ID: 1015366386

View in Genome Browser
Species Human (GRCh38)
Location 6:132401576-132401598
Sequence CCCTGCAGGCGGCCCGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 532
Summary {0: 1, 1: 0, 2: 6, 3: 59, 4: 466}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015366386_1015366402 21 Left 1015366386 6:132401576-132401598 CCCGCCCCGGGCCGCCTGCAGGG 0: 1
1: 0
2: 6
3: 59
4: 466
Right 1015366402 6:132401620-132401642 CCGTCCCGTTCCGTCCCGTCGGG 0: 1
1: 1
2: 1
3: 9
4: 31
1015366386_1015366394 -4 Left 1015366386 6:132401576-132401598 CCCGCCCCGGGCCGCCTGCAGGG 0: 1
1: 0
2: 6
3: 59
4: 466
Right 1015366394 6:132401595-132401617 AGGGCGCGCCGCGTCCCGTCCGG 0: 1
1: 0
2: 0
3: 6
4: 49
1015366386_1015366400 20 Left 1015366386 6:132401576-132401598 CCCGCCCCGGGCCGCCTGCAGGG 0: 1
1: 0
2: 6
3: 59
4: 466
Right 1015366400 6:132401619-132401641 CCCGTCCCGTTCCGTCCCGTCGG 0: 1
1: 0
2: 1
3: 4
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015366386 Original CRISPR CCCTGCAGGCGGCCCGGGGC GGG (reversed) Intergenic
900001684 1:18018-18040 TCCTGCAGGCGCCCTGGAGCAGG + Intergenic
900021404 1:188541-188563 TCCTGCAGGCGCCCTGGAGCAGG + Intergenic
900151368 1:1180618-1180640 CCCTGCAGGCTGCCCGCCTCTGG - Intronic
900164649 1:1239855-1239877 CCCTGCTGCCTGGCCGGGGCTGG - Intergenic
900330433 1:2131652-2131674 CCCGGCAGCCAGCCAGGGGCAGG + Intronic
900351869 1:2238851-2238873 CCCAGAAGGCAGCCTGGGGCAGG - Intronic
900378883 1:2373896-2373918 CCTTGCAGGTGCCCCGGCGCAGG + Intronic
900418619 1:2546199-2546221 CCCTGCTGGAGGCCGGGGGCGGG + Intergenic
900746826 1:4366302-4366324 CGCTGCAGAGGGCCCGGGGCAGG + Intergenic
901630716 1:10646945-10646967 TCCTGGAGGCGGCCTAGGGCAGG - Intronic
901644374 1:10708848-10708870 GCCTGCAGGCGGCTCGGAGTGGG + Intronic
901762213 1:11478801-11478823 CCCTGCAGACGGTCCGGGCCAGG - Intergenic
901953654 1:12769011-12769033 ACCTGCAGGTGGCCCTGTGCAGG - Intergenic
902246234 1:15122622-15122644 CCCTGCAGGTGGGGCTGGGCAGG + Intergenic
902645868 1:17797550-17797572 CTCTGCAGGCGGACAGGGCCAGG + Intronic
902816021 1:18917259-18917281 CCCACCAGGCCGCCCAGGGCAGG - Intronic
903181732 1:21608358-21608380 CCCTCCTGACGGCCCGGGCCTGG - Intronic
903542639 1:24105566-24105588 CCCCGCAGCCAGCCTGGGGCTGG - Intronic
903658896 1:24965102-24965124 CCCTGGAGGCGGCAAGGGCCTGG + Intronic
904031608 1:27536805-27536827 CCCTCCAAGGGCCCCGGGGCAGG + Intronic
904265535 1:29316672-29316694 CACTGCTGGCGGCCAGGTGCAGG - Intronic
904385731 1:30140792-30140814 CCCTGCCAGCAGCCAGGGGCCGG + Intergenic
904406793 1:30296277-30296299 TCTTGCAGGCAGCCCGGGGGTGG - Intergenic
904542065 1:31239811-31239833 CCCGCCAGCCGCCCCGGGGCAGG - Intergenic
905212758 1:36385788-36385810 CCCTCCCGGGGGGCCGGGGCCGG + Exonic
905365596 1:37449628-37449650 CCCTGCAGGAGGCTCTGGGAAGG - Intergenic
905584350 1:39105340-39105362 CGCTGCAGCCGCGCCGGGGCGGG + Intronic
905971550 1:42145811-42145833 CCCAGCAGCCGGCCGGGCGCTGG - Intergenic
908534684 1:65066870-65066892 CCCTGGACGCGGGCGGGGGCGGG + Intergenic
913449040 1:118979947-118979969 CCTTGGAGGCGCCGCGGGGCCGG - Intronic
915246274 1:154558442-154558464 CCCAGGGGGGGGCCCGGGGCCGG - Exonic
915338924 1:155165938-155165960 CTCTGCAGGGGGCCAGGGGCAGG - Intergenic
915597697 1:156904806-156904828 CCCTGCGAGCGGCCCTGGGAGGG + Exonic
916712843 1:167427147-167427169 CCCTGCAGGCAGCCCTAGGAGGG - Exonic
919977660 1:202623323-202623345 CCCAGCAGGCAGCTCAGGGCTGG - Intronic
920503699 1:206501504-206501526 CACTGCAGTGGGCCCAGGGCTGG + Intergenic
920528340 1:206684909-206684931 CGCGGCCGCCGGCCCGGGGCTGG + Intergenic
921866614 1:220093991-220094013 CCCTGCAGCCGCCGGGGGGCGGG - Intergenic
922360672 1:224818722-224818744 CCCTGCAGTCTTCCCTGGGCTGG + Intergenic
922677459 1:227561496-227561518 CCCAGCTCGCTGCCCGGGGCGGG + Intergenic
922959962 1:229637921-229637943 CAGTGCCGGGGGCCCGGGGCTGG + Exonic
1062816405 10:504333-504355 CCATGCAGGCGTGCCGAGGCTGG + Intronic
1062939182 10:1409148-1409170 CCCCGCATCCAGCCCGGGGCAGG + Intronic
1062939535 10:1411040-1411062 CCCTGCAGGCGCCCTGAGGGAGG - Intronic
1065288693 10:24209097-24209119 CCTGGGAGGGGGCCCGGGGCTGG - Intronic
1067046112 10:42986093-42986115 CCCTGCAAGGGGGCCGGGGATGG - Intergenic
1069873156 10:71545421-71545443 CCCTGCAGGGGACACAGGGCAGG - Intronic
1069943749 10:71972450-71972472 ACCTGCCGGCTGCCCTGGGCAGG + Intronic
1070129677 10:73647762-73647784 TCCTGCAGGAGGCCCGGCGCCGG - Exonic
1070198104 10:74177195-74177217 CCCCGGGGGCGGCCCAGGGCCGG + Intronic
1070257712 10:74825829-74825851 GCCTGCACCCGGCCTGGGGCTGG + Intronic
1070931767 10:80266009-80266031 CCCTGGAGGAGGCCAGGGCCAGG + Intergenic
1071568615 10:86684427-86684449 CTCTGCAGGGGGCCCTGGGCTGG + Intronic
1071573822 10:86711786-86711808 CCCTGCGCGCGGGCCGGGGACGG + Intronic
1072637201 10:97185729-97185751 ACCTGGAGGCGGCCCCGGACGGG - Exonic
1072640441 10:97207303-97207325 CCCTGCTGGCTCCCCAGGGCGGG + Intronic
1072763906 10:98080816-98080838 CCCTGCCTGGGGCCTGGGGCTGG + Intergenic
1073207415 10:101776272-101776294 GCCTGGATGCAGCCCGGGGCGGG + Intronic
1073550255 10:104393542-104393564 CACTGAAGGCAGCCAGGGGCAGG + Intronic
1074555320 10:114483990-114484012 CCCTGCAGGATGCCCCGGGCAGG + Intronic
1074801514 10:117005281-117005303 ACCTGCAGGCGGGGCGGGGCGGG + Exonic
1075040635 10:119104399-119104421 CCCCACAGGCGGCCGCGGGCGGG - Intronic
1075722460 10:124595279-124595301 CCCAGCAGGCTGCCAGGGGGAGG + Intronic
1075849130 10:125573478-125573500 CCCTGCAGACCCCCAGGGGCTGG + Intergenic
1076338807 10:129728655-129728677 ACCTGCAGGCGGGCAGTGGCGGG - Intronic
1077063298 11:626988-627010 CCCTGCGGGCGGTCGGGGGTCGG + Exonic
1077227184 11:1443468-1443490 CCCTGCGGGCGGCCGGGTGTGGG - Exonic
1077285457 11:1763487-1763509 CCCTGGAGACGGGGCGGGGCGGG - Intronic
1077529442 11:3088275-3088297 CTCTGCAGGAGGCCTGGGGTCGG + Exonic
1078216319 11:9314725-9314747 TCCCGCGGGCGGGCCGGGGCGGG - Exonic
1078476226 11:11632690-11632712 ACCTGCAGCCAGCCCAGGGCAGG - Intergenic
1079136599 11:17779140-17779162 CCCTGCTTGGGGCCCGGGGCCGG + Intronic
1079373607 11:19872711-19872733 TCCAGCAGGCGGGTCGGGGCAGG - Intronic
1080606668 11:33869763-33869785 CCCCGCGGGCGGCGCGGAGCCGG - Exonic
1081710478 11:45212644-45212666 TCCTGCAGGCAGCCTGGGCCTGG - Intronic
1081845789 11:46239300-46239322 CTCTGCCGGCCGCGCGGGGCAGG - Intergenic
1081863439 11:46347246-46347268 CCATCCAGGCGGGCCGGGCCGGG + Intronic
1081870875 11:46381991-46382013 CCCTGCACGCGGCCCCCGGTGGG + Intronic
1083610209 11:64000734-64000756 CCCTGCAGCGCGCCCGGGACAGG - Intronic
1083920887 11:65780970-65780992 CCGGGCTGGCGGCGCGGGGCGGG + Intergenic
1083959604 11:66007281-66007303 CTCAGCAGGCTGCCGGGGGCAGG - Intergenic
1084004807 11:66317096-66317118 TCCTGCGGGCGGGCCGGGGGCGG + Intergenic
1084039034 11:66531007-66531029 CCTTGAAGAAGGCCCGGGGCAGG - Exonic
1084165448 11:67373042-67373064 CCCTCCCGGCGGGCCGGGGAGGG + Intronic
1084267151 11:68010906-68010928 TCCTGCAGGCGGGGCGGGGCTGG - Intronic
1084386225 11:68844079-68844101 ACCTGCAGGCCGGGCGGGGCAGG + Intronic
1085312786 11:75526014-75526036 GCCCGCAGCCGGCCGGGGGCGGG - Intergenic
1085400403 11:76232512-76232534 TCCTGCAGGCAGCCCCGCGCGGG - Intergenic
1088889276 11:114032004-114032026 CCCAGCAGGCTGCCAGGGCCAGG - Intergenic
1089332065 11:117696568-117696590 CCCTGCAGGCCCCCCAGGGTGGG + Intronic
1089496382 11:118910408-118910430 CCGTGGAGGGGGCCCGGGGTTGG + Exonic
1090435540 11:126683907-126683929 CCCTGAAGGGGGACCTGGGCAGG - Intronic
1090635076 11:128686074-128686096 CCCTGCTGGTGGCCCGGGGACGG - Intergenic
1090647152 11:128775540-128775562 GCCTGCAGGAGGCCATGGGCTGG + Intronic
1091243298 11:134069368-134069390 CCCGGCAGTTGGACCGGGGCGGG + Intronic
1091558727 12:1594589-1594611 GAGTGCGGGCGGCCCGGGGCTGG - Intronic
1091915421 12:4269492-4269514 CCCTCCAGGCGCCCCCGGGAGGG - Intergenic
1094839640 12:34337536-34337558 CCCTTTAGGCGGCCCGACGCAGG - Intergenic
1096714589 12:53483415-53483437 CCATGCAGGAGGCCCCGGGAAGG + Exonic
1097990260 12:65825591-65825613 CGCGGCGGGCGGCCCGGGGAAGG + Intronic
1103044497 12:117724583-117724605 AACTGCAGGCGGCCGGGGGTGGG - Intronic
1103737142 12:123067848-123067870 TCCTGCAGGGTGCCCGGAGCAGG - Intronic
1103794248 12:123492402-123492424 GCCTGCTGGTGGCCAGGGGCTGG + Intronic
1104599494 12:130142837-130142859 CCCTGCAGGTGCCCCGGCCCAGG - Intergenic
1104941485 12:132397503-132397525 CCCAGGAGGGGGCCCGGGGAGGG - Intergenic
1106303909 13:28494318-28494340 CCTGCCAGGCTGCCCGGGGCTGG - Intronic
1106735786 13:32586769-32586791 GCCTGGCGGTGGCCCGGGGCGGG + Intronic
1107560304 13:41551938-41551960 CCCTGCAGGCTCCCAGGGGCAGG + Intergenic
1108593958 13:51934728-51934750 TCAGGCAGGCGGGCCGGGGCAGG - Exonic
1111672664 13:91348701-91348723 CCCAGCAAGCGGCCGGGCGCAGG - Intergenic
1113952327 13:114078967-114078989 CCCTGCAGGCATCCTGGGGAGGG + Intronic
1114537153 14:23430248-23430270 CCATGCAGACGGCATGGGGCTGG - Intronic
1114665047 14:24372709-24372731 CCCTGCAGGCAGCCTGGGGGAGG + Intronic
1116821950 14:49634827-49634849 CCCAGCAGCCGGCCCGGCTCCGG - Exonic
1118836760 14:69483794-69483816 CCTGGCAGGTGGCGCGGGGCAGG + Intergenic
1119851683 14:77870873-77870895 CCCTGCAGGCCACTCAGGGCTGG + Intronic
1120942013 14:89957876-89957898 TCCTGCAGCCAGCCCAGGGCTGG - Intronic
1120993362 14:90397563-90397585 CGCTGCAGGCAGCCCGGGTGCGG - Intronic
1121121690 14:91379756-91379778 CCCCGCAGGAGGCCCGGGCACGG - Intronic
1121449527 14:93998454-93998476 GCCTGCAGAGGGCCCGGGACTGG - Intergenic
1122130864 14:99604075-99604097 CGCGCCAGGCGGCGCGGGGCGGG - Intergenic
1122131269 14:99605363-99605385 GCCAGCAGGCGGGGCGGGGCGGG + Intergenic
1122179185 14:99943361-99943383 CCATGTAGGCGCCCCAGGGCAGG - Intergenic
1122353311 14:101109872-101109894 CCCTGCTTGGGGCCAGGGGCTGG + Intergenic
1122491130 14:102116851-102116873 GCTTGCAGGCAGCCTGGGGCAGG - Intronic
1122634349 14:103123236-103123258 CCCAGCAGCCGGGCAGGGGCGGG - Intergenic
1122771490 14:104099826-104099848 CCCTGGAGCCTCCCCGGGGCTGG - Intronic
1122798485 14:104218183-104218205 CACTTCAGGGGGCCCAGGGCTGG - Intergenic
1122814119 14:104303929-104303951 CTCTGCAAGCTGCCCGGGTCTGG + Intergenic
1122883304 14:104699698-104699720 CCCTGCAGGGGGTCCTGGTCTGG - Intronic
1122941988 14:104985650-104985672 CAGCGGAGGCGGCCCGGGGCAGG + Intergenic
1123032225 14:105457341-105457363 GCCTGCAGTCGGCCAGGGCCAGG - Intronic
1123119160 14:105909001-105909023 TCCTGCAGGGGGCCCGGGCAAGG + Intergenic
1124493310 15:30171687-30171709 CCCAGCAGGCAGCTCAGGGCTGG - Intergenic
1124750224 15:32366638-32366660 CCCAGCAGGCAGCTCAGGGCTGG + Intergenic
1127464090 15:59227013-59227035 CCCTGCAGGCAGGCTGAGGCCGG + Intronic
1128309643 15:66622215-66622237 CCCAGCCGGCAGCCCGGGGGCGG - Intronic
1129457382 15:75683099-75683121 CCCTGGTGGCAGCCCAGGGCCGG - Intronic
1129667585 15:77588192-77588214 CCCTGAGGGAGGCCAGGGGCTGG - Intergenic
1129842605 15:78753018-78753040 CACAGCAGGTGGCCTGGGGCAGG - Intergenic
1130274444 15:82469194-82469216 CCCTGGTGGCAGCCCAGGGCCGG + Intergenic
1130353087 15:83108064-83108086 CCCTGGAGGGGCCCAGGGGCCGG + Intronic
1130466791 15:84196568-84196590 CCCTGGTGGCAGCCCAGGGCCGG + Intergenic
1130497473 15:84476968-84476990 CCCTGGTGGCAGCCCAGGGCCGG - Intergenic
1130589086 15:85201161-85201183 CCCTGGTGGCAGCCCAGGGCCGG + Intergenic
1131184778 15:90265256-90265278 CCCTAGGTGCGGCCCGGGGCTGG + Intronic
1132498213 16:273725-273747 GCCTGCAGGCGGGGCGGGGCAGG + Intronic
1132536287 16:482745-482767 CTCTCCAGGAGGCCCGTGGCGGG - Intronic
1132552354 16:558839-558861 CCGTGCAGGCAGCTCCGGGCCGG - Intergenic
1132570639 16:642454-642476 CCCCGCTGGGGGCCCGGGCCCGG - Intronic
1132583540 16:695922-695944 ACCTGCAGGCGGGCGGGCGCCGG + Exonic
1132656689 16:1044472-1044494 CCCCCCAGGCGGCCCCGGGCGGG - Intergenic
1132658201 16:1049970-1049992 CCCTGGAGGCAGCCCTGGGGAGG + Intergenic
1132758436 16:1497186-1497208 CCCTGCAGAGGGCCAGGGTCAGG - Intronic
1133038397 16:3046888-3046910 CCCCGCCGGCGGCCCGGGCTGGG + Exonic
1134218177 16:12332675-12332697 CCCTGGTGGCGGCCAGGGGCTGG - Intronic
1134441559 16:14302186-14302208 CCCTATGGCCGGCCCGGGGCGGG - Intergenic
1134628135 16:15737448-15737470 AGCTGCAGGCGGCCCTGGCCAGG - Exonic
1134644722 16:15857132-15857154 CCCTGCAGGGGGCGCGGCGAGGG - Intergenic
1135115211 16:19718120-19718142 CGTTGCAGGCGGGCCGGCGCGGG - Exonic
1136548098 16:30966510-30966532 CCCTGCAGGCCACCCTGGGTGGG + Intronic
1138534801 16:57654123-57654145 CCCGGCAGGAGGTCAGGGGCAGG + Exonic
1138561327 16:57802420-57802442 TCCTGCCGGCGGGCCGGGCCGGG - Exonic
1138591146 16:58000400-58000422 CCCTGCAGGCGGCCTGGAGCAGG - Intronic
1138606823 16:58095050-58095072 CCCCGCAGGCAGTCCGAGGCTGG + Intergenic
1138659263 16:58508086-58508108 CCCTGGAGGCTCCCCTGGGCTGG - Intronic
1139913748 16:70415373-70415395 CCCTCCGGGCGGCACGGGGAAGG + Intronic
1140033870 16:71358655-71358677 CCCTTCTGGCGGCCGGGCGCAGG + Intergenic
1140065941 16:71611202-71611224 GCCTGCAGGGGGCCCAGAGCTGG - Intergenic
1141831630 16:86512480-86512502 CCCTGCTGCTGGCCCGGCGCTGG + Intronic
1142120108 16:88382992-88383014 CCCAGCACCCGGCCCAGGGCTGG + Intergenic
1142136229 16:88453184-88453206 CCCGGCAGGAGGCACGGGGCGGG + Intergenic
1142256433 16:89015829-89015851 CCCTGCACCCTGCCCGGGGCTGG + Intergenic
1142427667 16:90009298-90009320 ACCTGCAGGAGCCCCGGTGCTGG + Exonic
1142638294 17:1271012-1271034 CCCTGCAGGCGGCGGGGGGCTGG - Exonic
1143364316 17:6396023-6396045 CCCTGCTGGCCGCCTTGGGCAGG - Intronic
1143476021 17:7204487-7204509 ACATGCAGGGGGCCCCGGGCTGG - Intronic
1143560015 17:7688181-7688203 CTCTGCAGGCGGCGGGGGGGCGG + Exonic
1144020948 17:11240257-11240279 CTCTGCAGCCGGCCCGCGGCAGG - Intergenic
1144445487 17:15323385-15323407 CCCTGCAGCCTGCCCTGGTCTGG - Intronic
1144784377 17:17823688-17823710 ACCTGCAGGCGGGGCGGGGCTGG - Intronic
1145264337 17:21372382-21372404 CCAGGCAGGCGGCCAGGGTCTGG - Intergenic
1146062762 17:29615700-29615722 CCAGGCAGGCGGAGCGGGGCGGG - Exonic
1146947887 17:36886113-36886135 CCCTGCAGGTGGCCAGGGGGAGG + Intergenic
1147132480 17:38417727-38417749 CCCTGCTGGCTGCCTGGGGAGGG - Intergenic
1147339547 17:39745513-39745535 CCCTGGAGGAGGCCCAGGCCTGG + Exonic
1147587832 17:41662821-41662843 CCCTGCCGGTGGTCCGGGGCTGG + Intergenic
1147625428 17:41896926-41896948 CCCTGCAGAGGGCCTGGGGGAGG - Intronic
1147664245 17:42135978-42136000 ACCTGCAGGGGACCCTGGGCGGG - Intronic
1148225468 17:45895636-45895658 CCCTGCCGGAGGCGCGGGGCTGG + Intronic
1148807698 17:50272536-50272558 CCCTGCAGGTGGACCTTGGCAGG - Intronic
1149036734 17:52142686-52142708 CCCTGCAGGCAGCCCTAGGAGGG + Intronic
1149891162 17:60391822-60391844 CCCTCCAGGCTGCCCGTCGCGGG + Intronic
1149993961 17:61397308-61397330 CCTCGCGGGCCGCCCGGGGCTGG - Intergenic
1150125407 17:62631708-62631730 CACTGCAGGCGGCTCGGTCCAGG - Intronic
1150295797 17:64006721-64006743 CCCTCCAGGCAGCCCTTGGCTGG - Exonic
1151761138 17:76103785-76103807 CCGCCCAGGCGTCCCGGGGCGGG - Intronic
1151826070 17:76525143-76525165 TCCTGCAGCCCACCCGGGGCTGG + Intergenic
1151852961 17:76701751-76701773 CGCAGCAGTCGGCCCTGGGCAGG - Intronic
1151901114 17:77015921-77015943 ATCTGGAGGTGGCCCGGGGCTGG + Intergenic
1151926416 17:77200861-77200883 CCTTCCTGGCTGCCCGGGGCGGG - Intronic
1152319596 17:79601052-79601074 CTCCGCAGGGGCCCCGGGGCGGG - Intergenic
1152468428 17:80477939-80477961 CCCTGCGCGCAGCCGGGGGCTGG + Intergenic
1152565019 17:81096485-81096507 CCCTGCGGGAGGAGCGGGGCAGG + Intronic
1152617815 17:81345971-81345993 CCGGGCAGGAGCCCCGGGGCGGG + Intergenic
1152904102 17:82961019-82961041 CCTCTCAGGCGTCCCGGGGCCGG + Intronic
1154165108 18:12008901-12008923 CTCTGCAGCAGGCCCTGGGCTGG - Intronic
1157549233 18:48569815-48569837 CCAGGCAGGGGGCCAGGGGCTGG - Intronic
1159798225 18:72868200-72868222 CGCGGCCGGCGCCCCGGGGCTGG + Intergenic
1160517528 18:79486763-79486785 TGCTGCGGGCGGCCCGTGGCGGG - Exonic
1160750164 19:730195-730217 CCCTCCAGGCGGCTGTGGGCTGG + Intronic
1160766851 19:812641-812663 CCACGCGGGCGGCCTGGGGCTGG - Exonic
1160847320 19:1172340-1172362 CTCTGAAGGTGGCCCGGAGCAGG + Intronic
1160935419 19:1592427-1592449 CCCAGGCCGCGGCCCGGGGCAGG + Intronic
1160979990 19:1812342-1812364 CCCGGAAGGGGGCCGGGGGCGGG + Intergenic
1160986761 19:1842742-1842764 CCCGGCAAGCGGCCTGGTGCCGG + Intronic
1161024955 19:2032503-2032525 CCTGGCAGGCGGCCGGGGGCAGG + Intronic
1161028259 19:2046517-2046539 CCCTGCAGGGGGGTGGGGGCCGG - Intronic
1161153534 19:2721285-2721307 CCAGGTAGGCGGCCCGGGGCGGG - Exonic
1161438795 19:4279273-4279295 CCCGGGACGCGGCCCGGGGCTGG + Exonic
1161959572 19:7516258-7516280 CCCTGCGAGCGGGCTGGGGCCGG + Intronic
1162020726 19:7867264-7867286 CCATGCAGGAGACCCGGGGGAGG + Intergenic
1162423791 19:10581715-10581737 CCCTGGAGGCAGCCATGGGCTGG - Intronic
1162445224 19:10718575-10718597 CCCTGCAGGGGCTCCGGAGCAGG + Intronic
1162524243 19:11197931-11197953 TCCCCCAGGCGGCCCAGGGCTGG + Intergenic
1162760516 19:12885863-12885885 ATATGCTGGCGGCCCGGGGCTGG - Exonic
1162914134 19:13865353-13865375 CCGTGCAGGCGCCTCGGGCCCGG + Intronic
1164719474 19:30421837-30421859 GCCTGCAGCCGGCCCTGGCCTGG - Intronic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165420064 19:35718084-35718106 CCCCGCCGGCGCCCCGCGGCCGG - Exonic
1165424748 19:35739682-35739704 TCCTGGAGGAGCCCCGGGGCAGG - Intronic
1165432644 19:35781309-35781331 CCCAGCATGCAGCACGGGGCTGG - Intronic
1165782768 19:38443550-38443572 CCCTGCAGTCATCCCAGGGCGGG + Exonic
1165792894 19:38502720-38502742 CTCTGCAGGTGGAGCGGGGCAGG + Exonic
1165956487 19:39504667-39504689 TCCTGGAGGTGGCCCGGGGCTGG + Intronic
1166043611 19:40217197-40217219 ACCTGCAGGAGGCCCGCAGCCGG - Exonic
1166391372 19:42410656-42410678 CCCAGCAGGCGGCCCAGGGCCGG + Exonic
1166705023 19:44903761-44903783 CCCTGCAGGCGGCTGGGGGAAGG - Intergenic
1166723681 19:45012282-45012304 CCCGGCGAGCGGCCCCGGGCGGG + Intronic
1166790676 19:45396748-45396770 CCCTGCTGGCGGAGCGGGCCTGG + Exonic
1166790684 19:45396766-45396788 CCCTCCCCGCGGCCCGGGCCAGG - Exonic
1166936236 19:46334926-46334948 TCCTGCAGGCTCCCTGGGGCTGG - Exonic
1167037378 19:47002278-47002300 CACTGCAGGCGGGCACGGGCAGG - Exonic
1167292021 19:48629743-48629765 GCCTCCTGGCTGCCCGGGGCGGG + Exonic
1167300460 19:48674619-48674641 CCCTGCGGGTGCCCGGGGGCAGG + Intergenic
1167509909 19:49890599-49890621 ACCTGCAGGCGGGGCGGGGCGGG + Exonic
1167642158 19:50687852-50687874 CCCTGCGGGAGCCCCAGGGCTGG - Intronic
1168124709 19:54277108-54277130 CCTGGCTGGGGGCCCGGGGCAGG - Intronic
925068907 2:951014-951036 CGCGGGAGGCGGCCGGGGGCGGG - Exonic
925158772 2:1667039-1667061 CCCTGCAGGTGGGCTGGGCCAGG - Intronic
925361267 2:3282208-3282230 ACCTGACGGTGGCCCGGGGCTGG - Intronic
925428594 2:3771792-3771814 CCCAGCAGGCAGCACGGGCCAGG - Intronic
926018486 2:9474673-9474695 CCCCGCAGGGAGGCCGGGGCGGG - Intronic
926140791 2:10366723-10366745 CAATGCAGGAAGCCCGGGGCTGG - Intronic
926580829 2:14632278-14632300 CACTGCGAGCGGCCCGGGGCAGG - Intergenic
927214099 2:20656734-20656756 GCCTGGAGGAGGCCCAGGGCAGG + Intergenic
927698449 2:25252533-25252555 CCCTGCAGCCCGGCCTGGGCGGG - Intronic
927919598 2:26961764-26961786 GCCTGGAGGTGGCCAGGGGCAGG - Intergenic
928136042 2:28688165-28688187 CACTGCACCTGGCCCGGGGCAGG - Intergenic
928511724 2:32009967-32009989 CCGCGCCGGCAGCCCGGGGCCGG - Intronic
929118588 2:38465431-38465453 CCCTGCAGGCCACCAGGGGCAGG - Intergenic
929242164 2:39665194-39665216 TCCTGCAGGCGGCAGGCGGCAGG + Intronic
929575150 2:43046746-43046768 CCCTGCAGAGGGCCCCAGGCTGG - Intergenic
931309603 2:61065884-61065906 GCCTGCAAGCGGGCGGGGGCGGG + Intronic
932088967 2:68787965-68787987 CCCTGCAGGCTTTCCTGGGCAGG + Intronic
932416507 2:71576655-71576677 CCTGCCAGGCGGCCCAGGGCAGG + Intronic
934952131 2:98583920-98583942 CACTGCAGGCTCCCTGGGGCAGG + Intronic
935349650 2:102142562-102142584 CCCTGCGGGCTACCCGGGGCAGG + Intronic
936067225 2:109341836-109341858 GCCTGCAGGCAGCCCTGGGTAGG - Intronic
936165360 2:110115651-110115673 CTCTGCAGGTGGCCCGGGTCGGG + Intronic
936566060 2:113583718-113583740 CCCTGGGTGCGCCCCGGGGCAGG - Intergenic
937903752 2:127041636-127041658 CCCTGCAGGTCACACGGGGCAGG + Intergenic
937916002 2:127099016-127099038 CCCTCCAGGGTGGCCGGGGCAGG + Intronic
940775128 2:157876495-157876517 GCCTGCAGGGGGCGCGGGGACGG - Intergenic
941508425 2:166376084-166376106 TCCTGCGGGCGGCGCAGGGCGGG + Intergenic
944242407 2:197499487-197499509 CCCTGAAGTCGGCCAGGCGCAGG + Intronic
944897239 2:204177760-204177782 CCCAGCAGGCAGCCCGAGGGAGG - Intergenic
946747482 2:222860883-222860905 CGGCGCTGGCGGCCCGGGGCGGG - Intergenic
947353558 2:229271012-229271034 ACCTGCAGGCGCTCCGTGGCCGG + Exonic
947727147 2:232407949-232407971 CCCTCCTGGCGGGCCGAGGCAGG - Exonic
947749380 2:232524730-232524752 TCCTCCAGGCTGCCCTGGGCTGG + Exonic
947749394 2:232524777-232524799 CCCTGCAGGGGGCCCATGCCTGG + Exonic
948389198 2:237599936-237599958 CTCTCCAGGCTGCTCGGGGCAGG - Intronic
948465879 2:238151402-238151424 CCCTGCTGGGGTCCAGGGGCAGG - Exonic
948560150 2:238847027-238847049 CCGTCCAGATGGCCCGGGGCCGG + Intergenic
948778768 2:240304289-240304311 CCCTGCAAGTGGCTCAGGGCTGG + Intergenic
948909023 2:240993800-240993822 CCGTGCAGGCAGGCCTGGGCTGG - Intergenic
948920909 2:241065486-241065508 CCCTGCCGGCCGCCAGGGCCTGG - Exonic
1169199917 20:3703903-3703925 CGCTCCAGGCTGCCTGGGGCAGG + Exonic
1169220623 20:3820357-3820379 CCCTGCCGGCAGCTCGGGGCCGG + Intergenic
1169382389 20:5119532-5119554 AGGTGCAGGCGGGCCGGGGCCGG + Intronic
1170557953 20:17530889-17530911 CCGTCCCGGCGGCGCGGGGCTGG - Intronic
1170738105 20:19028031-19028053 CCCAACAGGCAGCCCGGGTCGGG + Intergenic
1171034213 20:21703338-21703360 CCGTGAAGGCCGCCCGTGGCTGG - Intergenic
1171342782 20:24443733-24443755 CCCAGCAGGCAGCCTGGGCCTGG + Intergenic
1171431351 20:25084832-25084854 TCCTGGGGGCCGCCCGGGGCGGG - Intergenic
1171968332 20:31547418-31547440 CCCTGCAGGAAGGCCGGCGCGGG - Intronic
1172033016 20:31994987-31995009 GCCTGTGGGCGGCTCGGGGCTGG + Intronic
1172132274 20:32663871-32663893 CCCTCCAGAGGGCCCCGGGCAGG - Intergenic
1172277108 20:33685906-33685928 GCCTGGAGGCGGCAGGGGGCGGG - Intronic
1172778064 20:37419758-37419780 CCCTGCTGGGGGCCCTGGGAGGG + Intergenic
1173279838 20:41618250-41618272 CCCGGCCGGCGGGGCGGGGCCGG + Intronic
1173280066 20:41619117-41619139 CGCTGCAGGGTCCCCGGGGCTGG - Intergenic
1173575852 20:44112660-44112682 ACCTGCAGGAGGCCTGGGGCCGG - Exonic
1173939139 20:46895007-46895029 CCCGGCGGGCGGCCTGGGGTGGG - Intronic
1174246926 20:49188394-49188416 GCCTGGAGGCGGGCGGGGGCCGG - Intergenic
1174287726 20:49484076-49484098 GGCTGCAGGCGCCGCGGGGCCGG + Intergenic
1174402613 20:50283998-50284020 CCCTGCAGGGAGCCAGGGGCCGG - Intergenic
1174736897 20:52973238-52973260 CCCAGCGCGCGGCTCGGGGCTGG + Exonic
1176096458 20:63346663-63346685 CCATGCGGCCGGCCTGGGGCCGG - Exonic
1176113808 20:63422464-63422486 CCCAGGAGGAGGGCCGGGGCGGG + Intronic
1176167284 20:63680883-63680905 CCCTGCAGGAGGCCCAGTGTGGG - Intronic
1176173627 20:63707659-63707681 ACCTGGAGGCGGCGCGCGGCTGG + Intronic
1176178686 20:63739924-63739946 CCCGGCCGGCGGCGCGGGGCGGG - Exonic
1176194399 20:63830835-63830857 CCAGGCCGGCGGCGCGGGGCGGG - Intronic
1176205875 20:63887864-63887886 CACTGCAGGCAGCCAGGGTCAGG - Intronic
1176299054 21:5090056-5090078 CCCAGAAGGCTGCCCTGGGCCGG + Intergenic
1176426928 21:6553690-6553712 TCCTGCAGGCTGTCCCGGGCAGG + Intergenic
1176550273 21:8217868-8217890 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
1176566765 21:8392109-8392131 CCCCGCCGGCGGCGCGGCGCAGG - Intergenic
1176569201 21:8400906-8400928 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
1176577115 21:8445138-8445160 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
1178249718 21:30990776-30990798 CCCAGCAGGGGGAGCGGGGCTGG + Intergenic
1178334650 21:31732218-31732240 CCCTGCACGCGGGGCGGTGCAGG - Intergenic
1178544322 21:33480183-33480205 CTCTGCAGGCCTCCCGGAGCCGG + Intergenic
1178922479 21:36747770-36747792 CCCGCCAGGCCGCCCGGGACGGG + Exonic
1179010585 21:37553042-37553064 CCCTCGAGGCGGCCTGGGCCTGG + Intergenic
1179477034 21:41653615-41653637 CCCAGCAGGCTGCCCAGGGAAGG + Intergenic
1179702419 21:43162012-43162034 TCCTGCAGGCTGTCCCGGGCAGG + Intronic
1179857971 21:44171892-44171914 CCCAGAAGGCTGCCCTGGGCCGG - Intergenic
1179880230 21:44290548-44290570 CCCTGCAGGAGCACCCGGGCTGG + Intronic
1179893747 21:44350430-44350452 CCCTGCAGCAGCACCGGGGCCGG - Intronic
1180014968 21:45075499-45075521 CGCCGCGGGCGGCCCGGGCCAGG + Intronic
1180559167 22:16601783-16601805 TGCTGCGGGCGGCCCGGGGGAGG + Intergenic
1180699704 22:17774533-17774555 CCCCGCAAGCCGCCGGGGGCGGG - Intronic
1180950379 22:19718193-19718215 TCCTGCACGCGGGCCGGGGCGGG - Intronic
1180998699 22:19977976-19977998 CCCTGCAGTCGGCTGTGGGCCGG - Exonic
1181031959 22:20152608-20152630 CCCTGCAGGAGGCCTGGGCTGGG + Intergenic
1181060573 22:20280331-20280353 CTCTCCTGGCGGGCCGGGGCGGG - Intronic
1181085512 22:20437747-20437769 CCCTCCATGAGGCGCGGGGCAGG + Exonic
1181574874 22:23787300-23787322 CCCCGCGGGAGCCCCGGGGCGGG + Intronic
1181585206 22:23849358-23849380 CCACGCAGGCGGGCCGAGGCCGG + Intergenic
1182301723 22:29340765-29340787 CCCAGCAGGTCGCCCTGGGCGGG + Exonic
1182550188 22:31096760-31096782 GGCTGCAGGAGGCACGGGGCCGG + Exonic
1183414907 22:37676436-37676458 CCCTGCAGTCGGGCTGTGGCTGG - Intronic
1183486232 22:38089064-38089086 CCCTCCTGCCGCCCCGGGGCGGG + Intronic
1183739536 22:39662291-39662313 CCCTCCAGGCGGCCCGGGGGTGG - Exonic
1184017926 22:41800035-41800057 CCCGGCAGGGGCCCCGGGCCCGG + Intergenic
1184472667 22:44704529-44704551 CCCTGCAGGTGCCGCGGGGAGGG - Intronic
1184692389 22:46123186-46123208 CTCTGCAGGCGGCCCTGGTGGGG - Intergenic
1184784676 22:46665925-46665947 CTCTGCTGGCCGCCCGGGGAAGG - Intronic
1184820376 22:46905527-46905549 CCCTGCAGCCGGCCCCGGGGAGG + Intronic
1185102547 22:48849388-48849410 GCCTCCAGGCTGTCCGGGGCTGG + Intronic
1185274245 22:49943576-49943598 CCCCGCAGGAGGCCCTGGGTAGG + Intergenic
1185317176 22:50184278-50184300 CCCTGCAGGCCACCCGAGCCGGG + Intergenic
1203255168 22_KI270733v1_random:134206-134228 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
1203263224 22_KI270733v1_random:179285-179307 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
949105776 3:198098-198120 CCCTGCTGGCCGTCTGGGGCGGG - Intronic
950428260 3:12936227-12936249 CCCTGGATGCGGCGCGGGCCCGG - Exonic
950495170 3:13329353-13329375 CCCTGCAGGCCACCAGGGGAAGG + Intronic
950707382 3:14791523-14791545 CCCTGCAAGCGGGACGGGTCTGG - Intergenic
951611325 3:24495099-24495121 CCCGGGAAGCGGGCCGGGGCGGG - Intronic
951695291 3:25440203-25440225 CACTTCAGGAGGCCCGAGGCAGG + Intronic
952744539 3:36764551-36764573 CCCTGGAGGCCGGGCGGGGCCGG + Intergenic
953414650 3:42708760-42708782 CACTGCAGGAGACCCTGGGCTGG - Exonic
954367439 3:50154191-50154213 CTCCGCAGGGTGCCCGGGGCAGG + Intergenic
954617327 3:51975963-51975985 CCCCGCAGGCGGCCAGCTGCAGG + Intronic
954712548 3:52512331-52512353 CCCGGCAGGTGGCCTGGGGTGGG - Exonic
954849494 3:53588370-53588392 CCCTGCTTGTGGCCTGGGGCTGG + Intronic
955060832 3:55489992-55490014 CCCTGCCCGCGGGGCGGGGCTGG - Intergenic
956675102 3:71725501-71725523 CCCTGAAGGCGGCGGGCGGCGGG - Intronic
957193508 3:77039744-77039766 GCCTGGAGTCGGCCCGGGGAGGG - Intronic
959117006 3:102190480-102190502 TCCTGCAGGCACCCAGGGGCTGG - Intronic
961359422 3:126357562-126357584 CCGCGCGGGCGGGCCGGGGCGGG - Intergenic
961634038 3:128321726-128321748 CCCAGCAGGCAGCCCAGTGCTGG - Intronic
961654282 3:128432916-128432938 CCCCGCAGGTGGCGCGGGGGAGG - Intergenic
962325889 3:134431956-134431978 CTCAGCAGGCTGCCCGGTGCTGG + Intergenic
962826667 3:139105472-139105494 CCCTGGAAGCAGCCCCGGGCTGG + Intronic
965229274 3:166029538-166029560 GCCTGCAGGTGCCCCTGGGCAGG - Intergenic
965590412 3:170356934-170356956 CCCTGCAGGGCCCCCGGGGCCGG - Intergenic
966815677 3:183887891-183887913 CCCTGAAGGCTGCCTGGGTCTGG - Intergenic
966915832 3:184583721-184583743 CGCCGCAGCCGGCCCGGGGGAGG + Intronic
968585439 4:1414209-1414231 CCCTGCGGGCGGCCCCAAGCAGG - Intergenic
968589235 4:1449498-1449520 CCCTGCAGGCTGATCTGGGCTGG + Intergenic
968685037 4:1952302-1952324 CTCTGCAGGCAGCTCAGGGCAGG - Intronic
969368655 4:6716417-6716439 GCCTGCCTGCTGCCCGGGGCCGG + Exonic
969376640 4:6767763-6767785 CCCTGCCGCCCGCCCGGGCCAGG + Intergenic
969716472 4:8870567-8870589 CGCTGCAGACAGCCTGGGGCAGG - Intronic
972321574 4:37977415-37977437 GCCCGCGGGCGGCCGGGGGCGGG - Intronic
972418770 4:38867772-38867794 CCCTGCAGACGTGGCGGGGCGGG + Intronic
973531868 4:51843428-51843450 CGCTGCGGGCGGCGTGGGGCGGG + Intronic
983283031 4:165705239-165705261 CCCGGCAGGAGGCCCAGGGGAGG - Intergenic
985318567 4:188683933-188683955 CACTGCAGTCAGCCCAGGGCAGG + Intergenic
985474991 5:73922-73944 CCCTGCAGGTCTCCTGGGGCAGG - Intergenic
985504591 5:271755-271777 GCCTGCAGCAGGCCCAGGGCCGG - Exonic
985781848 5:1875729-1875751 CCCGCCAGGCTGCCCGCGGCCGG + Intergenic
985794151 5:1949582-1949604 CCCTGCAGACGGCCTCCGGCGGG + Intergenic
986330526 5:6713672-6713694 CGCTTCACGCGGCGCGGGGCGGG - Intergenic
992102370 5:73419755-73419777 TCTTGCGGGCGGCCCGGGGGAGG + Intergenic
997661138 5:135590388-135590410 CCCTGCAGGCTGGCTGGGGCCGG - Intergenic
997690382 5:135824101-135824123 CCCTGCAGGGAGGCTGGGGCTGG + Intergenic
998080864 5:139274057-139274079 CCCAGTAGCCGCCCCGGGGCGGG + Exonic
999438246 5:151581126-151581148 ACCAGCAGTGGGCCCGGGGCAGG - Intergenic
999798782 5:155013709-155013731 CAGTGCAGGCGGCCCGAGGGCGG - Intergenic
1001074821 5:168618113-168618135 CACTGCAGCCGGCCCAGGCCTGG - Intergenic
1001328244 5:170744770-170744792 CCCTGAAGCCGGCGCTGGGCTGG - Intergenic
1001427124 5:171630122-171630144 CCGAGCAGGAAGCCCGGGGCGGG + Intergenic
1001592791 5:172877912-172877934 CCCTGCAGCCAGCCTGGGGCTGG + Intronic
1002193724 5:177491562-177491584 CCCTGCTGGCGGCTGGGGGTTGG - Intronic
1002195030 5:177496902-177496924 CCCGGCAGGCAGGCCGCGGCTGG + Intronic
1002431841 5:179208460-179208482 CGCTGCAGTCGGCCCTGGGCAGG + Intronic
1002593107 5:180304626-180304648 CCCCACAGGCGGCCCGGGGGAGG + Intronic
1002662779 5:180802850-180802872 CCCGGCAGGCGGGGCGGGGCGGG + Intronic
1002887749 6:1311735-1311757 CCTCGCGGGCTGCCCGGGGCTGG + Intergenic
1003188097 6:3850035-3850057 CCCGGCAGGAGGCCCTGGTCAGG + Exonic
1005971275 6:30763842-30763864 CCAGGCAGGCAGCTCGGGGCTGG + Intergenic
1006518213 6:34556173-34556195 GCCAGCAGGCAGCCCTGGGCTGG - Exonic
1006906242 6:37535695-37535717 CCCCCCAGGAGGCCCTGGGCAGG + Intergenic
1007229555 6:40338744-40338766 CCCTGCAGGTGGCCTGGGGCAGG + Intergenic
1007451272 6:41941602-41941624 CCCGGCACGCGCCCCGGGCCGGG - Exonic
1011615926 6:89198406-89198428 CGCTGCAGGGGGCGGGGGGCGGG + Intronic
1013117802 6:107115530-107115552 CCGCGCTGGCTGCCCGGGGCGGG + Intergenic
1014778071 6:125533543-125533565 CTCTGGAGGTGGCCTGGGGCAGG - Intergenic
1015366386 6:132401576-132401598 CCCTGCAGGCGGCCCGGGGCGGG - Intergenic
1015402132 6:132798643-132798665 CCCGGGAGGAGGCCGGGGGCGGG + Intergenic
1017707732 6:157139491-157139513 CCCTGCAGGCGGGCCAGGGAGGG - Intronic
1017796658 6:157850809-157850831 CACTGCTGGCTGCCAGGGGCTGG + Intronic
1018400229 6:163414337-163414359 CCGTGCGGGGCGCCCGGGGCGGG - Intronic
1018739324 6:166715158-166715180 CCCTCCAGGCAGCCCGAGGCGGG + Intronic
1019162278 6:170076593-170076615 CCCAGCAGGGAGCCCAGGGCAGG - Intergenic
1019177351 6:170166887-170166909 CCCTGCAGGTGGCCAGCGGATGG - Intergenic
1019279570 7:193042-193064 CCCTGCACGCGGCCCGGGCCCGG + Exonic
1019611762 7:1940254-1940276 CCCTGCCGCTGGGCCGGGGCAGG + Intronic
1019651840 7:2163766-2163788 CCCTGGAGGCAGCCTGGGCCTGG + Intronic
1019656791 7:2200209-2200231 GGTGGCAGGCGGCCCGGGGCGGG - Intronic
1020210521 7:6154754-6154776 CCCTGTACGCTGCCCGGGACTGG + Exonic
1020274388 7:6615724-6615746 GCCTGCGGGCGGCCTGGGCCGGG - Exonic
1020383004 7:7566829-7566851 CCCGGGAGGCGCCTCGGGGCGGG - Intergenic
1020916443 7:14199504-14199526 CTCTGCAGGCGGCCTGGGACAGG + Intronic
1022710537 7:32845038-32845060 CCCTGGAGGCGGCCCAGGAGAGG + Intergenic
1023659003 7:42454376-42454398 ACCTGCGGGAGGCCTGGGGCTGG + Intergenic
1024556196 7:50605259-50605281 CCCTCCAGGCTGGCCAGGGCCGG + Intronic
1024695134 7:51847986-51848008 CCCTGCAGGCCGTCCAAGGCTGG - Intergenic
1024732990 7:52273781-52273803 CCCTGCAGGCGGAGCGGGCTCGG + Intergenic
1029460617 7:100692106-100692128 CCCTCCAGCAGGCCTGGGGCTGG - Intergenic
1029460899 7:100693683-100693705 GCCCCCAGGCGGCCCAGGGCAGG + Intergenic
1029479003 7:100801864-100801886 CCCTGCAGGTGCCCGGGGGGAGG + Intergenic
1033732832 7:144195646-144195668 CCCGTCGGGCGGCCAGGGGCGGG - Exonic
1033743682 7:144294226-144294248 CCCGTCGGGCGGCCAGGGGCGGG - Intergenic
1033750219 7:144355371-144355393 CCCGTCGGGCGGCCAGGGGCGGG + Exonic
1035642467 8:1194429-1194451 ACCTGGAGGCCGCCCTGGGCAGG - Intergenic
1035795719 8:2354767-2354789 CCCTGCAGGCTCCCCCTGGCTGG + Intergenic
1036210330 8:6835531-6835553 CCCTGCACGCGGCCCCGCGTCGG + Exonic
1036381281 8:8237906-8237928 TCCTGCAGGAGGCCTGGGCCTGG - Intergenic
1036656345 8:10679736-10679758 CCCTGCAGGCGTGCCTGGCCCGG + Intronic
1036656361 8:10679792-10679814 CCCTGCAGGCGTGCCTGGCCCGG + Intronic
1040531887 8:48272581-48272603 CCCTGCAGGTGGCCTGGAGCAGG + Intergenic
1040549946 8:48430059-48430081 GCCTGCTGGAGGCCCAGGGCTGG + Intergenic
1040549981 8:48430201-48430223 CCCTGCAGGGGCCCAGGAGCAGG - Intergenic
1040610874 8:48980836-48980858 CCCTGGAGTCTGACCGGGGCTGG + Intergenic
1041770938 8:61471907-61471929 GCCTGCAGGAGGCCAGGGGAAGG - Intronic
1042020649 8:64369688-64369710 TCCTGCACCTGGCCCGGGGCAGG + Intergenic
1042246430 8:66712873-66712895 CTCCGACGGCGGCCCGGGGCGGG + Intronic
1043847235 8:85177347-85177369 CCCGGCAGGTGGCCGCGGGCGGG + Intronic
1044734800 8:95268746-95268768 CTCTGCGGGCGGGGCGGGGCGGG + Intronic
1045215671 8:100145967-100145989 CCCTGCACCCGTCCCGAGGCGGG + Intergenic
1045328769 8:101137360-101137382 TCCTCCAGGCGGCACGGGCCTGG + Intergenic
1045359091 8:101415342-101415364 CCATGCAGGTGGCCCGGGCCAGG - Intergenic
1045489091 8:102655753-102655775 CCCCGCCCGCGGCGCGGGGCAGG - Exonic
1046096593 8:109569900-109569922 CCCCGCAGGGGGCCAGGGGGAGG + Intergenic
1046916262 8:119681159-119681181 CCCTGCAAGCACCCCTGGGCTGG + Intergenic
1048009209 8:130443160-130443182 CCCTGCAGTGGGGCCGGGGACGG - Intronic
1048309566 8:133309702-133309724 ACCTACTGGCGGCCGGGGGCGGG - Intergenic
1048823393 8:138400013-138400035 CTCTGCAGGGGGCCTGGGACTGG - Intronic
1048833441 8:138497314-138497336 CCCTGATGGGAGCCCGGGGCGGG + Intergenic
1049198939 8:141330541-141330563 GCCTGCCGGCAGCCCTGGGCAGG - Intergenic
1049260890 8:141638580-141638602 CCCTGCAGGCTGCCCTGAGCAGG - Intergenic
1049451559 8:142664738-142664760 CCCAGCTGGCGGCCTGGCGCTGG + Exonic
1049551419 8:143261683-143261705 CCCTGCAGGCCGCTCAGGGCAGG + Intronic
1049556095 8:143282980-143283002 CCCCACAGGAGGCCCGGGGAGGG + Intergenic
1049573964 8:143382083-143382105 CCCAGGAGGCGGCCCAGGGAGGG - Intronic
1049776786 8:144409605-144409627 CCCTGCAGCCGTCCTGGGTCTGG - Intergenic
1049884492 9:18131-18153 TCCTGCAGGCGCCCTGGAGCAGG + Intergenic
1051164681 9:14248765-14248787 CCCTGCAGACGTTCCTGGGCTGG - Intronic
1051697761 9:19788312-19788334 CCCTGCTGGTCGCCCGGGCCGGG - Intergenic
1053122992 9:35560254-35560276 CGCTGCAGCTGGCCCGGGCCCGG + Exonic
1055422748 9:76161299-76161321 CCCTGCAGGCGGCCTGCTGAGGG - Intronic
1056665030 9:88574819-88574841 ACTTGCAGACGGCCAGGGGCGGG + Intronic
1057218553 9:93243297-93243319 CCCTGCAGGAGGGCGGGGGCAGG - Intronic
1057488613 9:95506050-95506072 CCCGAGAGGCGCCCCGGGGCTGG - Intronic
1059283089 9:113151163-113151185 CGCTGCCGCTGGCCCGGGGCTGG + Intronic
1059299020 9:113298018-113298040 CACAGCAGGCGGCGCCGGGCTGG + Exonic
1059395199 9:114029949-114029971 CCCGGCAGGTGGCCCAGGGCTGG - Intronic
1059429342 9:114240649-114240671 CCCTGGAAGGGGCACGGGGCAGG - Intronic
1059633451 9:116150025-116150047 CCCTTCAGGCTGCTCGGGGAGGG + Intergenic
1059942123 9:119368985-119369007 CCCCGAATGCGGCCCGGGGCCGG + Intronic
1060139838 9:121201066-121201088 CCCTGCAGCCGGGCCGGGCCGGG - Intronic
1060974291 9:127755327-127755349 CCCTCCAGCCGGCCAGGGGAGGG + Intronic
1061108872 9:128552772-128552794 CTCTTCAGGCGGGGCGGGGCCGG + Intronic
1061119832 9:128635833-128635855 CCCTGTAGGTGGGCTGGGGCGGG - Intronic
1061242635 9:129383375-129383397 CTCTGCAGGTAGCCCGGGCCTGG + Intergenic
1061262642 9:129488563-129488585 CCTGGCGGGCGGCCCGGGGCAGG - Intergenic
1061544780 9:131298408-131298430 CCCTGCAGGCTGCGAAGGGCTGG - Intronic
1061681099 9:132242745-132242767 CCCTGCAAGGGGGACGGGGCGGG + Exonic
1061808502 9:133149269-133149291 ACCTGCGGGCGGGCTGGGGCGGG - Intronic
1061933932 9:133847013-133847035 GCCTGAAGGCGGCCCTGGGTGGG + Intronic
1062272171 9:135714569-135714591 GCCCGCAGGCGGCCCTGCGCGGG + Exonic
1062277228 9:135736736-135736758 CGCTGCTGCCGGCCCGCGGCGGG + Intronic
1062365839 9:136208659-136208681 AGCTGCAGGTGGCACGGGGCAGG + Exonic
1062429924 9:136522508-136522530 CCCTGCAGTGGGGCTGGGGCCGG - Intronic
1062532490 9:137008039-137008061 GCCTGCAGGAGGGCCGGGGCGGG - Intronic
1062648696 9:137564473-137564495 GCATGCAGGCGGCCAGGAGCAGG + Exonic
1203776411 EBV:75618-75640 CCCTGCAGGTGGCGCCGGGGTGG - Intergenic
1203471566 Un_GL000220v1:117343-117365 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
1203479387 Un_GL000220v1:161315-161337 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
1185774956 X:2794583-2794605 ACCTGCAGGCGGCCGTGGCCTGG - Exonic
1185831816 X:3310209-3310231 CCCTGCACCCCTCCCGGGGCTGG - Exonic
1189234471 X:39476846-39476868 CCCTGCTGGCTGGCCTGGGCAGG + Intergenic
1190337327 X:49270236-49270258 CGCTCCAGACGGCCCGGCGCGGG - Exonic
1191253383 X:58269699-58269721 CCCTGCACTGGGCCCGGGGTGGG - Intergenic
1191875231 X:65788574-65788596 TCCTGCAGGGGGGCCTGGGCAGG + Intergenic
1192429121 X:71100803-71100825 CCATGGAGGCGGCCCGGCGGCGG - Exonic
1193320366 X:80114726-80114748 CACAGCAGGGGGCCCTGGGCTGG - Intergenic
1194268561 X:91782237-91782259 CACTGCTGGCGGCCCGCCGCCGG + Intronic
1196463275 X:115950349-115950371 CCCTGCAGGTGGGCCAGAGCTGG - Intergenic
1196804742 X:119574396-119574418 CCCCACGGGAGGCCCGGGGCGGG - Intergenic
1197147450 X:123185284-123185306 CCCTCCAGGCGCCCAGGAGCCGG - Intronic
1200154724 X:153969421-153969443 CCCTGCAGGCGGCTGGGGGAGGG - Intronic
1200256279 X:154584893-154584915 CCCTGCAGGGCTCCCGGGACAGG + Intergenic
1200261490 X:154619510-154619532 CCCTGCAGGGCTCCCGGGACAGG - Intergenic
1200267473 X:154653807-154653829 CCCTGCAGGGCTCCCGGGACAGG - Intergenic
1200585762 Y:5003151-5003173 CACTGCTGGCGGCCCGCCGCCGG + Intronic