ID: 1015371328

View in Genome Browser
Species Human (GRCh38)
Location 6:132456914-132456936
Sequence GCCACTGCAGACAGAAGTGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 328}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015371324_1015371328 11 Left 1015371324 6:132456880-132456902 CCATGAGAAAAGGAGAGACCATC 0: 1
1: 0
2: 1
3: 22
4: 245
Right 1015371328 6:132456914-132456936 GCCACTGCAGACAGAAGTGTAGG 0: 1
1: 0
2: 3
3: 28
4: 328
1015371326_1015371328 -7 Left 1015371326 6:132456898-132456920 CCATCTTTCCTCAGAGGCCACTG 0: 1
1: 0
2: 3
3: 48
4: 401
Right 1015371328 6:132456914-132456936 GCCACTGCAGACAGAAGTGTAGG 0: 1
1: 0
2: 3
3: 28
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015371328 Original CRISPR GCCACTGCAGACAGAAGTGT AGG Exonic
900745583 1:4358504-4358526 ATCACAGCAGACAGCAGTGTTGG + Intergenic
901426769 1:9186804-9186826 CCCCCTGCAGACAGAACTGCAGG + Intergenic
901853553 1:12030428-12030450 CCCACAGCAGCCAGGAGTGTAGG + Intronic
902165713 1:14569755-14569777 GCAACTGCAGCCAGAGGGGTGGG + Intergenic
902379989 1:16048324-16048346 GGCCCTGCAGAGAGAAGGGTGGG - Exonic
904131908 1:28281660-28281682 GCCACTGGAGGCAGGAGAGTGGG - Exonic
904235693 1:29115584-29115606 GGTACTGCAGACAGGAGTATTGG + Intronic
904409563 1:30317317-30317339 GACACTGCAGACATAGGTGGTGG - Intergenic
906847593 1:49210364-49210386 TCCACTGTAGTCAGAAGTGTGGG + Intronic
908140636 1:61180588-61180610 GGCTCAGCAGACAGAAGTCTTGG + Intronic
908247081 1:62236064-62236086 GTCTCTGCAGACAGCAGTATGGG - Intergenic
910002514 1:82356936-82356958 GCCACTGCACACAGACATGAGGG + Intergenic
911570603 1:99513255-99513277 GCCACTGCACACAGACATGAGGG - Intergenic
912084760 1:105985432-105985454 GCCACTGTAGAAAGCAGTTTGGG + Intergenic
912325130 1:108750763-108750785 GCCAAGACAGACAGAAGTGTGGG - Intronic
916313886 1:163426588-163426610 GCAACTCCAGGCAGAAATGTTGG + Intergenic
916459568 1:165009407-165009429 GCCACTGGGTAAAGAAGTGTAGG - Intergenic
916678520 1:167084051-167084073 GCCAGTGCAGCCAGAAATGTGGG + Intronic
916927088 1:169533807-169533829 GCCACTGTGGAAAGAAGTTTGGG + Intronic
917273356 1:173303230-173303252 GCAGCTGCAGAAAGATGTGTGGG - Intergenic
917310976 1:173677975-173677997 GCCACAACAAACAGAACTGTGGG + Intergenic
917796911 1:178539251-178539273 GCCACTGCAGTGAGAGGTCTTGG + Intronic
918177950 1:182061571-182061593 GGAAATGCAGACAGCAGTGTGGG + Exonic
918267823 1:182862925-182862947 GTTAAAGCAGACAGAAGTGTGGG + Intronic
919208397 1:194448211-194448233 GACACTGCTTAGAGAAGTGTAGG - Intergenic
919758230 1:201079307-201079329 GCCCCTGGAGAGAGTAGTGTTGG - Intronic
919761944 1:201103637-201103659 GCCACTGTACAGAGAAGTGATGG - Intronic
920943557 1:210506772-210506794 GCCAGAGCAGACAGAAGCATTGG + Intronic
921459075 1:215407795-215407817 GCCAGTGCAGACAAAGGTCTAGG + Intergenic
921559404 1:216639332-216639354 GCTTCTGCACACAGAAGTTTTGG - Intronic
923739577 1:236643115-236643137 GCCACTGCAGACTGCAAAGTAGG - Intergenic
924503463 1:244658364-244658386 GCCACTCCAGACAGAAGGATGGG - Intronic
1063805702 10:9637651-9637673 GCCTCTGGAGTCAGAATTGTTGG + Intergenic
1063833955 10:9990635-9990657 CCCACTGCAGAGAAATGTGTGGG + Intergenic
1063836343 10:10018304-10018326 GCCATTGCAGAAAGCAATGTAGG - Intergenic
1064111976 10:12547330-12547352 TCGACTGCAGAGAGAAGAGTGGG + Intronic
1065803255 10:29371728-29371750 GCCAGTGCAATCAGAAATGTAGG + Intergenic
1066436930 10:35404212-35404234 GCCACTGCACACAGACATGAGGG + Intronic
1068299419 10:55119276-55119298 GCCACTGAAGACTGAAGAATAGG - Intronic
1069723984 10:70565932-70565954 GCCGGTCCAGGCAGAAGTGTGGG + Intronic
1071239931 10:83694453-83694475 GGCATTGCAGACAGCAGTGGAGG + Intergenic
1071743389 10:88387861-88387883 GGCAATGCAGACAGGAGTGAAGG + Intronic
1075418032 10:122279964-122279986 GACACGGCAGAAGGAAGTGTTGG - Intronic
1075620498 10:123924309-123924331 GCTACGTCAGACAGAACTGTGGG - Intronic
1075932582 10:126311947-126311969 GCCAAGTCAGAGAGAAGTGTGGG + Intronic
1076424053 10:130354912-130354934 ACCAAGTCAGACAGAAGTGTGGG - Intergenic
1076667668 10:132102367-132102389 GCCACTGCAGACGGAGGGGCTGG - Intergenic
1076845509 10:133067748-133067770 GCCACAGCACCCTGAAGTGTGGG - Intergenic
1076852493 10:133099892-133099914 GCACCTGCAGACAGCAGTGGTGG + Intronic
1076999410 11:315224-315246 GACACTGTAGACAGGTGTGTGGG - Exonic
1077500075 11:2905374-2905396 ACCACTGGAGGCAGCAGTGTGGG + Intronic
1078778291 11:14413505-14413527 GCCAATGCTGACAAATGTGTGGG - Intergenic
1079284000 11:19112851-19112873 CCCTCTGCTGACAGATGTGTGGG + Intergenic
1079617655 11:22514786-22514808 TCCACTGCAAACATAAGTTTGGG - Intergenic
1080335965 11:31196453-31196475 GCCAAGTCAGACAGAAGTGTGGG - Intronic
1083631668 11:64098476-64098498 GGCACTGGAGACAGAAGGCTGGG - Intronic
1084447570 11:69212666-69212688 GCCACTGCAGACAGAGAGGAGGG - Intergenic
1084775026 11:71369359-71369381 GCCACAGCAGCCAGAGGTGAGGG + Intergenic
1085595116 11:77802265-77802287 GTCAAGTCAGACAGAAGTGTGGG + Intronic
1086953420 11:92913301-92913323 GACACTGCAGAGAGGAGGGTGGG + Intergenic
1087702139 11:101446921-101446943 GCATCTGCAGCCAGAAGTATTGG - Intergenic
1088352902 11:108909656-108909678 GCCACTGGTGTCCGAAGTGTGGG + Intronic
1089165448 11:116472547-116472569 GCCAAGTCAGACAGAAGTGCAGG + Intergenic
1092623805 12:10303597-10303619 GAAACTGCAGACACAAGAGTAGG - Intergenic
1094407163 12:30128583-30128605 GCCTCTGGAGTCAGAAGTGCTGG - Intergenic
1095042111 12:37454964-37454986 GCTACTGCTGACAAAACTGTTGG - Intergenic
1097248326 12:57618946-57618968 GCCACTCCTCACAGAGGTGTGGG + Intronic
1098146426 12:67502403-67502425 GTCACTGCAGACAGAAAGGTTGG + Intergenic
1098890908 12:76009920-76009942 GCAAATGCAAACAGAAATGTCGG + Intergenic
1100258100 12:92904601-92904623 GCCAAAGTAGACAAAAGTGTGGG - Intronic
1101278181 12:103224760-103224782 GCCACTGCACACAGACATGAGGG + Intergenic
1101323277 12:103692415-103692437 GACCCTGGAGACAGAACTGTGGG - Intronic
1101430611 12:104623772-104623794 GCAACTGCAGACAGCAGAGACGG - Intronic
1101730023 12:107419210-107419232 GCCACTGCACACAGCCATGTGGG - Intronic
1102973255 12:117188293-117188315 GCCTCTGCAAACCAAAGTGTTGG - Intronic
1103061355 12:117861111-117861133 GCTATTGCAAACAGAACTGTAGG - Intronic
1103797407 12:123513880-123513902 GCCACAGCAGCCACACGTGTGGG + Intronic
1104133812 12:125918903-125918925 GCCTCTGTAGACAGCATTGTCGG + Intergenic
1104220037 12:126773974-126773996 GCAACTCCAGACAGATGTCTGGG + Intergenic
1105572019 13:21611655-21611677 GGGCCTGCAGTCAGAAGTGTGGG - Intergenic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1106378450 13:29212552-29212574 GCCAAGTCAGACAGAAGTGTGGG - Intronic
1106392446 13:29347763-29347785 GCCAAGTCAGACAGACGTGTGGG - Intronic
1107961285 13:45561687-45561709 GCCTTTGAAGAGAGAAGTGTTGG + Intronic
1108091911 13:46858021-46858043 GCCACTGGGGACAAAAGTGGGGG + Intronic
1108803647 13:54129766-54129788 GCCACTGCACACAGACATGAGGG + Intergenic
1109863455 13:68230179-68230201 GCCTCTGCAGAACTAAGTGTTGG + Intergenic
1111630656 13:90843069-90843091 GCCACTGCACGCAGACGTGAGGG - Intergenic
1113399103 13:109975060-109975082 GCCACTGCAGGGAGACGTGTGGG - Intergenic
1114588556 14:23837675-23837697 GCCAAGGCTGATAGAAGTGTGGG - Intergenic
1115847335 14:37554534-37554556 TCCATTGTAGCCAGAAGTGTAGG + Intergenic
1116397426 14:44463384-44463406 GCAGCTGCAGAAAGATGTGTGGG - Intergenic
1116497115 14:45574677-45574699 CCCAGGGCAGACAGAAGAGTAGG - Intergenic
1117008544 14:51447073-51447095 GCAAATGCAGGCAGAGGTGTAGG + Intergenic
1120591939 14:86386116-86386138 GCCAAGTCAGACAGAAGTATGGG - Intergenic
1121743327 14:96269047-96269069 CCCACTGCAGAGAGCAGTGAAGG - Intergenic
1121861380 14:97321797-97321819 GCCACTCCAGGCTTAAGTGTAGG - Intergenic
1122693427 14:103541969-103541991 GCCACTGCAGACAGCAGCTGGGG - Intergenic
1122713218 14:103676131-103676153 TCCTCTGCAGAGGGAAGTGTAGG + Intronic
1122997758 14:105274765-105274787 TGCTCTGCAGACAGAAGTGGGGG - Intronic
1202940625 14_KI270725v1_random:142701-142723 GCTACTGCTGACAAAACTGTTGG - Intergenic
1123969101 15:25488325-25488347 GCCACTGAAGATTCAAGTGTGGG + Intergenic
1124438647 15:29671376-29671398 GCCAAGTCGGACAGAAGTGTAGG + Intergenic
1126529932 15:49701217-49701239 GCCACTGCACACAGACATGAAGG + Intergenic
1127228245 15:56958593-56958615 GTCACTGCAGACAGTTCTGTTGG + Intronic
1129914520 15:79257058-79257080 GCCAAGTCAGACAGAAGTGTGGG + Intergenic
1130306866 15:82718168-82718190 GCCACTGCACACACTAGTCTGGG - Intergenic
1130548377 15:84872915-84872937 GGCACTTGAGACAGAACTGTTGG + Exonic
1131089994 15:89616833-89616855 GCCTTTGCTGACAGAGGTGTGGG + Intronic
1131446159 15:92499583-92499605 GCCAGTGCACAGAGAAGTGGAGG - Intronic
1132074181 15:98805999-98806021 GGCAAGTCAGACAGAAGTGTGGG - Intronic
1132192627 15:99881237-99881259 GCCATTGTAAACAGAATTGTAGG + Intergenic
1132641346 16:979961-979983 GGCACTGCAGACGGAGGTGTGGG + Intronic
1133256216 16:4518009-4518031 ACCACTGCAGACCACAGTGTTGG - Intronic
1137043089 16:35631633-35631655 GCAGCTGCAGAAAGATGTGTGGG - Intergenic
1138071229 16:53995061-53995083 GCCACTGCATACAGCAGTACAGG - Intronic
1138573274 16:57889786-57889808 GGCACTGGGGTCAGAAGTGTGGG - Intronic
1139284211 16:65796348-65796370 CCCACTGCAGAGAGAAGGCTGGG - Intergenic
1141741504 16:85896269-85896291 GCCCCTGAAGACAGAAAGGTAGG + Intergenic
1143032146 17:3973790-3973812 GCCCCTGCACACAGTAGTGGGGG + Intergenic
1143804881 17:9418060-9418082 GCCACGTTGGACAGAAGTGTGGG + Intronic
1144368356 17:14567116-14567138 GCCACTGCCTCCCGAAGTGTTGG + Intergenic
1146059169 17:29595584-29595606 GCCGCTGCAGGTAGAGGTGTTGG + Intronic
1146663430 17:34680727-34680749 GCCAAGTCAGACAGAAGTGAGGG + Intergenic
1146767812 17:35539834-35539856 GGCACTGCAGATAGATATGTCGG + Intergenic
1147479017 17:40741310-40741332 GCCATGTCAGACAGAAGTGTGGG + Intergenic
1148400485 17:47355855-47355877 GCCACTGCACCCAGCAGTGCTGG + Intronic
1148591933 17:48822956-48822978 GCCACTGCACCCAGCAGTTTTGG + Intergenic
1149114397 17:53074384-53074406 GCCATTGTAGAAAGCAGTGTGGG - Intergenic
1149477656 17:56976701-56976723 TCCACTGCAGTCAGAATTTTAGG - Intergenic
1151657307 17:75502052-75502074 GCCACTGCAGACCGCACTGCTGG - Exonic
1151808417 17:76421225-76421247 AACACTGCAGAAAGAAGTGACGG + Intronic
1152071835 17:78137954-78137976 ACCACTCCAGACAGATGCGTGGG - Intronic
1155611922 18:27675860-27675882 CCCACTTGAGAGAGAAGTGTGGG + Intergenic
1157595056 18:48859325-48859347 GCAGCTGCAGACAGAGATGTGGG - Exonic
1157690501 18:49678164-49678186 GCAACAGCAGACACAAGTGAGGG + Intergenic
1157777348 18:50406120-50406142 GACACTGCAGGCAGCAGGGTCGG - Intergenic
1157912234 18:51627520-51627542 GCAGCTGCAGAGAGAATTGTAGG - Intergenic
1158121466 18:54052890-54052912 GCCACTGAAGGCAGAGCTGTAGG + Intergenic
1159835263 18:73328273-73328295 GCCACTGCACACAGACATGAGGG - Intergenic
1159843612 18:73430789-73430811 GCCTCTGCAGACAGACCTGAGGG - Intergenic
1160583999 18:79902880-79902902 CCCACTGCAGCCAGAAGTGAGGG + Exonic
1160857794 19:1225108-1225130 ACCAGTGCAGACAGGAGTGTGGG + Intronic
1161644422 19:5444415-5444437 GACTCTGCAGGCAGAGGTGTTGG - Intergenic
1161788261 19:6341913-6341935 GCCACTGCACCCAGCAGTGTTGG + Intergenic
1161889641 19:7025386-7025408 GCCACTGCACCCAGGTGTGTGGG + Intergenic
1161891811 19:7045360-7045382 GCCACTGCACCCAGGTGTGTGGG - Intergenic
1162661617 19:12173759-12173781 GCCACTGCTGTCGGATGTGTGGG + Intronic
1162827372 19:13261655-13261677 GCCACTGGAGGCAGAAGGTTGGG - Intronic
1163155563 19:15438367-15438389 GCCACTGGAGGAAGGAGTGTGGG - Intronic
1165752410 19:38268261-38268283 ACCTCTGCAGACAGAGGTGGGGG + Intronic
1165914413 19:39248753-39248775 TGCACTGCAGACAGGAGTGAGGG - Intergenic
1167393537 19:49212002-49212024 AACAGTGCAGACAGAAGTGCTGG - Intergenic
1167799776 19:51732614-51732636 GCCAAGTCAGATAGAAGTGTGGG - Intergenic
1168662286 19:58176694-58176716 GCCACTGCAGTCAGAAGGAAGGG + Intergenic
925553151 2:5097801-5097823 GCTGCTGCAGACAGAAGCATGGG - Intergenic
927174789 2:20398254-20398276 GCCAAGTCAGACAGAAATGTGGG - Intergenic
927562146 2:24081649-24081671 GCCACTGCACTCAGTAGTGAAGG - Intronic
927565697 2:24110783-24110805 GCCAGGTCAGACAGAAGTGTGGG + Intronic
928738173 2:34317411-34317433 GACAATGCAGACAGAATTATAGG - Intergenic
929278318 2:40049627-40049649 GACACCGCTGAGAGAAGTGTGGG + Intergenic
929539888 2:42811194-42811216 GTCTCTGCAGACAGAAGCGAGGG - Intergenic
931625991 2:64256116-64256138 GCCACTGCACACAGACTTGAGGG - Intergenic
931648799 2:64450277-64450299 GCCACACCAGAGAGAAGAGTGGG + Intergenic
932986609 2:76733508-76733530 GCCAAGTCAGACAGAAGTGTGGG - Intergenic
934038699 2:88110028-88110050 GCCCCTGCAGATACTAGTGTGGG - Intronic
935048775 2:99506060-99506082 GCAACTTCAGACAGAATGGTGGG - Intergenic
937968690 2:127533910-127533932 GGAACTGCAGGCAGAAATGTGGG - Intergenic
940006315 2:149012032-149012054 CCCACAGCAGACAGAAGTTGGGG + Intronic
940326775 2:152433841-152433863 GGCTCTGCAGACAGCAGTGGGGG + Intronic
942347454 2:175018155-175018177 GGCACTGCTGAAAGAAATGTAGG + Intergenic
942743288 2:179203702-179203724 GCCAAGTCAGACAGAAGTGTGGG + Intronic
942971366 2:181961868-181961890 GCCACTGGAGACAGAGATGGAGG - Intronic
943833609 2:192491052-192491074 GCCACTGCAGAAAGCAGTTTGGG + Intergenic
946457859 2:219843322-219843344 TTCAATGCTGACAGAAGTGTAGG - Intergenic
947391180 2:229641142-229641164 GACACTGCAAACAGAAATATCGG + Intronic
947391342 2:229642687-229642709 TCCTCTGCAGACAGAACTTTTGG + Intronic
948514728 2:238496971-238496993 GGCAAAGCAGACAGAAGAGTGGG + Intergenic
1168886940 20:1266541-1266563 GCCGCTGCAGCCAGAAGGCTTGG - Intronic
1170209671 20:13835936-13835958 GCCAGGGCAGACAGAAGTGTGGG + Intergenic
1170865254 20:20149872-20149894 ACCACTGCAGAAAGGAGTGCAGG + Intronic
1171536540 20:25898046-25898068 GCTACTGCTGACAAAACTGTTGG - Intergenic
1171804568 20:29663110-29663132 GCTACTGCTGACAAAACTGTTGG + Intergenic
1171839479 20:30193312-30193334 GCTACTGCTGACAAAACTGTTGG - Intergenic
1176345805 21:5745821-5745843 ACCACTGCAGACAGAATCTTGGG - Intergenic
1176352619 21:5866405-5866427 ACCACTGCAGACAGAATCTTGGG - Intergenic
1176499022 21:7578634-7578656 ACCACTGCAGACAGAATCTTGGG + Intergenic
1176540126 21:8143891-8143913 ACCACTGCAGACAGAATCTTGGG - Intergenic
1176559077 21:8326936-8326958 ACCACTGCAGACAGAATCTTGGG - Intergenic
1182368544 22:29794874-29794896 GACAATGCAGACAGAAGGCTAGG + Intronic
1182515746 22:30857972-30857994 TACACTGCAGACAGAAGAGGCGG + Intronic
1182664845 22:31950384-31950406 GCCACTGCAGCCAGGAGTAGGGG - Intronic
1182682394 22:32090808-32090830 GCCACTGCAGAAAATAGTCTGGG - Intronic
1182823727 22:33243901-33243923 CCCACTCCAGGCAAAAGTGTAGG + Intronic
1183302988 22:37067534-37067556 GCCTCAGCAGACAGAGGTGGGGG - Intronic
1183636548 22:39066987-39067009 GCCACTGCACAGAGACATGTGGG + Intronic
1183725535 22:39587133-39587155 CCCAGTGCAGACAGCAGAGTAGG - Intronic
1184167361 22:42737889-42737911 GCCACTGCACCCAGCAGTTTTGG - Intergenic
1184611583 22:45607320-45607342 GCCAAGTCAGACGGAAGTGTGGG + Intergenic
949210354 3:1491665-1491687 GGCAAGGTAGACAGAAGTGTGGG - Intergenic
949780673 3:7683615-7683637 GTCACTGCAGAAAGTACTGTTGG - Intronic
950553432 3:13681363-13681385 GCCACTGGATACAGAAGCCTGGG - Intergenic
950692560 3:14671796-14671818 CCCACTGCACACAGGAGTGTAGG - Exonic
951642388 3:24850590-24850612 ACCTATGCAGACAGAAGAGTAGG + Intergenic
952441300 3:33332349-33332371 GCCACTGCAGAAAACAGTTTGGG + Intronic
953103806 3:39855801-39855823 GCTGCTGCAGACACAAGTGCAGG - Intronic
954345152 3:49991034-49991056 GCCAAATCAGACATAAGTGTAGG - Intronic
954671808 3:52295032-52295054 GCCCCTACAAACAGAAGTATAGG - Intergenic
954710186 3:52501676-52501698 GCGGCTGCAGACGGAAGTGCCGG + Exonic
955296154 3:57737154-57737176 GCCACTGCTAACAGCAGTATAGG - Intergenic
955315006 3:57931144-57931166 GCCACTGCACTCAACAGTGTGGG - Intergenic
957295446 3:78327433-78327455 GCCACTGCACGCAGACGTGAGGG - Intergenic
959485554 3:106924802-106924824 GCCACTGCACACAGACATGAGGG + Intergenic
961855783 3:129869461-129869483 GCCAAGCCAGACAGAAGTGTGGG + Intronic
963425438 3:145116612-145116634 GCCACTGCACACAGACATGAGGG - Intergenic
966715894 3:183012599-183012621 GCCACTGCAGGCAGAAGGACTGG - Intergenic
967005095 3:185376402-185376424 GCCACTGCACGCAGACGTGAGGG + Intronic
967788707 3:193524244-193524266 GCCAAATCTGACAGAAGTGTGGG + Intronic
967891931 3:194369788-194369810 GTCACTGCAGAGGGCAGTGTTGG + Intergenic
967963417 3:194942602-194942624 GCCAAGGGGGACAGAAGTGTGGG + Intergenic
967991160 3:195131932-195131954 GCCAATGAAGACAGAAGTCCAGG + Intronic
968412999 4:405445-405467 GCCACTGCACACAGACATGAGGG + Intergenic
968648164 4:1750031-1750053 GCCCCTGCAGACATCAGGGTGGG + Intergenic
968793973 4:2689815-2689837 CCCACTGGAGACAGAGGTGGTGG - Intronic
969389439 4:6879928-6879950 GGCACTGCAGACGGGTGTGTTGG - Intronic
969389498 4:6880355-6880377 GGCACTGCAGACGGGTGTGTTGG - Intronic
970196159 4:13552174-13552196 GCCACTGTGGAAAGCAGTGTGGG + Intergenic
971615572 4:28786563-28786585 TCAACTGCAGACAGAGGTGGAGG + Intergenic
972254607 4:37339840-37339862 GACACTGGAGACAGAATGGTGGG - Intronic
974628809 4:64457355-64457377 GCAACTGCACACAGGAATGTGGG - Intergenic
975152332 4:71035000-71035022 GCCACTGCACACAGACATGAGGG - Intergenic
975265815 4:72365521-72365543 GCCACTGCATACAGTCCTGTAGG + Intronic
975419937 4:74151455-74151477 AGCACTGCAGTTAGAAGTGTGGG + Intronic
975635941 4:76448388-76448410 GCCAATGCACACAGAAATGAAGG - Intronic
976558818 4:86478423-86478445 GCCACTGCACACAGACTTGAGGG - Intronic
977086140 4:92601063-92601085 GCAACTTCAGGCAGGAGTGTAGG - Intronic
977781622 4:100987286-100987308 GCCAAGTCAGACAGAAATGTGGG - Intergenic
977961346 4:103088729-103088751 GCCAATGGAGACAGAAGGGCTGG - Intronic
978943781 4:114470238-114470260 GCCAAGTCAGACAGAAGTTTTGG + Intergenic
979300817 4:119085267-119085289 GACATTGGAGACAGAAGGGTGGG + Intergenic
980228711 4:130020231-130020253 GTCATGTCAGACAGAAGTGTGGG - Intergenic
981257033 4:142673933-142673955 GCCACAGCTGCCAGCAGTGTTGG + Intronic
981915104 4:150024770-150024792 GCCACATCAGACAGAAGCGTGGG + Intergenic
982083741 4:151814528-151814550 GCCACTGCACACAGACATGAGGG + Intergenic
982389412 4:154848329-154848351 GCAACTGCAGAAAGATGTATGGG - Intergenic
982933282 4:161436551-161436573 GACACTTCATACAGAAGTGAAGG - Intronic
984414266 4:179436375-179436397 GGGACTGCATACAGAATTGTGGG + Intergenic
985315663 4:188656795-188656817 GCCACTGCACACTGAAGCCTGGG - Intergenic
985677940 5:1242060-1242082 GGCAGTGGAGACAGAAGGGTGGG + Intronic
986193739 5:5519174-5519196 GCCACTGCACACAGACATGAGGG - Intergenic
987891466 5:23883624-23883646 GCAACTGTTGACAGAAATGTAGG + Intergenic
989807834 5:45632785-45632807 GCCACAACAGACACAGGTGTTGG + Intronic
992451743 5:76882250-76882272 GCCACTGCACACAGACATGAAGG + Intronic
993262616 5:85679340-85679362 GCCACTGCACACAGCAGTCTGGG - Intergenic
995741776 5:115363538-115363560 GCCTCAGCAGACTGCAGTGTGGG + Intergenic
996009926 5:118470976-118470998 GCCACTTCAGATAGAGGTGCAGG - Intergenic
996401612 5:123069153-123069175 GTGAATGCAGACAGAAGTGGAGG + Intergenic
997382833 5:133449703-133449725 GCCATCTCAGACAGAAGTCTGGG - Intronic
998555366 5:143118040-143118062 CCCAGTGAAGGCAGAAGTGTTGG - Intronic
999209340 5:149874294-149874316 GCCAAGTCAGACAGAAGGGTAGG - Intronic
999591724 5:153155750-153155772 GCCACTGCATTGAGAAATGTGGG + Intergenic
999968178 5:156832254-156832276 CCCACTGCGGACAGAGATGTGGG + Intergenic
1001331235 5:170764125-170764147 GCCACTGCACACAGACATGAGGG + Intronic
1002061175 5:176626934-176626956 ACCCTTGCAGACAGAGGTGTGGG - Intronic
1002468756 5:179422220-179422242 GCCACTGCTGCCACAAGTGAGGG + Intergenic
1003591368 6:7439936-7439958 GCCACAGCAGACAGAAAAGTAGG - Intergenic
1005140658 6:22627874-22627896 GCCACGTCAGAAACAAGTGTGGG + Intergenic
1005732357 6:28710289-28710311 AGCACTGCAGACAGAAAAGTAGG + Intergenic
1007582456 6:42967560-42967582 GCAGCTGCAGACAGAGGAGTGGG + Exonic
1007618080 6:43194074-43194096 GTTACTCCAGACAGAAGTGCTGG + Intronic
1009197375 6:60703192-60703214 GTCATAGCAGACAGAAGTGGAGG - Intergenic
1009359566 6:62795138-62795160 GCCACTGCACACAGACATGAGGG - Intergenic
1010685243 6:78846804-78846826 GCAACTGCAGGCTGAAGTGCAGG + Intergenic
1010778266 6:79911416-79911438 GCTCCTACAGACAAAAGTGTTGG - Intergenic
1012066326 6:94556021-94556043 GCCACTGCACACAGACATGAGGG + Intergenic
1012316030 6:97783211-97783233 GCCACTGCACACAGACATGAGGG - Intergenic
1013072053 6:106738209-106738231 GCCAATGCTGGCAGAGGTGTGGG - Intergenic
1013095532 6:106941292-106941314 CCCACTGCAGAAGGATGTGTTGG + Intergenic
1013351181 6:109307224-109307246 GCCACTGAAGGTAGAAATGTGGG - Intergenic
1014321448 6:119933577-119933599 GCCAATGCAGACACAAGGGGTGG - Intergenic
1015278371 6:131406444-131406466 GCCACTGCACACAGACATGAGGG - Intergenic
1015371328 6:132456914-132456936 GCCACTGCAGACAGAAGTGTAGG + Exonic
1016164386 6:140922483-140922505 GCCACTGCAGCCAGTGGTCTTGG + Intergenic
1016321070 6:142846311-142846333 GCCTTTGCAGACAGAAGATTTGG - Intronic
1016354961 6:143208855-143208877 GCCACAGCCGACAGAAATGAAGG + Intronic
1016535546 6:145105234-145105256 GCCACTGCACACAGACATGAGGG + Intergenic
1016974483 6:149793633-149793655 CTCCCTGAAGACAGAAGTGTTGG - Exonic
1017375891 6:153767509-153767531 GCCCCTGCAGAGAGAATTGCCGG + Intergenic
1018455089 6:163944518-163944540 GCCACTGCACAGAGAAGTTTAGG + Intergenic
1019276769 7:180011-180033 GCCCCTGCAGACAGCAGCCTGGG + Intergenic
1020105336 7:5420107-5420129 GCCGCTGCAGCCAGAGGGGTGGG - Intronic
1020140588 7:5609499-5609521 GTCACAGCAGACAGCAGTGGGGG - Intergenic
1020791505 7:12633828-12633850 TCCAGTGCACACAGATGTGTTGG + Intronic
1020895588 7:13934917-13934939 GCCACTGCATACAGAAGCACAGG + Intronic
1023300903 7:38769981-38770003 GCCACTGCACACAGCAGTTGAGG - Intronic
1023359286 7:39399404-39399426 GCCAAGTCGGACAGAAGTGTGGG - Intronic
1024344985 7:48304394-48304416 GCCACTGCAGAAAGCAGTGTGGG - Intronic
1024541763 7:50480504-50480526 GCCACGGTGGACAGAACTGTGGG + Intronic
1024601877 7:50989166-50989188 GCCAAGTCAGACAGAAGTGCTGG + Intergenic
1024729149 7:52235420-52235442 GTGACTGGAGACAGAAGTGCAGG - Intergenic
1024886468 7:54147998-54148020 GCCAAGTAAGACAGAAGTGTGGG - Intergenic
1025288011 7:57684757-57684779 GCTACTGCTGACAAAACTGTTGG - Intergenic
1026573955 7:71556432-71556454 CCCACTGTAGACAGAACCGTTGG - Intronic
1028675271 7:93452785-93452807 ACCAGGGCAAACAGAAGTGTAGG + Intronic
1029697549 7:102224035-102224057 GCCACAGCAAACAGACGCGTTGG - Intronic
1029989862 7:104953189-104953211 GCTACTGCAGACAGAATTCAAGG - Intergenic
1030081661 7:105783833-105783855 GCCAAGTCAGACAGAAATGTGGG + Intronic
1030512637 7:110503077-110503099 GCCACTGCAGCTAGAGGTGGAGG + Intergenic
1032851554 7:135799549-135799571 GCCACTGAAAACAGGAGTGGAGG - Intergenic
1033458670 7:141525506-141525528 GCCAAGTCAGACAGAAGTGTGGG + Intergenic
1034772533 7:153794064-153794086 GGCAGTGCAGACGGAAATGTGGG + Intergenic
1037519164 8:19662937-19662959 GACACTGCAAACAGATGTTTGGG - Intronic
1037670625 8:21012404-21012426 CCCACTGCAAACATCAGTGTGGG + Intergenic
1038483291 8:27916565-27916587 GCCACTGCAGACAGCAGTATGGG + Intronic
1039455562 8:37703710-37703732 GCCACTGGAGACTGAACTGAAGG - Intergenic
1039899278 8:41739887-41739909 GCCACTGCTGGGAGAAGAGTAGG - Intronic
1041008543 8:53519083-53519105 GCCAAGTCAGAGAGAAGTGTAGG + Intergenic
1041020930 8:53637750-53637772 GCCATTGAAGACAGAAGCATAGG - Intergenic
1041157413 8:55002862-55002884 ACCACTGCAGACAGGGATGTCGG + Intergenic
1042373934 8:68026444-68026466 GGCACTGCAGAAAGAAGGTTTGG + Intronic
1043415477 8:80043843-80043865 GCGAATGCAGACAGAGGTGGCGG + Intronic
1043946897 8:86263530-86263552 GCCACATCAGATAGAAGTGTGGG + Intronic
1044562477 8:93626809-93626831 GCCACTGCACCCAGGACTGTAGG - Intergenic
1045412416 8:101932076-101932098 GCCACTGAAAACAGAGGGGTAGG - Intronic
1047019469 8:120759542-120759564 GCCACAGCAGCCATAACTGTTGG + Intronic
1047168264 8:122464533-122464555 GCCAGCTCAGACAGAAGTGTGGG + Intergenic
1047249538 8:123171295-123171317 GCCAAGCCAGACAGAAATGTGGG + Intergenic
1048201717 8:132380262-132380284 GCCAGTGAAGACCAAAGTGTAGG + Intronic
1048825599 8:138422663-138422685 GCCACTGTAGAAAGCAGTTTGGG + Intronic
1049164314 8:141116987-141117009 GTCAGTGCAGTCAGCAGTGTGGG + Intergenic
1050267618 9:3907256-3907278 TCCACAGCAGCCAGCAGTGTGGG + Intronic
1050752286 9:8953913-8953935 GCCACTGCGGAAAGCAGTTTGGG + Intronic
1052192045 9:25672549-25672571 GCCACTGCACACAGACATGAGGG - Intergenic
1055067997 9:72138067-72138089 GCAGCTGCAGACAGATGTATGGG - Intronic
1056038098 9:82630557-82630579 GCAACTGCAGAAAGATGTATGGG + Intergenic
1056667931 9:88596823-88596845 GCTAAAGTAGACAGAAGTGTAGG - Intergenic
1057386265 9:94608293-94608315 GGCACCGCAGACAGAAGGGCTGG + Intronic
1061714010 9:132507457-132507479 GCGGCTGCAGACAGAAGGCTGGG - Intronic
1061716626 9:132522299-132522321 GACACTGCAGCCGGAAGGGTGGG + Intronic
1203461404 Un_GL000220v1:43329-43351 ACCACTGCAGACAGAATCTTGGG - Intergenic
1203612544 Un_KI270749v1:22255-22277 GCTACTGCTGACAAAACTGTTGG + Intergenic
1186660748 X:11665454-11665476 GCCTCTGCAGTCGGAAGAGTGGG - Exonic
1188444463 X:30242099-30242121 GGCACAGCAGGCAGGAGTGTAGG - Exonic
1191850878 X:65585195-65585217 GCCACTGTGGAAAGCAGTGTAGG - Intergenic
1192887989 X:75357427-75357449 GCAACTAGAGCCAGAAGTGTTGG - Intergenic
1192991297 X:76460370-76460392 GCCACTGTGGAAAGAAGTTTGGG + Intergenic
1194080944 X:89464918-89464940 GCCGCTGCAGATAAAAGTGCAGG + Intergenic
1194598172 X:95885723-95885745 GTCACTTCAGACAGAACTATGGG + Intergenic
1194617872 X:96129574-96129596 GACAATGCAGACAGAAGTGCAGG - Intergenic
1195212313 X:102661429-102661451 GCTAAGTCAGACAGAAGTGTGGG - Intergenic
1195218352 X:102722178-102722200 GCTAAGTCAGACAGAAGTGTGGG - Intronic
1195671961 X:107477369-107477391 CCTACTGCAGAGAGAACTGTTGG + Intergenic
1196165760 X:112534246-112534268 GCCACTGCACACAGACATGAGGG - Intergenic
1196245895 X:113400057-113400079 GCCAAGTCAGACAGAAGTGCAGG - Intergenic
1196331039 X:114470392-114470414 GCCACTGCACACAGACATGAGGG - Intergenic
1199415685 X:147580440-147580462 GCCACTGTAGAAAGCAGTTTGGG + Intergenic
1200100143 X:153686101-153686123 GGTACTGGAGACAGAAGTGAAGG - Intronic
1200411655 Y:2867722-2867744 GCCACTGCAGTCACACATGTTGG + Intronic
1200433619 Y:3121123-3121145 GCCGCTGCAGATAAAAGTGCAGG + Intergenic
1200845631 Y:7829333-7829355 TCCAGTGCACACAGAGGTGTTGG - Intergenic