCTTTAGCTGAGGGG - Intronic
1049751544 8:144286617-144286639 TGTCCTGTGCTTTAGCTGAGGGG - Intronic
1053274965 9:36776342-36776364 CTTCATGTGCATTAACTCACTGG + Intergenic
1053614182 9:39745960-39745982 CTACATGTGCTGTAGCTAACAGG + Intergenic
1053872211 9:42503899-42503921 CTACATGTGCTGTAGCTAACAGG + Intergenic
1053900544 9:42792035-42792057 CTACATGTGCTGTAGCTAACAGG - Intergenic
1054239335 9:62596433-62596455 CTACATGTGCTGTAGCTAACAGG - Intergenic
1054261100 9:62865584-62865606 CTACATGTGCTGTAGCTAACAGG + Intergenic
1054553466 9:66630960-66630982 CTACATGTGCTGTAGCTAACAGG - Intergenic
1055828711 9:80356907-80356929 CCTCATGTGCTCTTGGTGAATGG + Intergenic
1057309050 9:93930262-93930284 CCTCCAGTGCTTTAGCTTCCTGG - Intergenic
1059819032 9:117951247-117951269 CATAATGTGCTTTAGCAGAGCGG - Intergenic
1060697067 9:125718465-125718487 ACTCATTTGCTTGACCTGACAGG + Intergenic
1061450621 9:130665144-130665166 CCTCCTGCGCTTGAGCTGGCGGG + Intronic
1196238861 X:113316741-113316763 CCTGATATACTTTAGCTGCCTGG + Intergenic
1197288639 X:124627187-124627209 CCTCATGTGCCTTAAGTGAGGGG + Intronic
1197610446 X:128632474-128632496 CCTCAAGTGCTTTAGATGGAAGG - Intergenic
1201303597 Y:12531734-12531756 CCTCATGTGGTTTGCCTGCCTGG - Intergenic
1201496391 Y:14594675-14594697 CCTCAAGTGATTCAGGTGACAGG + Intronic