ID: 1015374040

View in Genome Browser
Species Human (GRCh38)
Location 6:132490221-132490243
Sequence CCTTCCTGTCATCCACTCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 127}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015374035_1015374040 12 Left 1015374035 6:132490186-132490208 CCGCTGACACATCTTTTGCCCAT 0: 1
1: 0
2: 2
3: 18
4: 232
Right 1015374040 6:132490221-132490243 CCTTCCTGTCATCCACTCGAGGG 0: 1
1: 0
2: 1
3: 13
4: 127
1015374034_1015374040 13 Left 1015374034 6:132490185-132490207 CCCGCTGACACATCTTTTGCCCA 0: 1
1: 0
2: 1
3: 11
4: 124
Right 1015374040 6:132490221-132490243 CCTTCCTGTCATCCACTCGAGGG 0: 1
1: 0
2: 1
3: 13
4: 127
1015374037_1015374040 -7 Left 1015374037 6:132490205-132490227 CCATCATGATGAGCTTCCTTCCT 0: 1
1: 0
2: 0
3: 24
4: 261
Right 1015374040 6:132490221-132490243 CCTTCCTGTCATCCACTCGAGGG 0: 1
1: 0
2: 1
3: 13
4: 127
1015374032_1015374040 18 Left 1015374032 6:132490180-132490202 CCAACCCCGCTGACACATCTTTT 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1015374040 6:132490221-132490243 CCTTCCTGTCATCCACTCGAGGG 0: 1
1: 0
2: 1
3: 13
4: 127
1015374033_1015374040 14 Left 1015374033 6:132490184-132490206 CCCCGCTGACACATCTTTTGCCC 0: 1
1: 0
2: 0
3: 9
4: 97
Right 1015374040 6:132490221-132490243 CCTTCCTGTCATCCACTCGAGGG 0: 1
1: 0
2: 1
3: 13
4: 127
1015374030_1015374040 20 Left 1015374030 6:132490178-132490200 CCCCAACCCCGCTGACACATCTT 0: 1
1: 0
2: 0
3: 15
4: 110
Right 1015374040 6:132490221-132490243 CCTTCCTGTCATCCACTCGAGGG 0: 1
1: 0
2: 1
3: 13
4: 127
1015374031_1015374040 19 Left 1015374031 6:132490179-132490201 CCCAACCCCGCTGACACATCTTT 0: 1
1: 0
2: 1
3: 8
4: 186
Right 1015374040 6:132490221-132490243 CCTTCCTGTCATCCACTCGAGGG 0: 1
1: 0
2: 1
3: 13
4: 127
1015374029_1015374040 30 Left 1015374029 6:132490168-132490190 CCTTGCAATTCCCCAACCCCGCT 0: 1
1: 0
2: 0
3: 17
4: 195
Right 1015374040 6:132490221-132490243 CCTTCCTGTCATCCACTCGAGGG 0: 1
1: 0
2: 1
3: 13
4: 127
1015374036_1015374040 -6 Left 1015374036 6:132490204-132490226 CCCATCATGATGAGCTTCCTTCC 0: 1
1: 0
2: 0
3: 24
4: 412
Right 1015374040 6:132490221-132490243 CCTTCCTGTCATCCACTCGAGGG 0: 1
1: 0
2: 1
3: 13
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015374040 Original CRISPR CCTTCCTGTCATCCACTCGA GGG Intronic
901199317 1:7457774-7457796 CCTTCCTGTTCCCCATTCGACGG + Intronic
911061416 1:93751274-93751296 TCTTCCTGTCACCCACTGCATGG - Intronic
912498525 1:110106721-110106743 CCTGCCTGTCATCCACTGGCTGG - Intergenic
915226910 1:154418400-154418422 CCTTCCTCCCATCCACACGATGG - Intronic
919766760 1:201132366-201132388 CCTCCCTGTGAGCCACACGAGGG + Intergenic
923330337 1:232917904-232917926 TCTTGGTGTCATCCACTCTAGGG - Intergenic
1064268859 10:13847539-13847561 CCTTCCTTCCTTCCACTGGATGG + Intronic
1064875193 10:19985966-19985988 CCTTCCAGTCCTCCAGTAGAAGG + Intronic
1065270584 10:24029392-24029414 TCTTCCTTTCATCTACTCTAAGG + Intronic
1065935846 10:30519846-30519868 CCTTCCTTTCATCTGCCCGAAGG - Intergenic
1067258565 10:44666533-44666555 CCTTCTTGTCATCCACAGCATGG + Intergenic
1068324628 10:55468014-55468036 ACTTCCTTCCATCCACCCGATGG + Intronic
1069860204 10:71466078-71466100 GCTTCCTCTCACCCACTCCAGGG + Intronic
1072625049 10:97105903-97105925 CTTTCCTGGCATCCACCTGATGG - Intronic
1074291369 10:112140168-112140190 CTTTCCTTTCCTCCACTTGAAGG + Intergenic
1076245757 10:128946024-128946046 GCTTCCTGTCATCCCCCAGAGGG - Intergenic
1076412809 10:130264000-130264022 CCTCCCTGGCATCCCCTAGATGG - Intergenic
1076745932 10:132514186-132514208 CCTTCCTGACATCCACACCAGGG - Intergenic
1077297205 11:1831835-1831857 CCTTCCTCTCAGACACCCGAAGG - Intronic
1078196801 11:9143375-9143397 CCTTCCTGCCCTCCAATCCAGGG - Intronic
1078853526 11:15187049-15187071 CCTTCCAGCCATCCCCTCCATGG - Intronic
1080791582 11:35526305-35526327 TCTTCCTGTGATCCCCACGATGG + Intronic
1081776801 11:45681326-45681348 CCATCCTGTCCTCCACTCTAAGG + Intergenic
1084285439 11:68128098-68128120 CCTCCCTGTCAGTCACTCAAAGG - Intergenic
1090863066 11:130671922-130671944 CCTCCCTGTCATCCAGTTTATGG + Intergenic
1091593062 12:1856857-1856879 CCTTTCTGTCATCCCCTCCTTGG - Intronic
1091715275 12:2772266-2772288 CCTTCCTGTCATGCATGTGATGG - Intergenic
1092114254 12:5987553-5987575 CCTGACTGTCAGCCATTCGAGGG - Intronic
1097169428 12:57104648-57104670 GCTTCCTGACATCCTCTCCAAGG + Intronic
1098143705 12:67476708-67476730 CCTTCATTTCCTCCACTCAACGG + Intergenic
1098873277 12:75840462-75840484 CCTTCATGTCATCCCCACCAGGG + Intergenic
1101242827 12:102855298-102855320 CCTCCATGTATTCCACTCGAGGG + Exonic
1101303015 12:103501166-103501188 CATGCCTTTCATCCACTCCAAGG - Intergenic
1102737671 12:115177723-115177745 ACTCCCTGTCAGCCACTTGAGGG - Intergenic
1103725268 12:122994665-122994687 CCTTCCTGTCTTCCCCACCAAGG - Intronic
1105612184 13:21978115-21978137 CCTTCCTGTCATCCACTCTGAGG + Intergenic
1108524728 13:51277085-51277107 TTTTCCAGTCATCCACTTGATGG - Intronic
1112013004 13:95307777-95307799 CCTTTCTGTCACTCACTCAAAGG + Intergenic
1113536455 13:111070386-111070408 CCTTCATGTCATCCACCCCATGG - Intergenic
1114853535 14:26409830-26409852 CCTTCCTGTCATCTACATGAGGG + Intergenic
1120245094 14:81996895-81996917 CCTTCCTGCCATTTACTCCAAGG - Intergenic
1122065319 14:99169160-99169182 ATTTCCTGTCATCCTCTCGATGG + Intergenic
1128712616 15:69883696-69883718 CCTTCCAGTCATCCAATTGCTGG + Intergenic
1130758379 15:86790959-86790981 CCTTCCTGTCATCTGCTACATGG - Intronic
1132314993 15:100883167-100883189 CCTTCCTGGTATCAACTCCAAGG - Intronic
1132661218 16:1062349-1062371 CCTTCCTGGCACCCACTGGCTGG + Intergenic
1132725461 16:1336452-1336474 CCTTCCTGTCCTCAGCTCTAGGG + Intronic
1133035525 16:3031810-3031832 GCTTCATTTCATCCACTAGAGGG + Intronic
1134112661 16:11524804-11524826 CCTTCCTGCCAGCCACTTGCAGG + Intergenic
1137528572 16:49261242-49261264 ACTTCCTGTCACCAACTCCAAGG + Intergenic
1138379575 16:56590592-56590614 ACTTCCTGGCATCCACCCAAGGG + Intronic
1147176235 17:38657877-38657899 CCTTCTTTTCTTCCACTCGGAGG - Intergenic
1148968911 17:51462274-51462296 CCTTCAAGTCTTCCACTCCAGGG + Intergenic
1153246012 18:3073321-3073343 CCTTCCTGTCATTCATTCAAAGG + Intronic
1153781774 18:8501078-8501100 CCTTCCTGTCTCCCTGTCGAGGG + Intergenic
1156462854 18:37331424-37331446 CCTTCCCCTCATCCCCTTGAGGG - Intronic
1159747722 18:72259349-72259371 CCTACCTGTATTCCACTAGATGG - Intergenic
1161950550 19:7465298-7465320 CCTTCCTGTTATCCACACTAAGG + Intronic
1167358792 19:49019147-49019169 CCTTCCTGCCACCCACGCCAGGG + Intergenic
1167366483 19:49057395-49057417 CCTTCCTGCCACCCACGCCAGGG + Exonic
925338458 2:3115757-3115779 CCTTCCTGACACCCTCTCCAAGG + Intergenic
928178409 2:29050715-29050737 TCTGCCTGTCATCCAGCCGAAGG - Intronic
929426699 2:41851284-41851306 ACTTCTAGTCATCCACTCAAAGG + Intergenic
930089133 2:47519221-47519243 CCTTCCTGCCATGAACTAGAAGG + Exonic
938122858 2:128645898-128645920 CCTCCTTGTCATCCTCTCCATGG - Intergenic
943932237 2:193868663-193868685 CCTTCTTGTCATCCACAACATGG - Intergenic
944305557 2:198174644-198174666 CCTTCCTGTCATACAAGAGAAGG + Intronic
948710166 2:239820407-239820429 CCTTCCTCTCATCCCCACGCAGG + Intergenic
1169145313 20:3248552-3248574 GCTTCCTGTCAACCAGTCGCTGG - Intergenic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1175404915 20:58719645-58719667 CCTTCCTGACATCCAACCGATGG + Intergenic
1176227764 20:64011778-64011800 ACTTCCTGTCCTCCTCTCGTAGG - Intronic
1176227769 20:64011837-64011859 ACTTCCTGTCCTCCTCTCGTAGG - Intronic
1176227774 20:64011896-64011918 ACTTCCTGTCCTCCTCTCGTAGG - Intronic
1176227779 20:64011955-64011977 ACTTCCTGTCCTCCTCTCGTAGG - Intronic
1176227784 20:64012014-64012036 ACTTCCTGTCCTCCTCTCGTAGG - Intronic
1176227789 20:64012073-64012095 ACTTCCTGTCCTCCTCTCGTAGG - Intronic
1176227794 20:64012132-64012154 ACTTCCTGTCCTCCTCTCGTAGG - Intronic
1176227799 20:64012191-64012213 ACTTCCTGTCCTCCTCTCGTAGG - Intronic
1176227804 20:64012250-64012272 ACTTCCTGTCCTCCTCTCGTAGG - Intronic
1176227809 20:64012309-64012331 ACTTCCTGTCCTCCTCTCGTAGG - Intronic
1176227814 20:64012368-64012390 ACTTCCTGTCCTCCTCTCGTAGG - Intronic
1176227819 20:64012427-64012449 ACTTCCTGTCCTCCTCTCGTAGG - Intronic
1176227824 20:64012486-64012508 ACTTCCTGTCCTCCTCTCGTAGG - Intronic
1176227829 20:64012545-64012567 ACTTCCTGTCCTCCTCTCGTAGG - Intronic
1176227834 20:64012601-64012623 ACTTCCTGTCCTCCTCTCGTAGG - Intronic
1176227839 20:64012660-64012682 ACTTCCTGTCCTCCTCTCGTAGG - Intronic
1176227844 20:64012719-64012741 ACTTCCTGTCCTCCTCTCGTAGG - Intronic
1176227849 20:64012778-64012800 ACTTCCTGTCCTCCTCTCGTAGG - Intronic
1176227854 20:64012837-64012859 ACTTCCTGTCCTCCTCTCGTAGG - Intronic
1176227859 20:64012896-64012918 ACTTCCTGTCCTCCTCTCGTAGG - Intronic
1178005119 21:28210080-28210102 CATTCTTGTCATCCAGACGATGG - Intergenic
1182679288 22:32066165-32066187 CCTTCCAGTCTTCCACTCTTGGG + Intronic
1182714740 22:32348452-32348474 CCTTCCTGGCCTCCACTGGGAGG - Intergenic
1184949609 22:47831815-47831837 CCATCCCCTCATTCACTCGAAGG - Intergenic
950414978 3:12863977-12863999 CCTTGCTGCCATCCACTCTCTGG + Intronic
950872842 3:16244263-16244285 ATTTCCTGTCATTCACTTGAGGG + Intergenic
957946290 3:87067611-87067633 CCTGGCAGTCATTCACTCGATGG - Intergenic
958715839 3:97779325-97779347 CCCTCCTGTCATTCACTCCTGGG + Intronic
961142208 3:124565110-124565132 ACTTCCTTTCCTCCACTAGATGG + Intronic
961439670 3:126945369-126945391 CCTTGCTGACATCAACTAGAGGG - Intronic
962318844 3:134374833-134374855 CCTTGCTGTCGTCCCGTCGATGG - Intronic
966387764 3:179418931-179418953 CCTTTCTGTGATGCAGTCGAGGG + Intronic
967944208 3:194789613-194789635 CTATCCTGTCATCCATTTGATGG + Intergenic
968000324 3:195201272-195201294 CCTTCCTCACATGCACTCTAGGG - Intronic
968096144 3:195932137-195932159 CCCTCCTCTCATCCAGTAGAAGG - Intergenic
974329782 4:60463716-60463738 CCTGCCTGTCATCCCCTCCCAGG + Intergenic
976469508 4:85411566-85411588 ACATCCTGCCATGCACTCGACGG - Intergenic
977553708 4:98468012-98468034 CCTTCCTGTTATCCATTAGCCGG - Intergenic
978760186 4:112348945-112348967 CTTTCCTGTCAGCCACTTCAGGG + Intronic
984065793 4:175046194-175046216 CCTTCCTGGCATACATTCCATGG - Intergenic
986169148 5:5301805-5301827 GCATCCTGTCTTCCACTCTACGG - Intronic
986876019 5:12110960-12110982 CCTTCCTGTCATCCTTTTGAAGG - Intergenic
987012434 5:13781298-13781320 CCTTCCTGTCATACACTATTAGG - Intronic
987163846 5:15173498-15173520 CCTACCAATCATCCACTCTATGG + Intergenic
987216048 5:15738474-15738496 CCTTCTTGTTATCTACTGGAGGG + Intronic
988919370 5:35926320-35926342 CCTTGCTGCCAGCCACTGGAGGG - Intronic
989730393 5:44641424-44641446 CCTTCCTGTCACCCACAACATGG + Intergenic
990511556 5:56493658-56493680 TCTCCCTTTAATCCACTCGATGG - Intergenic
997625961 5:135330714-135330736 CCTTCCAGTGATCCACCTGAAGG - Intronic
999301202 5:150491730-150491752 CCTTCCTGTCATCAAGCCTAAGG + Intronic
1000125020 5:158235655-158235677 AGTTCCTGCCATCCACTCCAGGG - Intergenic
1005522318 6:26612077-26612099 CCTTCCTATAGTCCACTGGAGGG - Intergenic
1006028904 6:31164867-31164889 CCTTTCTGTCATTCACTTGCAGG - Exonic
1013139843 6:107322109-107322131 TCTTCCTCACATCCACTCTAGGG + Intronic
1015374040 6:132490221-132490243 CCTTCCTGTCATCCACTCGAGGG + Intronic
1018643449 6:165926586-165926608 TCTTCCTGTCATCCAGTGCAGGG - Intronic
1023861289 7:44218906-44218928 CCTTCCTTTCATCCCCTGAAGGG - Exonic
1032217659 7:129969986-129970008 CCTTCCCCTCCTCCACTCCATGG + Intergenic
1034260060 7:149749657-149749679 CCTTCCTGTCATCCCCCTGGGGG + Intergenic
1035214868 7:157358041-157358063 CCATTCTGTCACCCACACGAGGG - Intronic
1038748900 8:30278248-30278270 GCTTTCTGCCATCCTCTCGAGGG + Intergenic
1045295385 8:100867962-100867984 TCTTCCTGTCAGCCACTCGTGGG + Intergenic
1045459233 8:102412243-102412265 CCTTCTCGTCCTCCACTCGAGGG + Exonic
1055253313 9:74335115-74335137 ACATACTGTCATCCACACGAAGG - Intergenic
1056420845 9:86424831-86424853 CCTTCCTGTCTTCTGCTCTATGG + Intergenic
1058875755 9:109243752-109243774 TGTTCCTGGCATCCACCCGAGGG + Intronic
1186184865 X:7010815-7010837 CCTTCCTGGCATCCCCTCATGGG + Intergenic
1192497193 X:71623655-71623677 CCTTCCTGTCATCCTGTCTCTGG + Intergenic
1194457290 X:94120867-94120889 CCTTCCTGTCTTCCTTTCAATGG + Intergenic
1199022995 X:142904462-142904484 TCTTCCAGTCATCCTCTCCAAGG - Intergenic
1199965095 X:152813120-152813142 CCTGTCTGTCACACACTCGAGGG - Intergenic