ID: 1015373516

View in Genome Browser
Species Human (GRCh38)
Location 6:132483161-132483183
Sequence TGTTGTCTTTGGGAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 350}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015373516_1015373521 13 Left 1015373516 6:132483161-132483183 CCATCCACCTCCCAAAGACAACA 0: 1
1: 0
2: 3
3: 33
4: 350
Right 1015373521 6:132483197-132483219 CTCAAGTTTCTAATATAAAATGG 0: 3
1: 33
2: 245
3: 876
4: 1577

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015373516 Original CRISPR TGTTGTCTTTGGGAGGTGGA TGG (reversed) Intronic
900237066 1:1597977-1597999 TGTGTTATTTGGGAGGTGGGAGG - Intergenic
900651075 1:3730326-3730348 TCCTGGCTGTGGGAGGTGGAGGG + Intronic
901544804 1:9948078-9948100 TGCTGTGTCTGGGATGTGGAAGG + Intronic
902555879 1:17246313-17246335 TGTTGTCCCTGAGAGATGGAGGG - Intergenic
904092794 1:27956924-27956946 GGGTATCTTGGGGAGGTGGAGGG + Intronic
907694374 1:56707077-56707099 TATTGCCTTGGGGAGGTGGAGGG - Intronic
908740229 1:67319806-67319828 TGGGGTCTTTGGGAGGTGATTGG + Intronic
909658324 1:78055264-78055286 TGGGGTCTTTGGGAGGTGACTGG - Intronic
910920747 1:92343810-92343832 TATTGGGTTTGGGAGGTAGAGGG + Intronic
911105076 1:94123281-94123303 TGATGTCTTTGGGAATTGGAAGG - Intergenic
911618771 1:100042949-100042971 TATTGTCTTTGGCAGGTGTGTGG + Intronic
913218032 1:116636767-116636789 TGCTGTCTTTGGAGTGTGGAAGG - Intronic
913588832 1:120303083-120303105 TGTTGCCTTTGAGAGGTAGGGGG + Intergenic
913608755 1:120490528-120490550 AGTGATCTATGGGAGGTGGAGGG + Intergenic
913619353 1:120595286-120595308 TGTTGCCTTTGAGAGGTAGGGGG - Intergenic
913986674 1:143572151-143572173 AGTGATCTATGGGAGGTGGAGGG - Intergenic
914205080 1:145519926-145519948 AGTGATCTATGGGAGGTGGAGGG - Intergenic
914370502 1:147020305-147020327 AGTGATCTGTGGGAGGTGGAGGG + Intergenic
914484192 1:148093105-148093127 AGTGATCTGTGGGAGGTGGAGGG - Intergenic
914570856 1:148914954-148914976 TGTTGCCTTTGAGAGGTAGGGGG + Intronic
914582440 1:149031310-149031332 AGTGATCTATGGGAGGTGGAGGG - Intronic
914601974 1:149215309-149215331 TGTTGCCTTTGAGAGGTAGGGGG - Intergenic
914747762 1:150512167-150512189 TGTGGGCTTGGGAAGGTGGACGG - Intronic
915528994 1:156492738-156492760 AGTTGTGTTGGGGAGGTGGAAGG - Intronic
915732729 1:158065714-158065736 TGACGTCTTTGGGAAATGGAAGG - Intronic
916731128 1:167567761-167567783 TTTTCTCTTTGGGAGGAGGCAGG + Intergenic
918241708 1:182626075-182626097 TGGTATCTTAGGGAAGTGGAGGG + Intergenic
919804931 1:201375909-201375931 TGCTATTTTTGGGAGCTGGATGG - Intronic
919848384 1:201655867-201655889 TGATGCCTTTGGAATGTGGAGGG + Intronic
921124246 1:212162748-212162770 TTTTGTCTGTGGGTGGTGGATGG - Intergenic
922471145 1:225878092-225878114 TGTTGTCTGTGGCTCGTGGATGG - Intronic
922988673 1:229886534-229886556 TGATTTATTTGGGAGGTGGATGG - Intergenic
923340144 1:233000075-233000097 TGCTGGCTCTGTGAGGTGGAGGG + Intronic
1062951422 10:1506797-1506819 TGGAGTCTTTGGGAGGTGATTGG + Intronic
1063386479 10:5619477-5619499 TGTGGTCTGTGGGACTTGGAGGG - Intergenic
1063725989 10:8638184-8638206 ACTTGTCTTTGGGAGGGGCAGGG - Intergenic
1066202075 10:33151505-33151527 TGTTGCCTTAGGGATGTGAATGG + Intergenic
1066279913 10:33906464-33906486 TGGTGTCTCTGGGTGGAGGATGG + Intergenic
1069281439 10:66659617-66659639 TGGGACCTTTGGGAGGTGGATGG + Intronic
1069399305 10:68025644-68025666 TGTTTACTTTTGGAGCTGGAGGG - Exonic
1069633195 10:69910097-69910119 TGGTTTCTTTGGGATGTGGAGGG + Intronic
1069670436 10:70197639-70197661 TGTTGTCTTTCAGTGGTGGAAGG - Intergenic
1069766938 10:70869314-70869336 TGTTGTCTTTCAGAGTTGGAAGG + Intronic
1069926824 10:71856267-71856289 TGCTGTCTTGGAGGGGTGGATGG + Intergenic
1073594550 10:104786882-104786904 TGCTGCCTTGGGGTGGTGGAAGG - Intronic
1074672039 10:115802130-115802152 AGTAGTCTCTGGGAGGAGGAAGG - Intronic
1076839028 10:133036247-133036269 TCTTGCTTTTGGGAGGAGGAAGG - Intergenic
1077295999 11:1826572-1826594 TGGGCTCTCTGGGAGGTGGATGG - Intergenic
1078393711 11:10958683-10958705 TGTTGTCTGTGGGAGCTTGTGGG - Intergenic
1079802017 11:24880469-24880491 TGGTGTCTTTGTTAGGGGGACGG + Intronic
1083989631 11:66239000-66239022 TGGTGGCTGGGGGAGGTGGAAGG + Intronic
1084389363 11:68865213-68865235 TGGTGTCTTTGCAAGGGGGAAGG - Intergenic
1085662690 11:78383810-78383832 TAAGGTCTCTGGGAGGTGGAGGG + Intronic
1088589368 11:111389901-111389923 CGTTGGCTTTGTGAGCTGGAAGG - Intronic
1088802296 11:113317310-113317332 GGTTTTATTTGGGAGGGGGAGGG - Intronic
1089015891 11:115165002-115165024 TGGTGTGTGTGGGAGGTGGCAGG - Intergenic
1089180889 11:116582147-116582169 TGTTGTCTTTAGAAGCTGGTGGG + Intergenic
1089232400 11:116990854-116990876 TAATGATTTTGGGAGGTGGAGGG - Intronic
1089604335 11:119633088-119633110 TGAGGCCTTTGGGAGGTGAATGG + Intronic
1091875780 12:3931737-3931759 TTTTTTCTTTGGGTGGTGGGCGG - Intergenic
1091968733 12:4767467-4767489 TGCTGTCTTTGTGAGGAAGAGGG + Intronic
1092162802 12:6325179-6325201 TGTTGGCTTGGGGAGGGGGAGGG - Intronic
1092387733 12:8049018-8049040 TTCTGTCTTTGGGAGGGAGAAGG + Intronic
1092738163 12:11603534-11603556 TGTTTGTTTTGGGGGGTGGAGGG + Intergenic
1093463639 12:19428473-19428495 TGTGGTGTTAGGGAGGAGGAAGG + Intronic
1095600770 12:44010479-44010501 TAAGGTCTCTGGGAGGTGGAGGG - Intronic
1095843240 12:46717476-46717498 TGTTTTCTTTGTGAGATGGTTGG + Intergenic
1096061962 12:48708966-48708988 TGTAGTCTTGGTAAGGTGGAAGG + Intronic
1096093376 12:48918049-48918071 TGCTGCATTTGGGAGGAGGAGGG - Intronic
1096125333 12:49115121-49115143 TGTTGTCGTTGGGAGTTAGGAGG + Intergenic
1096380159 12:51150030-51150052 TGTTGCCTCTGGGAGTTGGAGGG - Intronic
1097557930 12:61163597-61163619 TGTTTTTTGTGGGAGGTGCATGG - Intergenic
1098145136 12:67489991-67490013 TGTTGCCTTTGGGCTTTGGAGGG + Intergenic
1099026014 12:77465277-77465299 TGGGGTGTTTGGAAGGTGGAGGG + Intergenic
1100845417 12:98653319-98653341 TGTTTTCTTTGGGTGGTGATTGG + Intronic
1101498713 12:105281102-105281124 TGTTGAATTTGGGAGGAGGGAGG - Intronic
1103199744 12:119078069-119078091 TGTTGTCTTTGGGTAGAGGAGGG - Intronic
1103334141 12:120176550-120176572 AGTTCTTTTGGGGAGGTGGAGGG + Intronic
1104462117 12:128964421-128964443 TGAGGTCTTTGGGAGGTGACTGG - Intronic
1104552123 12:129766781-129766803 TGTTGCCTTTGTGAGGTAGGAGG + Intronic
1107106053 13:36643985-36644007 GCTTGTGTTTGAGAGGTGGAAGG - Intergenic
1107115943 13:36745580-36745602 TGTTGGCTTGGAGAGGTTGAGGG - Intergenic
1107218273 13:37948318-37948340 TGTTATCTTGGGGTTGTGGAAGG - Intergenic
1107293321 13:38882086-38882108 CCTTGGCTTTGGGAGGTGAATGG - Exonic
1107505686 13:41030813-41030835 TGTTTTTTTTGGGGGGTGGGGGG + Intronic
1107765804 13:43733254-43733276 TGTTGTATTTGGGAGGTGGTGGG - Intronic
1110321541 13:74165705-74165727 TGTATTCTTTTGGAGGAGGAAGG + Intergenic
1111692806 13:91585617-91585639 GGTTGTGTTTGGGGGGTGGAGGG + Intronic
1112065739 13:95790790-95790812 TGTTTTCTTTGGGCAGAGGAGGG - Intronic
1112377141 13:98853909-98853931 TGTTGTCCTCAGGAGGTGGTTGG - Intronic
1113205501 13:107911424-107911446 TGTTGGCCTTAGGAGATGGATGG + Intergenic
1114152317 14:20057180-20057202 TGTTTTCTTTGGGGGGTGGTGGG - Intergenic
1114652124 14:24291836-24291858 TGCTGTCTTTGCTAAGTGGAAGG + Intronic
1117788342 14:59311339-59311361 TATTTGCTGTGGGAGGTGGAGGG + Intronic
1118428248 14:65691105-65691127 TGGTTTTTTTGGGGGGTGGAGGG + Intronic
1119163742 14:72475086-72475108 AGTTGTCCTGGGGAGGTGGCAGG + Intronic
1119735042 14:76976346-76976368 TGGTGTGTGTGGGAGGTGGGAGG - Intergenic
1120862858 14:89270326-89270348 TGTTGTCTGTCGGGGGTGGAAGG + Intronic
1122193763 14:100068958-100068980 TGTTGTCTTTGGTAGGCTGTGGG + Intronic
1124367309 15:29081252-29081274 TGGTGTATTTGGGTGGGGGATGG + Intronic
1126037194 15:44557698-44557720 TGTTCTCTTCAGGAGGTTGAAGG + Intronic
1126850520 15:52794377-52794399 TCTTCTCTTTGGGATATGGAAGG - Intergenic
1129889581 15:79062940-79062962 TGTTGTCGTAGGGGGGTGGGTGG + Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130383615 15:83392782-83392804 TGTTGTCTATGGGAGTGTGAAGG + Intergenic
1130451469 15:84057801-84057823 TTTTGTGTTTGGGAAATGGAGGG + Intergenic
1131095446 15:89651820-89651842 TGAGGGCTTTGGGAAGTGGATGG + Intronic
1131559345 15:93425756-93425778 TGAGGTATTTGGGAGGTAGAGGG + Intergenic
1132611034 16:816419-816441 TGGTGCCCTTGGGAGGTGCAGGG + Intergenic
1133320997 16:4913882-4913904 GCTTGTCTTTGTGAGGTGCAGGG - Intronic
1134272082 16:12741724-12741746 TGTTGTCTTTGAGAGGAGAGAGG - Intronic
1135654486 16:24235822-24235844 TCTTGGCTTTGGGAGGAAGAGGG - Intergenic
1135792044 16:25405824-25405846 TGCTGTCTCGGGGAGGCGGAAGG + Intergenic
1136474481 16:30504220-30504242 TTCTCTCTTTGGGAGGAGGAAGG + Exonic
1138405435 16:56789025-56789047 TTTCTTTTTTGGGAGGTGGAGGG + Intronic
1139406353 16:66721535-66721557 GGTTCTTTTTGGGAGGTGGGAGG - Exonic
1140200996 16:72894609-72894631 TGTTTTCATTTGGAGGAGGAGGG + Intronic
1140210102 16:72962843-72962865 TGTGGTCCCTGGGAGGTGCAGGG + Intronic
1140289930 16:73644070-73644092 TGTTGTTTGTGGTGGGTGGATGG - Intergenic
1140388826 16:74567172-74567194 TGTTGTGTGTGGGGGGTGTAGGG + Intronic
1140778510 16:78272876-78272898 TGTTGTCTTGTGGGGGTGAAAGG - Intronic
1141035439 16:80621825-80621847 CCTTGTCTTAGGCAGGTGGAGGG + Intronic
1141326606 16:83065802-83065824 TACTGTCTTTGGGTGGTAGATGG + Intronic
1142754375 17:2007237-2007259 TGTTTTCTTTGGGATCTGGGTGG - Intronic
1142877962 17:2863718-2863740 TCTTGTCTTTGGTTGATGGATGG + Intronic
1143801208 17:9382946-9382968 TGGGGCCTTTGGGAGGTGAATGG + Intronic
1144278902 17:13704573-13704595 TTTTGAGTTTGGGAGGTAGAGGG - Intergenic
1144749492 17:17638615-17638637 TGGTGCCTTTGGGAGGTAGTTGG + Intergenic
1145957979 17:28867981-28868003 AGGTGTCTTTTGGAGATGGATGG - Intergenic
1146115911 17:30138670-30138692 TGTATACTTTGGGGGGTGGAGGG + Intronic
1146461967 17:33053385-33053407 TATTCTTTTTGGGAGTTGGAGGG + Intronic
1147843581 17:43389452-43389474 TGTTGTGTTAGGAAGGAGGACGG - Intergenic
1147906363 17:43825638-43825660 TGTTGTCCTGAGGAGGTGGCAGG - Intronic
1150612206 17:66742673-66742695 TGCTGACTTTGGGATGTGCAAGG + Exonic
1151079922 17:71317305-71317327 TGTGGTCTTTGGGTGGTGATTGG + Intergenic
1151127943 17:71865489-71865511 TGATTTTTTTGGGGGGTGGAAGG - Intergenic
1151736131 17:75941346-75941368 TGTTGATATTGGGAGGTTGACGG + Intergenic
1151922882 17:77170938-77170960 TGTTGTGTTTGGGAAAGGGATGG + Intronic
1152320903 17:79608466-79608488 TTTTTTCTTTGGGGGGAGGAGGG + Intergenic
1155179703 18:23333808-23333830 TGTTCTTTTCTGGAGGTGGAGGG + Intronic
1155349746 18:24894887-24894909 TATTTTGTTTGTGAGGTGGAAGG + Intergenic
1156472399 18:37385572-37385594 TGTGGGCTGGGGGAGGTGGAGGG - Intronic
1156706105 18:39884339-39884361 TCTTCTCTATGGGAGGTGAAAGG - Intergenic
1156999871 18:43511312-43511334 TGTTGTGCTTGGGAAGGGGATGG + Intergenic
1157162138 18:45323807-45323829 TTTTGGTCTTGGGAGGTGGAAGG - Intronic
1157332091 18:46711544-46711566 TGTTGCCTTTGGGAGGGGGAAGG - Intronic
1157937284 18:51887142-51887164 TGCTGTCTTTGGTAGATGAAAGG + Intergenic
1158512596 18:58104864-58104886 GGATGTGTTTGGGGGGTGGAGGG - Intronic
1159215936 18:65390647-65390669 TGGGGCCTGTGGGAGGTGGAGGG + Intergenic
1159787308 18:72729693-72729715 AGTTACCTTTGGGAGGAGGAAGG - Intergenic
1161168663 19:2802231-2802253 TGTTGGTGTTGGGAGGTGGGTGG - Intronic
1161991270 19:7685738-7685760 TGTTGGCTGTTGGAGGTGGAGGG + Exonic
1163675064 19:18651575-18651597 TGTTGTCTTTGGAAGGTGCTGGG + Intronic
1164692592 19:30222474-30222496 TGTTGGGAGTGGGAGGTGGAGGG - Intergenic
1165087237 19:33359140-33359162 TGTGGTCTTGGGGTGGGGGAAGG - Intergenic
1165209550 19:34223077-34223099 TCTTTTTTTTGGGGGGTGGAGGG + Intronic
1166890937 19:45992533-45992555 GCTTGACTTTGGGAGGTGGAGGG + Intergenic
1167338448 19:48900769-48900791 TGTGGTCTGTGGGGGATGGAGGG - Exonic
1168447854 19:56437713-56437735 TTTAGTGTGTGGGAGGTGGATGG + Intergenic
926982319 2:18584926-18584948 TGCAGGCTTGGGGAGGTGGATGG + Exonic
928225905 2:29447784-29447806 TCTTGTCTTTGGGATGGGGTGGG + Intronic
928345836 2:30494856-30494878 TTTTCTGTTTGGGGGGTGGAGGG + Intronic
928722897 2:34141067-34141089 TGTTGGATTTGGGGGATGGAAGG - Intergenic
930887818 2:56348273-56348295 TGTTGGCTTCAAGAGGTGGATGG - Intronic
931774448 2:65528458-65528480 TCTGGTCTTTGTGATGTGGATGG + Intergenic
932013310 2:67999762-67999784 TGGGGTCTTTGGGAAGTGAATGG - Intergenic
932207945 2:69900478-69900500 TGTATTTTTTTGGAGGTGGAAGG - Intronic
933164909 2:79065273-79065295 TGTTGTCTGATGGGGGTGGAAGG - Intergenic
933673663 2:85033681-85033703 TGGTGTCTTTAGGAGGTGATAGG - Intronic
934033812 2:88071688-88071710 TGTTGTGGTTGGGGGCTGGAAGG + Intronic
935032942 2:99339546-99339568 TTTTGTTTTTTGGAGATGGAGGG + Intronic
935330521 2:101974210-101974232 TGTTTTCTTTGGGAATTGAATGG + Intergenic
935546696 2:104406972-104406994 AGGTGTGTTTGGTAGGTGGAGGG - Intergenic
936224679 2:110637347-110637369 TGTTGACTTTCAGAGCTGGAAGG - Intergenic
937077298 2:119116675-119116697 TGTGGCCTTGGGGAGGAGGAAGG - Intergenic
937847104 2:126591493-126591515 TGTTATGTTATGGAGGTGGATGG + Intergenic
937907053 2:127057559-127057581 GGGTGTGTTTGGGAGGCGGAGGG + Exonic
938310059 2:130283969-130283991 GGGTGTCTTAGGGAGGGGGAAGG + Intergenic
938444860 2:131368400-131368422 GGGTGTCTTAGGGAGGGGGAAGG - Intergenic
939140294 2:138346339-138346361 TGATGTCTCTGGCAGGAGGATGG - Intergenic
939459741 2:142484462-142484484 TATTGTCTTTTGGTGGGGGATGG + Intergenic
941078562 2:161033936-161033958 TTTTATCTTAGGGAGGTTGATGG - Intergenic
942058513 2:172206923-172206945 TGGGGTCTTTGGGAAGTGAATGG - Intergenic
943731544 2:191307962-191307984 TGTTTTTTTGGGGAGATGGAGGG - Intronic
944654769 2:201866618-201866640 TCTTGTCTTTGGAAGGAGAAGGG + Intronic
944948825 2:204723006-204723028 TGTTATCTCTGGGAGGTGATTGG + Intronic
945185099 2:207132507-207132529 TGTTTCCTTGGGGAGGTGGGTGG + Intronic
945322304 2:208438762-208438784 TGATGTTTTGGGGAGGTGGGGGG + Intronic
946553340 2:220827132-220827154 TGTGGCCTTTGGGAGGTGATTGG + Intergenic
947247571 2:228066563-228066585 TGTTCTCTCTGGAAGGTGAAGGG - Intronic
948827045 2:240577910-240577932 TGTGGTGTCTGGGAGGTCGAGGG - Exonic
1169010195 20:2244070-2244092 TTTTGTATATGGTAGGTGGAGGG - Intergenic
1172492943 20:35355728-35355750 GGTTGTCTTTGGGAGAGGAACGG - Intronic
1172812378 20:37657907-37657929 TGTTTCCCTTGGGAGGGGGATGG - Intergenic
1173057322 20:39627978-39628000 CGTTGTATGTGAGAGGTGGAGGG + Intergenic
1173706629 20:45115002-45115024 TGCTGTCTTTGGCAGGAAGAAGG - Exonic
1174193700 20:48758065-48758087 TAGTTTCTTTGGGAGGTGGGAGG + Intronic
1176018976 20:62953029-62953051 TGTTCCTTGTGGGAGGTGGAAGG + Intronic
1176734512 21:10532144-10532166 TGTGGTGTTTGGGAGAGGGAAGG + Intronic
1178136875 21:29637528-29637550 TGGGGGCTTTGGGAGGTGAATGG + Intronic
1178476333 21:32940474-32940496 TGTTGTCCTTGGAAAGTTGAAGG + Intergenic
1178729657 21:35089094-35089116 TGTTATCTTTGGGGAGTAGAGGG + Intronic
1178860480 21:36285062-36285084 TGTTGTTGTTGGGAGGGGAACGG + Intronic
1179392017 21:41002617-41002639 TGTTGTCTTTGGCAAAGGGAGGG - Intergenic
1180819333 22:18814851-18814873 TGCTGTCTTTGGAGTGTGGAAGG - Intergenic
1181011728 22:20044765-20044787 TGATGTCCTTGGAAGGTGGAAGG + Intronic
1181205558 22:21249296-21249318 TGCTGTCTTTGGAGTGTGGAAGG - Intergenic
1181492358 22:23268566-23268588 TGTTCTCCTCGGGAGGTGGAGGG - Intronic
1181975211 22:26724060-26724082 TGGGACCTTTGGGAGGTGGATGG - Intergenic
1182505926 22:30782308-30782330 GGTTGTCTGCAGGAGGTGGAAGG - Intronic
1184170955 22:42759448-42759470 TTTTGTCTATGGGAGTGGGAAGG - Intergenic
1184318273 22:43716690-43716712 TGCTGTTATTGGGAGGTAGAGGG + Intronic
1203221365 22_KI270731v1_random:46117-46139 TGCTGTCTTTGGAGTGTGGAAGG + Intergenic
1203269461 22_KI270734v1_random:40704-40726 TGCTGTCTTTGGAGTGTGGAAGG - Intergenic
949653812 3:6193259-6193281 TCTTGTTTTTGGCAGGAGGAGGG - Intergenic
949797670 3:7868415-7868437 AGTTGTGGGTGGGAGGTGGAAGG - Intergenic
950145408 3:10646394-10646416 GGCTGACTTGGGGAGGTGGAAGG - Intronic
950490272 3:13300469-13300491 TTGGGTCTTTGGGAGGTGGTTGG - Intergenic
950496804 3:13338776-13338798 GGTGGTCCTTGGCAGGTGGAGGG - Intronic
950608437 3:14106831-14106853 GGTTCTTTTTGGGAGGTGGGAGG + Intergenic
950741586 3:15056543-15056565 TGTGGTCAGAGGGAGGTGGAAGG + Intronic
951057553 3:18164949-18164971 TGGTTTATTTGGGAGGTGCAGGG - Intronic
951204426 3:19910360-19910382 CTCTGTCTTTGGGAGGGGGAGGG + Intronic
951688720 3:25373200-25373222 TGAAGTCTTTGGCATGTGGATGG + Intronic
954485088 3:50841229-50841251 TGTTGACTTTAGCAGCTGGAAGG + Intronic
954787689 3:53106570-53106592 TGTTCATTTTGGGAGGTGGGAGG - Intronic
955212831 3:56958180-56958202 TGTTTTCTTTGGAACCTGGAGGG - Intronic
955748331 3:62162524-62162546 TGAGGGCTTTGGGAGGTGGACGG + Intronic
955961986 3:64350159-64350181 TGTTGAATTTTGGAGCTGGAAGG + Intronic
956826222 3:72998883-72998905 TGTAGTCTTTGGGTGGGGGCTGG + Intronic
957540458 3:81562720-81562742 TATTTTCTTTGAGAGGTTGAGGG - Intronic
959254938 3:103997478-103997500 TTTTGTCTTGGAGAGGTAGAAGG - Intergenic
959982681 3:112534537-112534559 TTTTGTGTTTCGGAAGTGGAGGG - Intronic
960943405 3:122949265-122949287 TGTTGTTTTTGGGGAGAGGAGGG - Intronic
961682985 3:128611286-128611308 TGTTGTCTTTGTGGAGTGGGGGG - Intergenic
962708524 3:138067258-138067280 TGTTAACTGTGGGAGGTTGAAGG - Intronic
963840798 3:150104019-150104041 TGTTCCTTTTGGTAGGTGGAAGG + Intergenic
964658213 3:159091493-159091515 TGCAGTCTTTGGGAGGTGATTGG - Intronic
964711100 3:159672656-159672678 TGTTGTTTTTGTGAGGTGAGGGG - Intronic
964957338 3:162377522-162377544 TGTTATTTTTTGGAGATGGATGG - Intergenic
965055891 3:163715675-163715697 TTTTATTTTTGGGGGGTGGAGGG - Intergenic
966625425 3:182010948-182010970 GGAGGTATTTGGGAGGTGGAGGG - Intergenic
967119743 3:186372259-186372281 TTTTGTGTTTGGGTGGTGAATGG + Intergenic
969299527 4:6289575-6289597 TGTTCACTTTGGGAGGAGGCAGG + Intronic
969634328 4:8357781-8357803 TGTTGTCTGTGGGCGGCGGAGGG - Intergenic
969646314 4:8431521-8431543 TGTTGTATTTGGGACCTGGGTGG + Intronic
969959177 4:10925871-10925893 TGGAGGCTTTGGGAGGTGGTGGG + Intergenic
970797091 4:19925966-19925988 TGTGGTCTTTGGGAGGTGATTGG + Intergenic
972357710 4:38296606-38296628 TGATGTCTTTGAGGGGTGGGGGG - Intergenic
972586348 4:40440281-40440303 TGTTTTCTTGAGGAGGTGGGAGG + Intronic
973578482 4:52316559-52316581 TGATGGCTTTGGGAGATGGGGGG + Intergenic
975852950 4:78591607-78591629 TGTTGACTTTGGCAGATGTAAGG + Exonic
975903115 4:79176831-79176853 TCTTGTCCTTGGGACGTGCATGG - Intergenic
977555878 4:98486964-98486986 GGTTTTCTTTGGGAGGGGAAAGG - Intronic
978306893 4:107338948-107338970 GGTTTTCTTTGGGAAGTGGTGGG - Intergenic
979919357 4:126478809-126478831 AGGTGTCTTTGGGTGGTGGCAGG - Intergenic
980453288 4:133005535-133005557 TGTTGTCCTGGGGAGGTGGAAGG + Intergenic
981332833 4:143532676-143532698 AGGTGTTTTTGGGGGGTGGAGGG - Intronic
982379189 4:154730764-154730786 TGTGGTCATTGGAATGTGGAAGG + Intronic
982685473 4:158483631-158483653 TGTTATGTTTGGGAAGTGGTGGG - Intronic
983827649 4:172284388-172284410 TGGTGTGTGTGGGGGGTGGATGG - Intronic
984678311 4:182576750-182576772 TGTTGCCTTTGGTAGGTGCTGGG - Intronic
989003769 5:36787641-36787663 AGTTGTAGTTGGGGGGTGGAGGG + Intergenic
989158889 5:38371141-38371163 TTTTGTATTTGGGGAGTGGAGGG + Intronic
989717552 5:44482085-44482107 GGGTGTCTGTGGGAGGTGGTGGG + Intergenic
991944105 5:71883046-71883068 TTTTGTCTGTGGGAGGAGAAGGG + Intergenic
992367716 5:76110312-76110334 TGTGCTCGTTGGGAAGTGGATGG + Intronic
992836805 5:80649699-80649721 GCATGTCTTTGGGATGTGGAAGG - Intronic
993379319 5:87188000-87188022 TGTTGGCAGTGGGAAGTGGAGGG - Intergenic
994620877 5:102160466-102160488 TGTGGCCTTTGGAGGGTGGAGGG + Intergenic
995352366 5:111194261-111194283 TATTGCCTCTGGGAGGGGGAAGG - Intergenic
996443379 5:123515798-123515820 TGTTGTTACTGGGAGGTTGAAGG - Intronic
997248485 5:132370875-132370897 TGTCGTTTTTGGGTTGTGGACGG - Intronic
997382335 5:133446692-133446714 TGTAGACTTTGGGAGGGGGCTGG - Intronic
998383376 5:141741726-141741748 TGCAGTCTCTGGGAGGTGGGAGG + Intergenic
999784971 5:154882695-154882717 TGTTGTGCTTGGGAAGGGGATGG - Intergenic
1000110044 5:158099521-158099543 TGCTGTCTGTGGAAAGTGGAGGG - Intergenic
1000119912 5:158187573-158187595 TGTTGTGTGTGGGGGGAGGAGGG + Intergenic
1001096961 5:168782805-168782827 TATTGTCTTTGGGGGATGCAAGG - Intronic
1001280508 5:170383116-170383138 TTTTGTGTTTTGGAGGGGGAGGG + Intronic
1001396497 5:171422174-171422196 TGTTCTCCGTGGGAGCTGGAGGG + Intronic
1002090892 5:176805466-176805488 TGTTGTCTTTTGGAATTGGAGGG + Intergenic
1002218010 5:177653412-177653434 AGCTGTCTTTGGGAGGTTGGTGG - Intergenic
1003753065 6:9084006-9084028 GATTCTCTTTGGGAGCTGGATGG + Intergenic
1004719950 6:18260516-18260538 TTCTGTCTTTGGCAGGTGGGTGG - Intronic
1005001314 6:21244528-21244550 TATTGTTTTAGGGAGATGGAGGG - Intergenic
1005575195 6:27183690-27183712 TGTTGTGCTTGGGAAGGGGATGG - Intergenic
1006419831 6:33925949-33925971 TGCTGTCTTCAGGAGGAGGAGGG + Intergenic
1007759930 6:44127725-44127747 TTTTTTCTTTGGGTGGTGGTGGG - Intronic
1008172870 6:48231801-48231823 GTTTGTCTTTGGGAGGCTGAAGG + Intergenic
1009026579 6:58007326-58007348 TGTTGTCTCTGGGGAGCGGATGG - Intergenic
1010462815 6:76132626-76132648 GGTGGCCTTTGGGAGATGGAAGG - Intergenic
1010995645 6:82529159-82529181 TGCTATCTTTGGGGGTTGGAAGG - Intergenic
1011361993 6:86537096-86537118 TGTTGACTGAGAGAGGTGGATGG - Intergenic
1012034722 6:94119479-94119501 TCTTGTCTTTGGGTTTTGGAAGG - Intergenic
1015373516 6:132483161-132483183 TGTTGTCTTTGGGAGGTGGATGG - Intronic
1015671798 6:135699164-135699186 TGTTGTCTTGGGGAAGTTGGAGG + Intergenic
1015709682 6:136126276-136126298 TGTTGTTTTTGGGGGGTTGTGGG - Intronic
1015911990 6:138178260-138178282 TCTTGGCTTTGGCATGTGGAAGG - Intronic
1015935810 6:138404799-138404821 TCTTGTCTTTGCGGGGTGGTGGG + Intronic
1016641664 6:146356400-146356422 TTTTGTCCTTGTGTGGTGGAAGG + Intronic
1017067751 6:150545419-150545441 TATTCTGGTTGGGAGGTGGAGGG + Intergenic
1017892604 6:158651731-158651753 TGTTGTTTTTGGGTGGTAAAAGG + Exonic
1018166596 6:161103691-161103713 TGGTGTGTTTGGGATGTGGGAGG + Intronic
1018707802 6:166475626-166475648 TGCTGGCTTAGGAAGGTGGATGG - Intronic
1019847964 7:3525420-3525442 TCTTGTGTCTGGGAGGTTGATGG + Intronic
1021061771 7:16121391-16121413 TTTATTTTTTGGGAGGTGGAGGG - Intronic
1021434740 7:20601258-20601280 TGTTGTTTTTGGAGGGAGGAAGG + Intergenic
1021585833 7:22207096-22207118 TGTTATCTTTGTCAGGTTGATGG - Intronic
1022271302 7:28810447-28810469 TGATCACTTTGGGAGGTGGCTGG + Intronic
1022508229 7:30920065-30920087 TGTTGTCTTTGGGTAGGGGCTGG + Intronic
1022640754 7:32180439-32180461 TGTGGCCTTTGGGAGGTGATTGG + Intronic
1023559075 7:41453400-41453422 TGGGGTCTTTGGGAGGTGATTGG + Intergenic
1024210545 7:47199601-47199623 TGAGGTCTTTGGGAGGTGACTGG - Intergenic
1024450300 7:49532420-49532442 TGTTGTAGGTGGCAGGTGGAGGG - Intergenic
1024714602 7:52061882-52061904 TGTGGTCTGGGGGAGGTGGTGGG - Intergenic
1026309488 7:69171353-69171375 TGTGGTCATTGGGAGGTATATGG - Intergenic
1026358839 7:69584071-69584093 TGTTTTCTTTGGCAGGGGGAGGG - Intergenic
1027821238 7:83047870-83047892 TGTTGTGTGTGAGAGGTAGATGG - Intronic
1028122449 7:87071414-87071436 TTTTGACTTCGGGAGGTGGGAGG - Intergenic
1028253680 7:88565944-88565966 TGTTGTCTTTGGGGGGGGGGGGG + Intergenic
1028312720 7:89359168-89359190 TATTTTCTTTTGGAGGGGGAGGG + Intergenic
1028542809 7:91962341-91962363 TTTTGTCTTTTGGTGGAGGAGGG + Intronic
1028828875 7:95305250-95305272 TGCTGTTTTTCGGAGGTAGAGGG + Intronic
1029011677 7:97268651-97268673 GGTGGTCTTTGGAAGGTGGATGG + Intergenic
1031962980 7:128006405-128006427 TGTCCTATTTGGGAGGTGGGGGG - Intronic
1031992540 7:128207619-128207641 TTGTGACTTTGGGAGGTGGAGGG + Intergenic
1032312980 7:130805647-130805669 GGTTGAGTTTGGCAGGTGGAAGG + Intergenic
1033459499 7:141532592-141532614 TGTTGTGTTTTGGAGGAGGGAGG + Intergenic
1034853724 7:154520709-154520731 TGTTTTCTATGGGAGTGGGATGG + Intronic
1035038688 7:155911822-155911844 TGCAGGCTTTGGGAGGTGGGTGG + Intergenic
1035778846 8:2211267-2211289 AGTTGTCTGTGGAAGGTGAACGG - Intergenic
1035840358 8:2805446-2805468 TGATGTCTTTGGGAGGTCAAAGG + Intergenic
1036578365 8:10049981-10050003 TGCTGTCCTATGGAGGTGGAGGG + Intergenic
1037767266 8:21779943-21779965 TGGTGCCTTTGGGAAGGGGAGGG - Intronic
1038298610 8:26320950-26320972 TCTTGACTTTGGGAGGAGGATGG + Intronic
1038517847 8:28202438-28202460 GGCTGTCTTTGGGAGGGGCAGGG - Intergenic
1038883530 8:31639808-31639830 AGTTGTTTATGGGAGGAGGAGGG - Intronic
1039219915 8:35319082-35319104 TGTTGTCTGTGTGAAGTGCATGG + Intronic
1039328549 8:36511895-36511917 TTTTTTTTTTGGGTGGTGGAGGG - Intergenic
1039949116 8:42153663-42153685 TTTTTTTTTTTGGAGGTGGAGGG + Intronic
1040994669 8:53389617-53389639 TGGGGTCTTTGGGAGGTGATTGG - Intergenic
1041013344 8:53566589-53566611 TGTTGTTTTCTGGAGTTGGAAGG + Intergenic
1041117404 8:54553504-54553526 TGGGGTCTTTGGGAGGTGATTGG - Intergenic
1043270932 8:78332030-78332052 TTTTGTATTTGGGAAGAGGAAGG + Intergenic
1044742857 8:95345321-95345343 TACTGTGTTTGGGAGGTGGTTGG + Intergenic
1044944961 8:97381197-97381219 TGTAGGCTGGGGGAGGTGGAAGG - Intergenic
1044999413 8:97867516-97867538 TTATGTCTTTGGGAGGAGGTAGG - Intergenic
1046401199 8:113705506-113705528 TGAAGTCTTTGGGAGGTGATAGG + Intergenic
1046596226 8:116264390-116264412 TGTGGTCTTTGGTAGTTTGAGGG - Intergenic
1048077046 8:131082818-131082840 TGTTGTGGTTGTGAGGTGGGGGG + Intergenic
1048623032 8:136155545-136155567 TTTTCTCTTGGGCAGGTGGAAGG + Intergenic
1049815083 8:144595442-144595464 GCTTCTCTGTGGGAGGTGGATGG + Intronic
1051381351 9:16462212-16462234 TTTTTTCTTTGGCTGGTGGATGG - Intronic
1051557751 9:18403891-18403913 TGTTGTTTTTGGTTGGGGGAGGG + Intergenic
1051819036 9:21143099-21143121 TTTTGTCTAAGGAAGGTGGAAGG + Intergenic
1056116808 9:83448647-83448669 TGTGGTCTTAGGGAGGGGAATGG - Intronic
1056753100 9:89365559-89365581 TTTTGTCATTGTGAGGTTGATGG - Intronic
1056809838 9:89755733-89755755 TGTTATCTTTGGGGAGTTGAAGG - Intergenic
1058022280 9:100102178-100102200 GCTTGAATTTGGGAGGTGGATGG - Intronic
1059477720 9:114561270-114561292 GTTTGTCTTTGGAAGGTGCAGGG + Intergenic
1060766377 9:126297333-126297355 TGTTTTCTTTGGGTGGGGGGGGG + Intergenic
1061605228 9:131705114-131705136 AGGTGTCTTTGGGACTTGGAAGG - Intronic
1061936021 9:133858060-133858082 TCTTGTCTTCGGCATGTGGAGGG - Intronic
1185548177 X:962510-962532 TGTTGTCTTTTTTAGGTGGGTGG + Intergenic
1185603400 X:1354218-1354240 TGGGGTCTTTGGGAGGTGACTGG - Intronic
1188595869 X:31899584-31899606 TGTTGTCTCTAGGAGTTGGAAGG + Intronic
1188960566 X:36486584-36486606 TGTTTTCTCTGGAAGGTGGAGGG - Intergenic
1192964864 X:76166540-76166562 TGTGGCCTTTGGGAGGTGATTGG - Intergenic
1193047100 X:77065160-77065182 TGCTCTTTTTGGAAGGTGGAAGG - Intergenic
1193427509 X:81357231-81357253 TTATGTCTTTTGGAGCTGGAAGG + Intergenic
1193651661 X:84142041-84142063 TGCTATTTTTGGGTGGTGGAAGG - Intronic
1195241741 X:102959679-102959701 TGTTGTCTTTGGACTGGGGAAGG - Intergenic
1196413230 X:115442517-115442539 TGTGGTCTTTGGTAGGTGATTGG - Intergenic
1196760502 X:119196802-119196824 TGGGGTCTTTGGGAGGTGAATGG - Intergenic
1197095938 X:122595207-122595229 TGGAGCCTTTTGGAGGTGGAGGG - Intergenic
1198031597 X:132758661-132758683 TGTTGGCCTTGGGAGCTGAAAGG - Intronic
1198296897 X:135295981-135296003 TCAGGTCTTCGGGAGGTGGAGGG - Exonic
1199056310 X:143299180-143299202 TCTTTTCTTTGGAAGGTGGAAGG - Intergenic
1199502935 X:148529234-148529256 TGCTGGCTTTGGTAGGTTGAGGG + Intronic
1199533230 X:148872870-148872892 TGGAGTCTTTGGGAGGTGACTGG - Intronic
1199825757 X:151497976-151497998 GGTTGTCTTTGGAACTTGGAAGG - Intergenic
1199852438 X:151735286-151735308 TGTTCTCTTTGGTAGGTACATGG + Intergenic
1201066884 Y:10105603-10105625 TGGTGTTTTTGTGTGGTGGATGG - Intergenic
1201642967 Y:16198916-16198938 TGTTGTTATGGGGAGGTGTATGG + Intergenic
1201659848 Y:16386405-16386427 TGTTGTTATGGGGAGGTGTATGG - Intergenic
1202592538 Y:26501649-26501671 TGTGGTGTTTGGGAGAGGGAAGG + Intergenic