ID: 1015370566

View in Genome Browser
Species Human (GRCh38)
Location 6:132446976-132446998
Sequence GGGTACCATAGACACTGGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015370559_1015370566 2 Left 1015370559 6:132446951-132446973 CCTAGGAGCCATGAATAACTGCC 0: 1
1: 0
2: 2
3: 14
4: 137
Right 1015370566 6:132446976-132446998 GGGTACCATAGACACTGGGTTGG 0: 1
1: 0
2: 1
3: 9
4: 109
1015370562_1015370566 -6 Left 1015370562 6:132446959-132446981 CCATGAATAACTGCCGAGGGTAC 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1015370566 6:132446976-132446998 GGGTACCATAGACACTGGGTTGG 0: 1
1: 0
2: 1
3: 9
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015370566 Original CRISPR GGGTACCATAGACACTGGGT TGG Exonic
911967877 1:104390318-104390340 AGGTACCCTAGGCCCTGGGTGGG - Intergenic
913346599 1:117816601-117816623 GGGTCCCACGGACAATGGGTGGG - Intergenic
919934337 1:202241643-202241665 GGGGAAAATAGAAACTGGGTGGG + Intronic
920791196 1:209094676-209094698 GGAAACCACAGTCACTGGGTAGG - Intergenic
1063558132 10:7100151-7100173 GGCTTCCATGGACGCTGGGTGGG - Intergenic
1063872958 10:10439556-10439578 GGGGAACATAGACTCTGGCTGGG - Intergenic
1065541631 10:26775504-26775526 GGATACATTAGACACAGGGTTGG - Intronic
1067358796 10:45557454-45557476 GGATAGAATAGACAATGGGTAGG - Intronic
1072703758 10:97664926-97664948 GGCTGCCATAGACAATGGGCTGG + Exonic
1073154103 10:101332922-101332944 GGGTCCCAAAAACACTGAGTGGG + Intergenic
1076015781 10:127026631-127026653 GGGGACCAGCAACACTGGGTAGG - Intronic
1077054486 11:584330-584352 GGATGCCAGAGACTCTGGGTTGG + Intronic
1077140881 11:1024371-1024393 GGGGAGCAGAGACCCTGGGTGGG - Intronic
1080237353 11:30086540-30086562 GGTTACTATAGATAATGGGTTGG + Intergenic
1080349731 11:31369731-31369753 GGTTACCATAGAGACCGCGTCGG + Exonic
1080399273 11:31919192-31919214 CAGTGCCATAGCCACTGGGTTGG + Intronic
1082777511 11:57258735-57258757 GGGAATGACAGACACTGGGTGGG + Intergenic
1084548959 11:69829364-69829386 GGGCACCCCAGACACTGGGCCGG - Intergenic
1088295068 11:108284383-108284405 GGGTACCAGAGACAGTGGGATGG + Exonic
1089580748 11:119480780-119480802 GGGTAGCAAAGACAGTGGGGAGG - Intergenic
1090483686 11:127091710-127091732 GGGTACAGTATACACTGTGTGGG + Intergenic
1095535264 12:43238475-43238497 GGTTACTATAGATAATGGGTTGG + Intergenic
1098158577 12:67625185-67625207 GGAGACCAAAGAGACTGGGTGGG - Intergenic
1106661410 13:31803848-31803870 GGGTAGCATAGTCAATGAGTGGG - Intergenic
1109301876 13:60597964-60597986 GGGAACAACAGACACTGGGGCGG - Intergenic
1114031675 14:18584905-18584927 GGGGGCCAGAGACACTAGGTAGG + Intergenic
1114209953 14:20606006-20606028 GGGTCCCACGGACAATGGGTGGG + Intronic
1117189296 14:53275033-53275055 GGGTCCCATGGACAATGGTTGGG - Intergenic
1117917323 14:60691543-60691565 AGGAACCATAGACACTGGCGTGG - Intergenic
1118030528 14:61813307-61813329 GGTTACCATGGTCAGTGGGTGGG + Intergenic
1119536502 14:75407162-75407184 GGGTACAATATACACTGTTTGGG - Intergenic
1119645011 14:76341712-76341734 GGCTCCCAGAGACAGTGGGTGGG - Intronic
1119762439 14:77161097-77161119 GGGCCCCATAAACACTGGGGAGG - Intronic
1120161731 14:81153042-81153064 GGGTACCAAAGAGGCTGGATGGG - Intergenic
1121247347 14:92471569-92471591 GGGTTACATAGGCCCTGGGTTGG - Intronic
1122885651 14:104709210-104709232 GGGTCCCAAAGAGGCTGGGTGGG + Intronic
1126874110 15:53020256-53020278 GGGCACCACAGATACTGGGGAGG - Intergenic
1127681819 15:61305060-61305082 GGGTAGCACAGACACGGGGCGGG + Intergenic
1129222976 15:74144327-74144349 GAGAGCCCTAGACACTGGGTGGG - Intergenic
1140560799 16:75978684-75978706 GGGAAGAACAGACACTGGGTGGG - Intergenic
1144280639 17:13722911-13722933 GGGTAGCATTGGCACTTGGTGGG - Intergenic
1146838121 17:36128562-36128584 GGGTACCACAGACAGAGGCTGGG - Intergenic
1148606174 17:48930652-48930674 AGGTTCCATAGACAAAGGGTAGG + Intronic
1149341441 17:55690601-55690623 GGGGGGCATAGACACTGGGCAGG - Intergenic
1150847230 17:68671646-68671668 GGGTACAATTGAGACTGGGAAGG - Intergenic
1153308401 18:3653601-3653623 GCCTGCCATAGACACTTGGTAGG + Intronic
1153986627 18:10356779-10356801 GGTTACTATAGACAGTGGGTTGG - Intergenic
1153986641 18:10356880-10356902 GGTTACTGTAGACAGTGGGTTGG - Intergenic
1164734647 19:30531942-30531964 GGGTACCATGGACACAGAGGTGG - Intronic
926129419 2:10292412-10292434 GGGTTCCACACACACTGGGGAGG - Intergenic
932736334 2:74257153-74257175 GGGCATCATACACACTGGGCTGG + Intronic
933024267 2:77234900-77234922 GGCAACAATAGACACTGGATGGG - Intronic
935480091 2:103576036-103576058 GGGTACCATGTACACTGCTTGGG + Intergenic
935903780 2:107821140-107821162 GGGATCCATTGACACTGAGTTGG - Intergenic
944072691 2:195690954-195690976 GGGTACAGTATACACTGGTTGGG - Intronic
944120905 2:196239791-196239813 GGGCACAACAGACACTGTGTAGG + Intronic
946897500 2:224339221-224339243 TGGAACAATAGACACTGGGTAGG + Intergenic
947478438 2:230473481-230473503 GGATATCACAGACACTGGGTAGG + Intronic
1174760034 20:53198212-53198234 GGGCTCCAGAGACACTGGATGGG - Intronic
1175860493 20:62147819-62147841 GGGTACCAAGGACATGGGGTAGG - Intronic
1180455787 22:15511962-15511984 GGGGGCCAGAGACACTAGGTAGG + Intergenic
951955675 3:28250624-28250646 GGGTAACATAACCACTAGGTTGG + Intronic
953439220 3:42903941-42903963 GGTTACCATAGAAAATGGGTTGG - Intronic
953705604 3:45227578-45227600 GGGACAGATAGACACTGGGTTGG - Intergenic
955690426 3:61585411-61585433 TGGTACTATAGCCATTGGGTGGG + Intronic
956456003 3:69421068-69421090 GGGTAGGGTGGACACTGGGTGGG - Intronic
962231508 3:133669461-133669483 GGGAACCATAGTCTCTGGCTAGG - Intergenic
962666550 3:137659770-137659792 GGATACAACAGACACTGGGGAGG + Intergenic
967367804 3:188707500-188707522 CAGTAGCATTGACACTGGGTTGG - Intronic
968501301 4:951467-951489 GGGGACCAGGGGCACTGGGTTGG + Intronic
970167187 4:13251176-13251198 GGGTAACATAGAGAATGTGTTGG + Intergenic
974490395 4:62557263-62557285 TGGTTCCTTAGACAATGGGTGGG + Intergenic
974921969 4:68252908-68252930 GGGAACAATAGACACTGTGGGGG - Intergenic
975762277 4:77631849-77631871 GGGTCCCACAGACAATGGGCGGG - Intergenic
975839502 4:78458532-78458554 GGGAACCTTAGACACTGGGGAGG + Intronic
976044449 4:80929188-80929210 TGGTGCCATAGATACTGGATGGG - Intronic
976044464 4:80929290-80929312 TGGTGCCATAGAGACTGGATGGG - Intronic
976221481 4:82759970-82759992 GGGCACCATAGATGCTGGGAAGG - Intronic
976973738 4:91140965-91140987 GGGTACTATAAAAACTGGGAGGG - Intronic
980695820 4:136354224-136354246 GGGAATAATAGACACTGGGGAGG - Intergenic
983493377 4:168414855-168414877 GGCTAGCAAAGACAGTGGGTTGG + Intronic
986040839 5:3992703-3992725 GGGTACTAGAGAGGCTGGGTGGG - Intergenic
986399716 5:7369059-7369081 GGGAACCCAAGACAATGGGTGGG - Intergenic
993744505 5:91580234-91580256 GGGTGCTATTGACATTGGGTGGG + Intergenic
997335611 5:133107097-133107119 GGCTACAATAGGCCCTGGGTAGG - Intergenic
997898742 5:137743842-137743864 GGGTATCATGGAAACTTGGTGGG + Intergenic
998157103 5:139793301-139793323 GGGTGCCATGGACACTGGAGAGG - Intergenic
998407571 5:141882774-141882796 TGTTTCCATAGAAACTGGGTAGG + Intergenic
1000362434 5:160460422-160460444 GGGTACCTTAGAAATTGGGGTGG + Intergenic
1005718953 6:28581879-28581901 GGGTAGAATAGACACTGGGTTGG + Intronic
1008751979 6:54746068-54746090 GGGCACTATAGCCACTGGGATGG + Intergenic
1011433247 6:87310541-87310563 GGGTACCATGTACACTGCTTGGG + Intronic
1012714496 6:102651084-102651106 GGGAATAATAGACACTGGGGAGG - Intergenic
1015370566 6:132446976-132446998 GGGTACCATAGACACTGGGTTGG + Exonic
1017961871 6:159230429-159230451 GGGTACAATATTCACTGGCTGGG + Intronic
1023075087 7:36474008-36474030 GGATCCCATGGACAATGGGTGGG - Intergenic
1024061818 7:45703947-45703969 GGGGACCAGGGCCACTGGGTGGG + Intronic
1026297464 7:69067313-69067335 GGGTACGATATACACTGCTTGGG - Intergenic
1030720790 7:112868347-112868369 GGATACCCTAGACCCTGGGGAGG + Intronic
1036410322 8:8493975-8493997 GAGCAGCAGAGACACTGGGTTGG + Intergenic
1042832494 8:73047005-73047027 GGGAATAATAGACACTGGGGAGG + Intronic
1056182978 9:84103428-84103450 GGCAACGATAGACACTGGGGAGG + Intergenic
1056848040 9:90057443-90057465 TGGGACCAGAGACACTGTGTTGG - Intergenic
1058092583 9:100822282-100822304 AACTACCATAGACACTGGGAAGG - Intergenic
1058745201 9:107983669-107983691 GGGTATCATAGTTCCTGGGTAGG + Intergenic
1061043471 9:128152454-128152476 GAGTCCCATAGACCCTGGGGTGG - Intronic
1061758776 9:132835218-132835240 GGGCACCATAGATACTTGATAGG - Intronic
1062431389 9:136528305-136528327 AGGAACCAGAGACCCTGGGTGGG + Intronic
1188029814 X:25251734-25251756 GGCAACAATAGACACTGGGAAGG - Intergenic
1189008404 X:37019070-37019092 GGGAACCACAGACACTGGGGTGG + Intergenic
1189040323 X:37535940-37535962 GGGAACCACAGACACTGGGGCGG - Intronic
1190684176 X:52855711-52855733 GGGAACAACACACACTGGGTGGG + Intergenic
1192884854 X:75325884-75325906 GGGAATAATAGACACTGGGGAGG - Intergenic
1193620506 X:83747922-83747944 GGGAATAATAGACACTGGGGAGG - Intergenic
1193995271 X:88359025-88359047 GGTTACCATAGTCTGTGGGTGGG + Intergenic
1198322610 X:135533569-135533591 GGGAACCACACACACTGGGTGGG - Intronic
1199311580 X:146327214-146327236 TGATACCATAGATATTGGGTGGG - Intergenic
1199666189 X:150098306-150098328 GGGTACCAGAGACACTGATCTGG + Intergenic
1199720737 X:150541253-150541275 GGGGACCAGAGGCACTCGGTGGG + Intergenic
1202195708 Y:22297042-22297064 TGGTACCAGGGAAACTGGGTGGG - Intergenic