ID: 1015368618

View in Genome Browser
Species Human (GRCh38)
Location 6:132425444-132425466
Sequence CTGCTGGCTGAAACCTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015368609_1015368618 23 Left 1015368609 6:132425398-132425420 CCCCTCCCATGGGAATTTGGTCG No data
Right 1015368618 6:132425444-132425466 CTGCTGGCTGAAACCTGAGCAGG No data
1015368610_1015368618 22 Left 1015368610 6:132425399-132425421 CCCTCCCATGGGAATTTGGTCGC No data
Right 1015368618 6:132425444-132425466 CTGCTGGCTGAAACCTGAGCAGG No data
1015368611_1015368618 21 Left 1015368611 6:132425400-132425422 CCTCCCATGGGAATTTGGTCGCT No data
Right 1015368618 6:132425444-132425466 CTGCTGGCTGAAACCTGAGCAGG No data
1015368607_1015368618 26 Left 1015368607 6:132425395-132425417 CCACCCCTCCCATGGGAATTTGG No data
Right 1015368618 6:132425444-132425466 CTGCTGGCTGAAACCTGAGCAGG No data
1015368612_1015368618 18 Left 1015368612 6:132425403-132425425 CCCATGGGAATTTGGTCGCTTAG No data
Right 1015368618 6:132425444-132425466 CTGCTGGCTGAAACCTGAGCAGG No data
1015368613_1015368618 17 Left 1015368613 6:132425404-132425426 CCATGGGAATTTGGTCGCTTAGG No data
Right 1015368618 6:132425444-132425466 CTGCTGGCTGAAACCTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015368618 Original CRISPR CTGCTGGCTGAAACCTGAGC AGG Intergenic
No off target data available for this crispr