ID: 1015369267

View in Genome Browser
Species Human (GRCh38)
Location 6:132432960-132432982
Sequence CTGTGGAGGTACATGACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015369267_1015369275 3 Left 1015369267 6:132432960-132432982 CCCAGAGTCATGTACCTCCACAG No data
Right 1015369275 6:132432986-132433008 CCAGAAAGCATACCTCAAAGGGG No data
1015369267_1015369279 19 Left 1015369267 6:132432960-132432982 CCCAGAGTCATGTACCTCCACAG No data
Right 1015369279 6:132433002-132433024 AAAGGGGTTAATACAAAGGTGGG No data
1015369267_1015369278 18 Left 1015369267 6:132432960-132432982 CCCAGAGTCATGTACCTCCACAG No data
Right 1015369278 6:132433001-132433023 CAAAGGGGTTAATACAAAGGTGG No data
1015369267_1015369277 15 Left 1015369267 6:132432960-132432982 CCCAGAGTCATGTACCTCCACAG No data
Right 1015369277 6:132432998-132433020 CCTCAAAGGGGTTAATACAAAGG No data
1015369267_1015369272 1 Left 1015369267 6:132432960-132432982 CCCAGAGTCATGTACCTCCACAG No data
Right 1015369272 6:132432984-132433006 AGCCAGAAAGCATACCTCAAAGG No data
1015369267_1015369273 2 Left 1015369267 6:132432960-132432982 CCCAGAGTCATGTACCTCCACAG No data
Right 1015369273 6:132432985-132433007 GCCAGAAAGCATACCTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015369267 Original CRISPR CTGTGGAGGTACATGACTCT GGG (reversed) Intergenic
No off target data available for this crispr