ID: 1015374484

View in Genome Browser
Species Human (GRCh38)
Location 6:132493941-132493963
Sequence ATGCTCAGTAATTGTATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1405
Summary {0: 1, 1: 0, 2: 3, 3: 69, 4: 1332}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015374484 Original CRISPR ATGCTCAGTAATTGTATGAC AGG (reversed) Intronic
900817556 1:4860282-4860304 ATACCCAGTAATGGTATGGCTGG + Intergenic
902151509 1:14446998-14447020 ATGCTCACTAACTGGGTGACGGG - Intergenic
904315455 1:29657219-29657241 ATACTCAGTAATGGGATGGCTGG - Intergenic
904446994 1:30581796-30581818 ATGCCCAGTAATGGGATGGCTGG + Intergenic
904632454 1:31852700-31852722 ATGCCCAGTAATGGGATGGCTGG + Intergenic
904843857 1:33393246-33393268 ATGCTCAGTAGTTGTCTGGGAGG + Intronic
905051457 1:35054644-35054666 ATGCCCAGTAATGGGATGGCTGG + Intergenic
905438150 1:37973712-37973734 ATGCCCAGTAATGGGATGGCTGG - Intronic
905757888 1:40527131-40527153 ATGCCCAGTAATGGGATGGCTGG - Intergenic
906094053 1:43208281-43208303 ATACTCAGTAATGGGATGGCTGG - Intronic
906945496 1:50291008-50291030 ATGCCCAGTAATGGGAGGACTGG + Intergenic
907840370 1:58151202-58151224 ATGCCCAGTAATGGGATGGCTGG + Intronic
908074131 1:60495617-60495639 ATACCCAGTAATGGGATGACTGG - Intergenic
908215617 1:61948695-61948717 ATGCCCAGTAATGGGATGGCTGG - Intronic
908319874 1:62968743-62968765 ATGCTCAGTACCTGGATGATGGG + Intergenic
908876349 1:68682008-68682030 ATGCCCAGTAATGGGATGGCTGG + Intergenic
908930044 1:69306934-69306956 ATACCCAGTAATTGAATTACTGG + Intergenic
908943364 1:69463831-69463853 ATGCCCAGTAATGGGATTACTGG + Intergenic
908945159 1:69486804-69486826 ATACTCAGTAATGGGATGGCTGG + Intergenic
909051026 1:70768228-70768250 ATACTCAGTAATTGGATTGCTGG + Intergenic
909243122 1:73240141-73240163 ATGCCCAGTAATGGGATGGCTGG - Intergenic
909420235 1:75456398-75456420 ATGCTCAGTACCTGGGTGACAGG + Intronic
909475933 1:76080902-76080924 CTGCTCAGTCACTGTAAGACTGG - Intronic
909845938 1:80394859-80394881 ATACTCAGTAATGGGATGGCTGG + Intergenic
910076289 1:83282942-83282964 ATGCTCAGTAATGGGATTGCTGG + Intergenic
911402497 1:97393801-97393823 ATACTCAGTAATGGGATCACTGG + Intronic
911536065 1:99102271-99102293 ATACTCAGTAATGGGATGGCTGG - Intergenic
911736827 1:101345834-101345856 ATGCTCAGTACCTGAGTGACAGG - Intergenic
911828449 1:102518604-102518626 ATCTTCAGTAATTGTAAAACTGG + Intergenic
911892622 1:103391643-103391665 ATACTCAGTAATGGTATTGCTGG + Intergenic
911929435 1:103883432-103883454 ATGCCCAGTAATGGGATGGCTGG + Intergenic
912035377 1:105305761-105305783 ATACTCAGTAATGGGATGGCTGG + Intergenic
912139626 1:106707421-106707443 ATGCTCACTACTTGGGTGACGGG - Intergenic
912207097 1:107520727-107520749 ATACTCAGTAATGGGATGGCTGG + Intergenic
912480512 1:109978977-109978999 ATGCTCAGTAAATAACTGACTGG + Intergenic
913178266 1:116295149-116295171 ATGCTCAGTACCTGGGTGACGGG + Intergenic
913367911 1:118062801-118062823 ATGCTCAAGGTTTGTATGACAGG - Intronic
913388622 1:118286381-118286403 ATACCCAGTAATGGGATGACTGG - Intergenic
913575107 1:120164375-120164397 ATGCTTAGTACTTGGGTGACGGG - Intronic
914214352 1:145611280-145611302 ATGCTCAGTACCTGGGTGACCGG - Intronic
914219531 1:145667095-145667117 ATACCCAGTAATGGGATGACTGG + Intronic
914334616 1:146703041-146703063 ATGCTCAGTACCTGGGTGACGGG - Intergenic
914406159 1:147375746-147375768 ATACCCAGTAATGGGATGACTGG - Intergenic
914472115 1:147989973-147989995 ATACCCAGTAATGGGATGACTGG + Intronic
914557412 1:148780016-148780038 ATGCTTAGTACTTGGGTGACGGG - Intergenic
914615422 1:149350214-149350236 ATGCTTAGTACTTGGGTGACGGG + Intergenic
914966822 1:152266878-152266900 ATACCCAGTAATGGTATGGCTGG - Intergenic
914990093 1:152492072-152492094 ATGCTCACTACCTGGATGACAGG - Intergenic
915678846 1:157559661-157559683 ATACTCAGTAATGGGATGGCTGG + Intergenic
915690266 1:157681752-157681774 ATACTCAGTAATGGGATGGCTGG + Intronic
915761204 1:158315166-158315188 ATACTCAGTAATGGGATGGCTGG + Intergenic
916395835 1:164386379-164386401 ATGCCCAGTAATGGGATGGCTGG + Intergenic
916396776 1:164398923-164398945 ATGCTCACTACTTGGGTGACAGG + Intergenic
916467871 1:165090578-165090600 ATGCCCAGTAATGGGATGGCTGG - Intergenic
916615167 1:166431822-166431844 ATGCCCAGTAATGGGATGGCTGG - Intergenic
916637252 1:166685828-166685850 ATGCTCAGTAATGGGATTGCTGG + Intergenic
916648394 1:166812010-166812032 ATACTCAGTAATGGGATTACTGG - Intergenic
917129142 1:171722886-171722908 ATGCCCAGTAATGGGATGGCTGG - Intronic
917159955 1:172046036-172046058 ATACTCAGTAATGGGATGGCTGG - Intronic
917172308 1:172190522-172190544 ATGCCCAGTAATAGGATGGCTGG + Intronic
917181927 1:172307505-172307527 ATACTCAGTAATGGGATCACTGG - Intronic
917184312 1:172335842-172335864 ATGCTCAGTACCTGGGTGACAGG + Intronic
917251447 1:173066473-173066495 ATACTCAGTAATGGTATTGCTGG - Intergenic
917372240 1:174306274-174306296 ATACCCAGTAATTGGATGGCTGG + Intronic
917548850 1:176002866-176002888 ATACTCAGTAATGGGATGGCTGG + Intronic
917832554 1:178908440-178908462 ATGCTCAGTAATGGGATTGCTGG + Intronic
918250923 1:182702430-182702452 ATGCTCAGTACCTGGGTGACAGG + Intergenic
918276390 1:182957125-182957147 ATGCTCACTAGTTGGGTGACTGG + Intergenic
918645372 1:186897901-186897923 ATGTTCACTACTTGGATGACAGG - Intronic
918913848 1:190609383-190609405 ATACTCAGTAATGGGATGGCTGG - Intergenic
919052772 1:192531947-192531969 ATGCCCAGTAATAGGATGGCTGG + Intergenic
919175653 1:194015883-194015905 ATACCCAGTAATGGGATGACTGG + Intergenic
919185619 1:194144541-194144563 ATGCTTAGTAAATGTATCAAGGG - Intergenic
919245169 1:194973455-194973477 ATCCTCAGTACCTGGATGACAGG + Intergenic
919293411 1:195663248-195663270 CTGCTCAGAATTTGTCTGACCGG + Intergenic
919329847 1:196157770-196157792 ATACCCAGTAATGGGATGACTGG - Intergenic
919414776 1:197294537-197294559 ATACTCAGTAATGGGATGGCTGG - Intronic
919698298 1:200603417-200603439 TTACTCAGTAATTATATGAGGGG - Intronic
920522922 1:206642410-206642432 ATGCCCAGTAATGGGATGGCTGG - Intronic
920808089 1:209253873-209253895 ATACTCAGTAATGGGATGGCTGG + Intergenic
920980877 1:210834166-210834188 ATACCCAGTAATGGGATGACTGG - Intronic
920982127 1:210847211-210847233 ATGCCCAGTAATGGGATGGCTGG - Intronic
921260260 1:213379956-213379978 ATGCTCAGTCATGGGATCACTGG - Intergenic
921269925 1:213458511-213458533 ATGCCCAGTAATGGTATTGCTGG + Intergenic
921279676 1:213553518-213553540 ATGCCCAGTAATGGTATTGCTGG + Intergenic
921296345 1:213707058-213707080 ATGCTCAGTAATGGGATTGCTGG + Intergenic
921396625 1:214675522-214675544 ATGCCCAGTAATGGGATGGCTGG - Intergenic
921411398 1:214839938-214839960 ATGCTCACTACCTGGATGACAGG - Intergenic
921458561 1:215401684-215401706 ATGCTCAGTACCTGAGTGACAGG - Intergenic
921860040 1:220033116-220033138 TTGCTCAGTGAGTGTGTGACTGG - Intronic
921895706 1:220398179-220398201 ATGCTCAGTACCTGGGTGACGGG - Intergenic
922183378 1:223253820-223253842 ATGCTCAGAAAATAGATGACCGG - Intronic
922412089 1:225386863-225386885 ATGCCCAGTAATGGGATGGCTGG - Intronic
922639218 1:227210231-227210253 ATACCCAGTAATGGGATGACTGG + Intronic
922640944 1:227231492-227231514 ATGCCCAGTAATGGGATGGCTGG + Intronic
923067757 1:230535424-230535446 ATGCTCAATAATAGTATGAAAGG + Intergenic
923374572 1:233347782-233347804 ATGCTCAGTACCTGGGTGACAGG + Intronic
923889370 1:238195059-238195081 TTGCCCAGGAATTATATGACAGG + Intergenic
924639665 1:245822028-245822050 ATACCCAGTAATGGCATGACTGG - Intronic
1062773011 10:119440-119462 ACACTCAGTAATGGGATGACTGG + Intergenic
1062918647 10:1262762-1262784 ATACCCAGTAATGGGATGACTGG - Intronic
1063054649 10:2491522-2491544 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1063326971 10:5113563-5113585 ATGCCCAGTAATGGGATGGCTGG - Intronic
1063538307 10:6907121-6907143 ATACTCAGTAATGGGATGCCTGG - Intergenic
1064305853 10:14165493-14165515 ATGCTCAGTAATGGGATTGCTGG - Intronic
1064375822 10:14794842-14794864 ATACTCAGTAATGGGATGGCTGG - Intergenic
1064838265 10:19560119-19560141 ATACCCAGTAATGGGATGACTGG - Intronic
1064921682 10:20526222-20526244 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1065209327 10:23387893-23387915 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1065386514 10:25138994-25139016 ATACCCAGTAATGGGATGACTGG + Intergenic
1065502572 10:26396791-26396813 ATACTCAGTAATGGGATGGCTGG - Intergenic
1066030894 10:31422761-31422783 ATGCTCAGTATTTGAGTGACAGG - Intronic
1066136709 10:32454469-32454491 GTGCTCAGTACTTGGGTGACGGG + Intronic
1066271652 10:33829933-33829955 ATACTCAGTAATTGGATTGCTGG - Intergenic
1066290070 10:34005965-34005987 ATACTCAGTAATGGGATTACTGG - Intergenic
1066645846 10:37607991-37608013 ATACTCAGTAATGGGATGGCTGG - Intergenic
1066751751 10:38664807-38664829 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1066933538 10:41798414-41798436 ATACCCAGTAATGGGATGACTGG + Intergenic
1066965289 10:42258284-42258306 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1067250640 10:44583683-44583705 ATACCCAGTAATGGGATGACTGG - Intergenic
1067345508 10:45435361-45435383 ATGCTCAGTATTTGAGTGATGGG - Intronic
1067423324 10:46178673-46178695 ATACCCAGTAATTGGATTACTGG + Intergenic
1068052378 10:51967041-51967063 ATACCCAGTAATTGGATGGCTGG - Intronic
1068655035 10:59565664-59565686 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1068821466 10:61381158-61381180 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1068932219 10:62603265-62603287 ATGCCCAGTAATGGGATGGCTGG + Intronic
1069474346 10:68720035-68720057 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1070293032 10:75134080-75134102 ATACTCAGTAATGGTATTGCTGG + Intronic
1070476345 10:76833012-76833034 ATACCCAGTAATGGGATGACTGG + Intergenic
1071363274 10:84872540-84872562 ATGTTCACTATTTGTGTGACAGG + Intergenic
1071803612 10:89092637-89092659 ATGCTCACTACTCGTATGACAGG - Intergenic
1071914774 10:90281065-90281087 ATACTCAGTAATGGGATGGCTGG + Intergenic
1071917418 10:90310330-90310352 ATACTCAGTAATGGGATGGCTGG - Intergenic
1071927086 10:90422601-90422623 AGGCTCAGTAATGGGATGGCTGG + Intergenic
1072032551 10:91535257-91535279 ATACCCAGTAATGGGATGACTGG - Intergenic
1072245536 10:93540883-93540905 ATGCCCAGTAATGGGATCACTGG - Intergenic
1072321771 10:94257401-94257423 ATGCCCAGTAATGGGATGGCTGG - Intronic
1072376750 10:94825166-94825188 ATACTCAGTAATGGGATGGCTGG + Intronic
1072384796 10:94913682-94913704 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1072761005 10:98056781-98056803 ATGCTCAGTAAATGGGTGAATGG + Intergenic
1073022759 10:100460074-100460096 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1073728208 10:106259187-106259209 ATACCCAGTAATGGGATGACTGG - Intergenic
1073730300 10:106279949-106279971 ATACTCAGTAATGGGATGGCTGG - Intergenic
1073843447 10:107525093-107525115 ATGCTCAGTACCTGAATGACAGG + Intergenic
1074239811 10:111626903-111626925 ATACTCAGTAATGGGATGGCTGG - Intergenic
1074335649 10:112572033-112572055 ATGCTCACAACTTGAATGACAGG + Intronic
1074655417 10:115582254-115582276 ATACCCAGTAATGGGATGACTGG + Intronic
1074664188 10:115699781-115699803 ATGCTCACTACTTCGATGACGGG - Intronic
1075179589 10:120197876-120197898 ATGCTCAGTACCTGGATGACAGG - Intergenic
1075413745 10:122247795-122247817 ATGCTCAGTACCTGGGTGACAGG + Intronic
1075423195 10:122320946-122320968 ATGCTCAGTACCTGGGTGACAGG - Intronic
1075529019 10:123211337-123211359 ATACCCAGTAATTGTATTGCTGG + Intergenic
1075858553 10:125653118-125653140 ATGCCCAGTAATAGGATGGCTGG - Intronic
1076320568 10:129578164-129578186 ATACTCAGTAATAGGATGGCTGG - Intronic
1076460158 10:130637666-130637688 AAGCTATGTAATTGTATGGCTGG - Intergenic
1076699413 10:132263490-132263512 ATGCTCAGTGCTTGGGTGACAGG + Intronic
1078710377 11:13785396-13785418 ATTTTCAGTAATGGAATGACTGG + Intergenic
1079446923 11:20565965-20565987 AAGCTCAGTAATTGGAAAACTGG + Intergenic
1079462001 11:20689795-20689817 ATACTCAGTAATGGGATGGCTGG + Intronic
1079465507 11:20725844-20725866 ATGCTCACTACTTGGATGATGGG - Intronic
1079527585 11:21409062-21409084 ATGCCCAGTAATGGGATGGCTGG - Intronic
1079543061 11:21599054-21599076 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1079578323 11:22030568-22030590 ATGCCCAGTAATTGGATTGCTGG - Intergenic
1079708067 11:23646779-23646801 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1079779272 11:24578824-24578846 ATGCTCAGTACTTTGGTGACTGG + Intronic
1079813522 11:25025774-25025796 ATGCCCAGTAATGGGATGGCTGG - Intronic
1080095215 11:28397720-28397742 ATACTCAGTAATAGGATGGCTGG - Intergenic
1080137901 11:28879211-28879233 ATACTCAGTAATGGGATGGCTGG + Intergenic
1080465362 11:32491268-32491290 ATACCCAGTAATGGGATGACTGG + Intergenic
1080488970 11:32742168-32742190 ATGCCCAGTAATGGCATGGCTGG + Intronic
1080515096 11:33013114-33013136 ATACTCAGTAATGGAATGGCTGG - Intergenic
1081093741 11:38905100-38905122 ATGCTCATTACCTGGATGACGGG + Intergenic
1081132046 11:39392432-39392454 ATACTCAGTAATGGGATGGCTGG + Intergenic
1081142649 11:39521606-39521628 ATACTCAGTAATGGTATTGCTGG - Intergenic
1081185736 11:40040055-40040077 ATACCCAGTAATGGTATGGCTGG + Intergenic
1081382857 11:42437020-42437042 ATGCTCAGTACTTGAGTGATAGG + Intergenic
1081453884 11:43201737-43201759 ATACCCAGTAATGGGATGACTGG + Intergenic
1081936985 11:46911775-46911797 TTACTCACTATTTGTATGACAGG + Intronic
1082112276 11:48290561-48290583 ATACCCAGTAATGGGATGACTGG - Intergenic
1082123966 11:48410571-48410593 ATACTCAGTAATGGGATGGCTGG + Intergenic
1082152737 11:48762479-48762501 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1082297403 11:50458992-50459014 ATACCCAGTAATGGGATGACTGG + Intergenic
1082612808 11:55322371-55322393 ATACCCAGTAATGGTATGGCTGG - Intergenic
1082613353 11:55329798-55329820 ATACCCAGTAATTGTATTGCTGG + Intergenic
1082648640 11:55759433-55759455 ATACCCAGTAATAGTATGGCTGG + Intergenic
1082660042 11:55898390-55898412 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1082675915 11:56101970-56101992 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1082713221 11:56580364-56580386 ATACTCAGTAATGGGATGGCTGG - Intergenic
1082908604 11:58342936-58342958 ATGCTCAGTATCTGAGTGACAGG + Intergenic
1082931129 11:58606592-58606614 ATGCTCAGTACCTGCATGATGGG - Intronic
1083513213 11:63231160-63231182 ATACTCAGTAATGGGATGGCTGG + Intronic
1085092388 11:73729043-73729065 ATGCTAACTAATTAGATGACAGG - Intronic
1085335738 11:75693205-75693227 ATGCTCACTACCTGGATGACGGG - Intergenic
1085881109 11:80466907-80466929 ATACTCAGTAATGGTATTTCTGG - Intergenic
1086247013 11:84765220-84765242 GTGTTCAGTAAATGTATGCCAGG + Intronic
1086433236 11:86756298-86756320 ATACTCAGTAATGGGATGGCTGG + Intergenic
1086496733 11:87411752-87411774 ATGCTCAGAAATCCTATCACAGG - Intergenic
1086505789 11:87502726-87502748 ATACTCAGTAATGGGATCACTGG + Intergenic
1086979004 11:93172955-93172977 ATACTCAGTAATGGGATGGCTGG + Intronic
1087085659 11:94216030-94216052 ATGCTCAGTACTTGGGTGATGGG - Intergenic
1087224297 11:95580647-95580669 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1087243854 11:95811066-95811088 ATGCCCAGTAATGGGATGGCTGG - Intronic
1087446292 11:98258570-98258592 ATACCCAGTAATTGGATTACTGG + Intergenic
1087686294 11:101269331-101269353 ATACTCAGTAATGGGATTACTGG + Intergenic
1087725737 11:101714092-101714114 ATGCTCACTACCTGGATGACAGG + Intronic
1087794786 11:102444178-102444200 ATGCCCAGTAATGGGATGGCCGG - Intronic
1087854233 11:103072392-103072414 ATGCCCAGTAATGGGATGGCTGG - Intronic
1088005762 11:104938027-104938049 ATGCTCACGACTTGGATGACAGG + Intergenic
1088061438 11:105655842-105655864 ATACTCAGTAATGGTATTGCTGG + Intronic
1088674851 11:112182332-112182354 ATGCCCAGTAATGGGATGGCTGG - Intronic
1088690643 11:112323796-112323818 ATACTCAGTAATGGGATGGCTGG + Intergenic
1089907320 11:122054185-122054207 ATACTCAGTAATGGGATGGCTGG - Intergenic
1090573677 11:128076601-128076623 ATACTCAGTAATGGGATGGCTGG + Intergenic
1090734816 11:129602769-129602791 ATACTCAGTAATGGGATGGCTGG - Intergenic
1091959268 12:4677767-4677789 ATACTCAGTAATGGGATTACTGG - Intronic
1092298890 12:7226089-7226111 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1092308497 12:7326086-7326108 AACCTCAGTAATTGTCTAACTGG + Intronic
1092473683 12:8800842-8800864 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1092638024 12:10473172-10473194 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1093056115 12:14557291-14557313 ATGCCCAGTAATGGGATTACTGG - Intronic
1093056169 12:14557861-14557883 ATGCCCAGTAATGGGATTACTGG - Intronic
1093081159 12:14812845-14812867 ATGCTCAGTATCTGGGTGACAGG - Intronic
1093627460 12:21366030-21366052 ATGCCCAGTAATGGGATGGCTGG - Intronic
1093989426 12:25573371-25573393 ATTCTCATTAATTCTAGGACTGG - Intronic
1093992382 12:25604857-25604879 ATACCCAGTAATGGGATGACTGG + Intronic
1094262747 12:28520082-28520104 ATGCCCAGTAATGGGATGGCTGG + Intronic
1094291363 12:28853825-28853847 ATACTCAGTAATTGAATCAATGG - Intergenic
1094387941 12:29915521-29915543 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1094736714 12:33243099-33243121 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1094795951 12:33972905-33972927 ATACTCAGTAATGGGATTACTGG - Intergenic
1095108683 12:38266775-38266797 ATACTCAGTAATGGGATTACTGG - Intergenic
1095115984 12:38352701-38352723 ATACCCAGTAATGGGATGACTGG + Intergenic
1095144162 12:38704154-38704176 ATGCTCAGTACCTGGGTGACAGG + Intronic
1095534862 12:43233214-43233236 ATACCCAGTAATTGGATGGCTGG - Intergenic
1095562476 12:43582689-43582711 ATACTCAGTAATGGGATTACTGG - Intergenic
1095576991 12:43751707-43751729 ATACCCAGTAATGGTATGGCTGG + Intronic
1095614251 12:44169925-44169947 ATGCCCAGTAATGGGATGGCTGG - Intronic
1095858593 12:46889512-46889534 ATGCCCAGTAATAGGATGGCTGG + Intergenic
1095863100 12:46940868-46940890 ATACTCAGTAATGGGATGGCTGG - Intergenic
1095869506 12:47010783-47010805 ATGCCCAGTAATAGGATGGCTGG - Intergenic
1095908484 12:47402241-47402263 ATGCTCAGTACCTGTGTGACAGG + Intergenic
1095918809 12:47508205-47508227 ATACCCAGTAATGGTATGGCTGG - Intergenic
1095919216 12:47512674-47512696 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1096029838 12:48403680-48403702 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1096898582 12:54850669-54850691 ATGCCCAGTAATGGGATGGCTGG + Intronic
1097311597 12:58124844-58124866 ATACCCAGTAATGGTATGGCTGG + Intergenic
1097462116 12:59874510-59874532 ATGCCCAGTAATAGGATGGCTGG - Intergenic
1097531650 12:60809084-60809106 ATACTCAGTAATGGGATGGCTGG + Intergenic
1097732126 12:63140591-63140613 ATACTCAGTAATGGGATGGCTGG - Intergenic
1098101530 12:67022798-67022820 ATGCTCACTACCTGGATGACAGG - Intergenic
1098452746 12:70638534-70638556 GTGCTCTGTAATTGTTTGATAGG + Exonic
1098620681 12:72594025-72594047 ATGCCCAGTAATGGGATGGCTGG + Intronic
1098717153 12:73844324-73844346 ATACTCAGTAATTGGATTGCTGG + Intergenic
1098839216 12:75458938-75458960 ATTCTCACTACTTGGATGACAGG - Intergenic
1098863079 12:75731830-75731852 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1099045110 12:77707571-77707593 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1099637071 12:85227038-85227060 ATGCCCAGTAATGGGATGTCTGG + Intronic
1099706671 12:86162538-86162560 ATGCTCATTATTTGGATGATGGG + Intronic
1099836640 12:87914868-87914890 ATGCTCAGTAACTGGGTGATGGG + Intergenic
1099892186 12:88603313-88603335 ATGCCCAGTAATGGGATGCCTGG + Intergenic
1099994553 12:89764199-89764221 ATACTCAGTAATGGGATCACTGG - Intergenic
1100057167 12:90525745-90525767 ATACCCAGTAATGGGATGACTGG + Intergenic
1100374403 12:93999874-93999896 ATGCTCAGTATCTGGATGAAGGG + Intergenic
1100568407 12:95821302-95821324 ATACCCAGTAATTGGATGGCTGG + Intronic
1100636663 12:96441167-96441189 ATACCCAGTAATGGGATGACTGG - Intergenic
1101028547 12:100637331-100637353 ATACCCAGTAATGGTATGGCTGG + Intergenic
1101050619 12:100859938-100859960 ATGCTAATTAATTTTATGATAGG - Intronic
1101056647 12:100923646-100923668 ATGCTCAGTAATGGGATTGCTGG + Intronic
1101072463 12:101090229-101090251 ATGCCCAGTAATGGGATGGCTGG - Intronic
1101105533 12:101436339-101436361 ATCCTCAGTCTTTGCATGACTGG - Intergenic
1101121633 12:101586754-101586776 ATGCCCAGTAATGGGATGGCTGG - Intronic
1101220770 12:102637525-102637547 ATGCTCAGTACCTGGATGATGGG - Intergenic
1101833428 12:108277250-108277272 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1101850217 12:108395892-108395914 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1103224536 12:119275457-119275479 CTGCTCAGTAATATTAAGACAGG - Intergenic
1104483491 12:129129079-129129101 ATGCTCAGTACTTGAGTGATGGG - Intronic
1104793655 12:131500547-131500569 ATGCTCAGTGATGGTCTGATGGG + Intergenic
1105566305 13:21551943-21551965 ATGCCCAGTAATGGGATGGCTGG + Intronic
1105627151 13:22123746-22123768 ATGCCCAGTAATGGGATCACTGG + Intergenic
1105753880 13:23446970-23446992 ATACCCAGTAATTGGATGGCTGG - Intergenic
1106165005 13:27236858-27236880 ATCCTCAGTAATTTTTTGACAGG - Intergenic
1106990572 13:35414740-35414762 ATGCCCAGTAATGGGATGGCTGG + Intronic
1107003555 13:35581131-35581153 ATACTCAGTAATGGGATGGCTGG + Intronic
1107097741 13:36554464-36554486 ATGTTCAGTACTTGGATGATGGG - Intergenic
1107267417 13:38572913-38572935 ATGCTCACTACCTGTGTGACAGG + Intergenic
1107811315 13:44202456-44202478 ATACCCAGTAATGGGATGACTGG - Intergenic
1107989592 13:45806619-45806641 ATGCTCACTACCTGGATGACAGG + Intronic
1108021444 13:46131906-46131928 ATGCTCACTATTTGGGTGACTGG + Intronic
1108235342 13:48397126-48397148 ATGCTCAGTAATGGGATTACTGG - Intronic
1108265382 13:48701892-48701914 ATGCCCAGTAATGGGATGGCTGG - Intronic
1108335683 13:49439388-49439410 ATGCCCAGTACCTGGATGACAGG - Intronic
1108428656 13:50331655-50331677 ATGCCCAGTAATGGGATGGCTGG + Intronic
1108565270 13:51690705-51690727 ATACTCAGTAATGGGATGGCTGG + Intronic
1108797505 13:54049445-54049467 ATACCCAGTAATGGGATGACTGG - Intergenic
1109031663 13:57198452-57198474 ATCCTCAGTTATTGTTTGTCTGG + Intergenic
1109310599 13:60688107-60688129 ATGCCCAGTAATGGTATTGCTGG + Intergenic
1109317760 13:60771350-60771372 ATGCTCAGTACCTGGGTGACAGG - Intergenic
1109517005 13:63456810-63456832 ATGCTCAGTACCTGGGTGACAGG - Intergenic
1109580038 13:64318599-64318621 ATGCTCAGTACCTGGATGATGGG - Intergenic
1109621105 13:64906497-64906519 ATGCTCAGTACCTGGGTGACAGG + Intergenic
1109666607 13:65548106-65548128 ATGCTCAGTAATGGGATTCCTGG + Intergenic
1109667355 13:65556842-65556864 ATGCCCAGTAATTGTATTGGTGG + Intergenic
1109701113 13:66025858-66025880 ATACTCAGTAATGGGATGGCTGG - Intergenic
1109701735 13:66034882-66034904 ATACTCAGTAATGGGATGGCTGG - Intergenic
1109774934 13:67028050-67028072 ATACTCAGTAATGGGATGGCTGG - Intronic
1109807109 13:67457474-67457496 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1110049655 13:70879660-70879682 ATGCTCAGTAACTGTGTGACAGG + Intergenic
1110349973 13:74495570-74495592 ATACTCAGTAATGGGATGGCTGG - Intergenic
1110510830 13:76348214-76348236 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1110692366 13:78445532-78445554 ATGCTCAGTATCTGGATGACAGG - Intergenic
1110789695 13:79574307-79574329 ATACCCAGTAATGGGATGACTGG - Intergenic
1110825223 13:79964085-79964107 ATACTCAGTAATTGGATTGCTGG - Intergenic
1110877019 13:80522459-80522481 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1110942552 13:81368453-81368475 ATACCCAGTAATGGGATGACTGG - Intergenic
1111018966 13:82421019-82421041 ATACTCAGTAATGGGATGGCTGG - Intergenic
1111065582 13:83087875-83087897 ATGCTCACCAACTGTATGACAGG - Intergenic
1111080080 13:83293886-83293908 ATGCTCAGTACCTGGGTGACAGG - Intergenic
1111142238 13:84134311-84134333 ATACTCAGTAATGGGATGGCTGG - Intergenic
1111149808 13:84235465-84235487 ATGCTCAATAACTGGATGATAGG + Intergenic
1111374667 13:87363247-87363269 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1111438582 13:88246105-88246127 ATTCTCATTAATTTTATCACTGG + Intergenic
1111465159 13:88598613-88598635 ATGCTCAGTACTTGGGTGATGGG + Intergenic
1111493702 13:89020111-89020133 ATACTCAGTAATGGTATTGCTGG + Intergenic
1111953685 13:94732331-94732353 ATACCCAGTAATGGGATGACTGG + Intergenic
1111961812 13:94819487-94819509 ATACCCAGTAATGGGATGACTGG + Intergenic
1112072454 13:95869397-95869419 ATACCCAGTAATGGGATGACTGG + Intronic
1112134547 13:96562414-96562436 ATGCTCAGTACCTGGGTGACAGG + Intronic
1112411453 13:99167112-99167134 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1112948210 13:104957712-104957734 ATACTCAGTAATGGGATGGCTGG + Intergenic
1113276421 13:108735652-108735674 ATACCCAGTAATGGTATGGCTGG + Intronic
1113288494 13:108879871-108879893 ATGCCCAGTAATGGGATGGCTGG + Intronic
1113342672 13:109442002-109442024 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1113383266 13:109823579-109823601 ATACTCAGTAATGGGATGGCTGG + Intergenic
1113974539 13:114216800-114216822 ATGCCCAGTAATGGGATGACTGG + Intergenic
1114366531 14:22033027-22033049 ATGCCCAGTAATGGGATTACTGG + Intergenic
1114468212 14:22939852-22939874 ATGCTCACTAACTGGGTGACGGG + Intergenic
1114837124 14:26216081-26216103 ATACTCAGTAATGGGATGGCTGG - Intergenic
1114876470 14:26725862-26725884 ATACCCAGTAATTGGATGGCTGG + Intergenic
1114922289 14:27347817-27347839 ATGCTCACTACCTGGATGACAGG - Intergenic
1115011041 14:28544914-28544936 ATACTCAGTAATGGGATGGCTGG + Intergenic
1115012517 14:28566677-28566699 ATGCTCAGTACTTGGGTGATGGG - Intergenic
1115046412 14:29000346-29000368 ATGCTCACTACTTGGGTGACAGG + Intergenic
1115071991 14:29334633-29334655 ATACCCAGTAATGGGATGACTGG - Intergenic
1115516822 14:34193535-34193557 ATACTCAGTAATGGGATGGCTGG + Intronic
1115625215 14:35185033-35185055 ATGCTCAGTAATGGGATTGCTGG + Intronic
1115876059 14:37863469-37863491 ATACCCAGTAATGGGATGACTGG + Intronic
1115930809 14:38491329-38491351 GTGCTCAGTACCTGGATGACAGG - Intergenic
1116042079 14:39698100-39698122 ATACTCAGTAATGGGATGGCTGG + Intergenic
1116109933 14:40565009-40565031 ATACCCAGTAATGGTATGGCTGG + Intergenic
1116150410 14:41134258-41134280 ATACCCAGTAATGGGATGACTGG - Intergenic
1116245405 14:42405586-42405608 ATACTCAGTAATGGGATCACTGG - Intergenic
1116514439 14:45788220-45788242 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1116537979 14:46060214-46060236 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1116550168 14:46227415-46227437 ATACTCAGTAATGGGATGGCTGG - Intergenic
1116550628 14:46232801-46232823 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1116714448 14:48409984-48410006 ATACTCAGTAATGGGATGGCTGG + Intergenic
1117023771 14:51598905-51598927 ATACCCAGTAATGGTATTACAGG + Intronic
1117415672 14:55493023-55493045 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1117511872 14:56460026-56460048 ATACCCAGTAATGGGATGACTGG - Intergenic
1117800160 14:59434962-59434984 TAGTTCAGTAATTGTAAGACAGG - Intronic
1117841650 14:59867250-59867272 ATGATCAGTTATTTTATTACTGG - Intronic
1117921700 14:60731306-60731328 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1118495258 14:66302189-66302211 ATACTCAGTAATGGGATGGCTGG + Intergenic
1118504619 14:66397462-66397484 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1118508027 14:66436892-66436914 ATGCTCAGTACTTGGGTGATGGG - Intergenic
1118522722 14:66604791-66604813 ATGCTCAGTACCTGGGTGACAGG - Intronic
1118560200 14:67071114-67071136 ATGCCCAGTAATGGGATGGCTGG - Intronic
1118649356 14:67873569-67873591 ATACCCAGTAATTGGATGGCTGG - Intronic
1119157411 14:72423722-72423744 TTGCTCAGTACTTGAGTGACGGG + Intronic
1119192880 14:72695749-72695771 ATGTTCACTAATTGGATGATGGG + Intronic
1120154315 14:81075776-81075798 ATACTCAGTAATGGGATGGCTGG - Intronic
1120284616 14:82483210-82483232 ATACTCAGTAATAGGATGGCTGG - Intergenic
1120349861 14:83341890-83341912 ATACTCAGTAATGGGATGGCTGG - Intergenic
1121161800 14:91750015-91750037 ATGCCCAGTAATGGGATTACTGG - Intronic
1122084180 14:99288372-99288394 ATACTCAGTAATGGGATGGCTGG - Intergenic
1122259574 14:100506007-100506029 ATGCTCAGTAACTGGGTGAAGGG - Intronic
1123454830 15:20412004-20412026 ATACTCAGTAATGGGATGGCTGG + Intergenic
1123844618 15:24285466-24285488 ATGCTCAGTAATGGGATTGCTGG + Intergenic
1123859710 15:24451739-24451761 ATGCTCAGTAATGGGATTGCTGG + Intergenic
1124704293 15:31948933-31948955 ATGCTCACTACTTGGATGATGGG - Intergenic
1124989169 15:34653696-34653718 ATACCCAGTAATGGGATGACTGG + Intergenic
1125053880 15:35334912-35334934 ATACTCAGTAATGGTATTGCTGG + Intronic
1125157439 15:36603987-36604009 ATGATCAGTAATTATATATCTGG + Intronic
1125774226 15:42196805-42196827 ATACTCAGTAATGGGATGGCTGG - Intronic
1125835793 15:42749546-42749568 ATCCCCAGTAATTGGAGGACAGG - Intronic
1125889862 15:43257709-43257731 ATGCCCAGTAATGGTATGGCTGG - Intronic
1126252458 15:46584913-46584935 ATGCCCAGTAATGGGATTACTGG - Intergenic
1126540669 15:49819164-49819186 ATGCTCAGTATCTGGGTGACAGG + Intergenic
1126839459 15:52702658-52702680 ATGCTCAGTACCTGGATGACAGG + Intronic
1126854956 15:52829612-52829634 ATGCCCAGTAATTGGATCACTGG - Intergenic
1127058933 15:55162205-55162227 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1127150208 15:56066645-56066667 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1127151811 15:56083482-56083504 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1127357882 15:58218420-58218442 ATGCTCAGTACTTGGGTGACAGG - Intronic
1127571121 15:60242782-60242804 ATGCCCAGTAATGGGATTACTGG - Intergenic
1127970689 15:63957866-63957888 ATGCCCAGTAATGGTATGGCTGG + Intronic
1128218172 15:65948625-65948647 ATGTTCAGTAAATGTTTGTCAGG - Intronic
1128902700 15:71439497-71439519 ATACTCAGTAATAGGATGGCTGG - Intronic
1128949221 15:71858238-71858260 ATACCCAGTAATGGTATGGCTGG - Intronic
1128960454 15:71997952-71997974 ATGCCCAGTAATTGGATTACTGG - Intronic
1129572633 15:76705027-76705049 ATACTCAGTAATGGGATGGCTGG - Intronic
1129573252 15:76713260-76713282 ATACTCAGTAATGGGATGGCTGG - Intronic
1129637928 15:77342113-77342135 ATGAACAGTTATTGAATGACTGG + Intronic
1129796017 15:78376471-78376493 ATACCCAGTAATGGAATGACTGG + Intergenic
1130818780 15:87469218-87469240 ATACTCAGTAATTGGATGGCTGG - Intergenic
1131917873 15:97290677-97290699 ATGCCCAGTAATGGGATGACTGG + Intergenic
1131919044 15:97302895-97302917 ATACCCAGTAATGGGATGACTGG + Intergenic
1133865874 16:9642956-9642978 ATGCTCAGTACCTGGGTGACAGG + Intergenic
1133899741 16:9962752-9962774 ATACTCAGTAATGGGATGGCTGG - Intronic
1133910669 16:10063264-10063286 ATGCTCACTACTTGGATGATGGG + Intronic
1135784747 16:25338800-25338822 ATGCTCACTAAATATATAACAGG + Intergenic
1136865658 16:33750752-33750774 ATGCCCAGTAATGGGATTACTGG - Intergenic
1137074865 16:35949317-35949339 ATACTCAGTAATGGGATGGCTGG - Intergenic
1137220887 16:46449920-46449942 ATACCCAGTAATGGGATGACTGG + Intergenic
1137465111 16:48700639-48700661 ATGCTCAGTAACTGGATAATGGG - Intergenic
1137878403 16:52020166-52020188 ATACCCAGTAATGGGATGACTGG - Intronic
1137953374 16:52804948-52804970 ATGCTCAGTACTTGGGTGATGGG + Intergenic
1137986904 16:53116705-53116727 ATACTCAGTAATGGGATTACTGG - Intronic
1138006046 16:53338688-53338710 ATGCTCGGTACCTGGATGACAGG + Intergenic
1138710131 16:58961779-58961801 ATGCTCAGTACCTGGGTGACAGG - Intergenic
1138710424 16:58964866-58964888 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1138757590 16:59507061-59507083 GTTCTCAGTAATTTTATTACTGG + Intergenic
1138968481 16:62115308-62115330 ATGCCCAGTAATGGAATTACTGG + Intergenic
1138974510 16:62187512-62187534 ATACCCAGTAATGGGATGACTGG + Intergenic
1139067698 16:63338605-63338627 ATGCTCACTATTTGTGTGACAGG - Intergenic
1139147234 16:64339793-64339815 ATGCTCAGTAGCTGTGTGATGGG - Intergenic
1139800371 16:69517915-69517937 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1139999005 16:71008191-71008213 ATGCTCAGTACCTGGGTGACGGG + Intronic
1140164507 16:72535820-72535842 ATACTCAGTAATGGGATGGCTGG - Intergenic
1203106495 16_KI270728v1_random:1365360-1365382 ATGCCCAGTAATGGGATTACTGG + Intergenic
1203127019 16_KI270728v1_random:1597008-1597030 ATGCCCAGTAATGGGATTACTGG - Intergenic
1143144235 17:4763373-4763395 ATGCTCAGTACCTGGGTGACAGG + Intergenic
1143934105 17:10464102-10464124 ATGCTCATTACCTGGATGACAGG - Intronic
1145125392 17:20295529-20295551 ATGCCCAGTAATGGGATGGCTGG + Intronic
1145408796 17:22637080-22637102 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1145829162 17:27901176-27901198 ATACCCAGTAATGGTATGGCTGG + Intergenic
1146313095 17:31786014-31786036 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1146450362 17:32969234-32969256 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1146917723 17:36688881-36688903 CTGCTTAGGAAGTGTATGACCGG - Intergenic
1147352449 17:39860773-39860795 ATGCTCATTATTTGGGTGACAGG + Intronic
1149705123 17:58688031-58688053 ATCCACAGTAATCCTATGACTGG - Intronic
1150513576 17:65782865-65782887 ATGCTCAGTAACTGGGTGACAGG + Intronic
1150537681 17:66060182-66060204 ATGCTCACTACTTGGATGATGGG + Intronic
1150623566 17:66826110-66826132 ATGCTCAGTAATGGGATGGCTGG + Intergenic
1151165769 17:72202376-72202398 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1203161035 17_GL000205v2_random:50069-50091 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1153317493 18:3739257-3739279 ATACCCAGTAATTGGATGGCTGG - Intronic
1153359537 18:4177856-4177878 ATGCTCATCAATGGTAGGACTGG - Intronic
1153389552 18:4538795-4538817 ATATTCAGAAATTGGATGACAGG + Intergenic
1153511931 18:5864288-5864310 ATACTCAGTAATAGGATCACTGG - Intergenic
1153540553 18:6149558-6149580 ATACCCAGTAATGGGATGACTGG + Intronic
1153657227 18:7293683-7293705 ATGCTCAGTACATGGGTGACAGG + Intergenic
1154364573 18:13695345-13695367 ATGCCCAGTAATGGGATGGCTGG - Intronic
1154469699 18:14687461-14687483 ATACCCAGTAATGGGATGACTGG + Intergenic
1155351058 18:24906713-24906735 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1155658714 18:28222485-28222507 ATACTCAGTAATGGGATGGCTGG + Intergenic
1155664674 18:28294406-28294428 ATACTCAGTAATGATATGGCTGG + Intergenic
1155763172 18:29591375-29591397 ATACACAGTAATGGTATTACTGG - Intergenic
1155770839 18:29696135-29696157 ATACTCAGTAATTGGATTGCTGG + Intergenic
1156022161 18:32612136-32612158 ATACCCAGTAATTGTATTGCTGG + Intergenic
1156168696 18:34455822-34455844 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1156936611 18:42716489-42716511 ATACTCAGTAATGGAATGGCTGG - Intergenic
1157039080 18:44016919-44016941 ATGCTCACTAACTGGGTGACAGG - Intergenic
1157066058 18:44352071-44352093 ATACCCAGTAATGGTATGGCTGG - Intergenic
1157206014 18:45700066-45700088 ATACTCAGTAATGGAATGGCTGG - Intergenic
1157532619 18:48434402-48434424 ATACTCAGTAATGGGATGGCTGG - Intergenic
1157769149 18:50329559-50329581 ATACTCAGTAATGGGATGTCTGG - Intergenic
1157960746 18:52150962-52150984 ATGCTCACTACCTGTGTGACAGG - Intergenic
1157961516 18:52158979-52159001 ATGCCCAGTAATAGGATGGCTGG + Intergenic
1158087936 18:53675634-53675656 ATGCTCACTACTTGGATGATGGG - Intergenic
1158812248 18:61051223-61051245 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1158909866 18:62049212-62049234 ATACTCAGTAATGGGATGGCTGG + Intronic
1159227469 18:65557772-65557794 ATACTCAGTAATGGGATGGCTGG - Intergenic
1159271834 18:66163356-66163378 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1159581899 18:70242489-70242511 ATACTCAGTAATTGGATTGCTGG - Intergenic
1159669553 18:71206001-71206023 ATGCCAAATAATTGTATGATAGG - Intergenic
1159687984 18:71447421-71447443 ATACTCAGTAATGGGATTACTGG - Intergenic
1160267220 18:77349411-77349433 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1162171869 19:8796352-8796374 ATACTCAGTAATGGGATGGCTGG + Intergenic
1162287210 19:9747792-9747814 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1163279060 19:16304086-16304108 ATGCACAGTATTGGCATGACTGG + Intergenic
1163914671 19:20230499-20230521 ATACTCAGTAATGGAATGGCTGG - Intergenic
1164142208 19:22482219-22482241 ATACTCAGTAATTGTATTGATGG - Intronic
1164166205 19:22677810-22677832 ATACTCAGTAATGGGATGGCTGG - Intergenic
1164279372 19:23755977-23755999 ATACTCAGAAATGGTATCACTGG - Intronic
1164346739 19:27272667-27272689 ATACCCAGTAATGGGATGACTGG - Intergenic
1164395940 19:27863013-27863035 ATACTCAGTAATGGGATGGCTGG + Intergenic
1164568871 19:29353943-29353965 ATACCCAGTAATTGGATGGCTGG - Intergenic
1165102976 19:33449864-33449886 ATGATCAATAATTATATCACAGG + Intronic
1166599761 19:44083717-44083739 ATGCTCAGTACCTGGGTGACAGG - Intronic
1166681592 19:44770998-44771020 ATGCTCAGTACCTGGGTGACGGG - Intergenic
1168210227 19:54884725-54884747 ATGCTCAGTACCTGGGTGACAGG + Intronic
924962799 2:48487-48509 ATACTCAGTAATGGTATTGCTGG - Intergenic
926314799 2:11701390-11701412 ATGCTCAATGAATGTGTGACTGG + Intronic
926432336 2:12801007-12801029 ATACCCAGTAATGGTATTACTGG - Intergenic
926539701 2:14160173-14160195 ATACTCAGTAATGGGATGGCTGG - Intergenic
926759615 2:16266475-16266497 ATGCTCAGTACTTGAGTGATGGG - Intergenic
926904959 2:17796876-17796898 ATACTCAGTAATGGGATGGCTGG - Intronic
927061853 2:19430604-19430626 ATGCTCAGTAAATGTTTCACTGG - Intergenic
927387126 2:22547829-22547851 ATGCCCAGTAATGGGATGGCTGG - Intergenic
927526086 2:23742185-23742207 ATACCCAGTAATGGGATGACTGG - Intergenic
928090565 2:28371770-28371792 ATGCCCAGTAATGGGATGGCTGG - Intergenic
928368112 2:30718454-30718476 ATGCCCAGTAATGGGATGGCTGG + Intergenic
928493439 2:31807129-31807151 ATGCCCAGTAATGGGATGGCTGG - Intergenic
928631796 2:33201108-33201130 ATACTCAGTAATGGGATGGCTGG - Intronic
928649995 2:33393801-33393823 ATACCCAGTAATGGGATGACTGG + Intronic
928693656 2:33826198-33826220 ATACCCAGTAATGGGATGACTGG + Intergenic
928721682 2:34128298-34128320 ATACTCAGTAATGGGATGGCTGG + Intergenic
928931872 2:36633270-36633292 ATGCTCAGTACTTGGGTGATGGG - Intronic
929104338 2:38349154-38349176 ATACCCAGTAATGGGATGACTGG - Intronic
929405955 2:41641099-41641121 ATGCCCAGTAATGGGATGGCTGG - Intergenic
930267348 2:49215415-49215437 ATACTCAGTAATGGGATGGCTGG - Intergenic
930295294 2:49546578-49546600 ATGCCCAGTAATGGGATGGCTGG - Intergenic
930433611 2:51313213-51313235 ATGCCCAGTAATGGGATGGCTGG + Intergenic
930441924 2:51419575-51419597 ATACCCAGTAATGGGATGACTGG - Intergenic
930466071 2:51751244-51751266 ATGCTCAGTAATGGGATTCCTGG + Intergenic
930502174 2:52235338-52235360 ATACTCAGTAATGGGATGGCTGG - Intergenic
930505241 2:52275166-52275188 ATACTCAGTAATGGGATGGCTGG - Intergenic
930867648 2:56137651-56137673 ATGCCCAGTAATGGGATGGCTGG + Intergenic
930885632 2:56322775-56322797 ATGCCCAGTAATGGGATGGCTGG - Intronic
930926286 2:56822178-56822200 ATACTCAGTAATGGGATGGCTGG - Intergenic
930961813 2:57271370-57271392 ATGCTCAATAATGGGATGGCTGG + Intergenic
930965941 2:57326850-57326872 ATGCCCAGTAATGGGATGGCTGG - Intergenic
931532355 2:63230446-63230468 ATGCCCAGTAATGGGATGGCTGG + Intronic
931558135 2:63527729-63527751 ATGCCCAGTAATGGGATGGCTGG + Intronic
931558982 2:63536341-63536363 ATGCCCAGTAATGGGATGGCTGG - Intronic
931595019 2:63932137-63932159 ATGCCCAGTAATGGGATGTCTGG - Intronic
931905216 2:66835347-66835369 ATTCTTAGTATTTGTATGTCTGG - Intergenic
932070417 2:68614159-68614181 ATACTCAGTAATGGGATGGCTGG + Intronic
932504584 2:72216533-72216555 ATACTCAGTAATGGGATTACTGG - Intronic
932521642 2:72420746-72420768 ATACTCAGTAATGGGATGGCTGG + Intronic
932829053 2:74970615-74970637 ATGCGCAGTAATGGGATGGCTGG + Intergenic
932899809 2:75684686-75684708 ATACTCAGTAATAGCATGGCTGG - Intronic
932997563 2:76874453-76874475 ATATTCAGTAATTGAATAACTGG + Intronic
933070063 2:77845916-77845938 ATACCCAGTAATGGGATGACTGG - Intergenic
933112589 2:78422758-78422780 ATACCCAGTAATGGTATGGCTGG - Intergenic
934163909 2:89277148-89277170 ATGCCCAGTAATGGGATGGCTGG - Intergenic
934203363 2:89905376-89905398 ATGCCCAGTAATGGGATGGCTGG + Intergenic
934314747 2:91906961-91906983 ATGCCCAGTAATGGGATGGCTGG - Intergenic
934319216 2:91957370-91957392 ATTATCAGTAATAGTATGCCAGG - Intergenic
934585888 2:95494575-95494597 ATACTCAGTAATGGGATGGCTGG + Intergenic
934701112 2:96440938-96440960 ATACTCAGTAATGGGATGGCTGG - Intergenic
934799451 2:97137616-97137638 ATGCCCAGTAATGGGATTACTGG + Intronic
935260704 2:101353595-101353617 ATGCCCAGTAATGGGATGGCTGG - Intronic
935455258 2:103259944-103259966 ATGCCCAGTAATGGGATTACTGG + Intergenic
935477562 2:103542030-103542052 ATGCTCAGTATGTGGGTGACAGG + Intergenic
935667972 2:105529605-105529627 ATGCCCAGTAATGGGATGGCTGG + Intergenic
935883123 2:107586796-107586818 ATACTCAGTAATGGGATGGCTGG - Intergenic
935937136 2:108198421-108198443 ATACCCAGTAATGGGATGACTGG - Intergenic
936150618 2:110019482-110019504 ATACCCAGTAATGGGATGACTGG - Intergenic
936159698 2:110075416-110075438 ATACTCAGTAATGGGATGGCTGG - Intergenic
936184967 2:110295937-110295959 ATACTCAGTAATGGGATGGCTGG + Intergenic
936194058 2:110351887-110351909 ATACCCAGTAATGGGATGACTGG + Intergenic
936667042 2:114608940-114608962 ATGCTCAGTACCTGTGTGATGGG + Intronic
936908768 2:117568615-117568637 ATACTCAGTAATTGGATCGCTGG - Intergenic
937474655 2:122204365-122204387 GTGCTCAGGAATTGTACGACTGG + Intergenic
937607053 2:123813412-123813434 ATACTCAGTAATGGGATTACTGG - Intergenic
937747840 2:125435939-125435961 ATGCTCAGCAGTTGTAACACTGG - Intergenic
937775287 2:125768890-125768912 ATACCCAGTAATTGGATGGCTGG - Intergenic
937889164 2:126923305-126923327 ATACCCAGTAATGGAATGACTGG + Intergenic
938799416 2:134747020-134747042 ATGCCCAGTAATGGGATGGCTGG + Intergenic
938865697 2:135417592-135417614 ATGCCCAGTAATGGGATGGCTGG - Intronic
939093419 2:137804928-137804950 ATACCCAGTAATGGGATGACTGG - Intergenic
939357514 2:141122731-141122753 ATGCCCAGTAATGGGATGGCTGG - Intronic
939397387 2:141648656-141648678 ATGTTCAGTAAATGTTTGTCAGG + Intronic
939757077 2:146127872-146127894 ATGCTCACTACCTGTGTGACGGG - Intergenic
940103793 2:150074105-150074127 ATGCTCACTACCTGTGTGACAGG + Intergenic
940257716 2:151748963-151748985 ATGCTCAGTAATGGGATGACTGG - Intergenic
940387942 2:153095518-153095540 ATACCCAGTAATGGGATGACTGG - Intergenic
940571228 2:155437340-155437362 ATGCTCAGTACTTGAGTGACAGG - Intergenic
940679792 2:156771882-156771904 ATGCCCAGTAATGGGATGGCTGG + Intergenic
940699928 2:157028017-157028039 ATGCTCAGTACATGGGTGACAGG + Intergenic
940827443 2:158428767-158428789 ATGCTCAGTAATGGGAAGCCTGG - Intronic
940946024 2:159618427-159618449 AAGCTCTGTACATGTATGACTGG + Intergenic
941082860 2:161081875-161081897 ATACTCAGTAATGGGATGGCTGG + Intergenic
941136008 2:161719411-161719433 ATACTCAGTAATGGGATGGCTGG + Intronic
941212006 2:162651713-162651735 ATGCTCAGTAATGGGATTGCTGG + Intronic
941228525 2:162879552-162879574 ATGCCCAGTAATTGGATTGCTGG - Intergenic
941286207 2:163616118-163616140 ATGGTCAGTAATGGTAAGAATGG - Intronic
941355201 2:164482621-164482643 ATGCCCAGTACATGTTTGACTGG - Intergenic
941680841 2:168397245-168397267 ATGCTCACTACTTGGGTGACAGG - Intergenic
941726586 2:168867106-168867128 ATACTCAGTAATGGGATGGCTGG - Intronic
941763472 2:169270237-169270259 ATGCCCAGTAATGGGATGGCTGG - Intronic
941766968 2:169308732-169308754 ATACTCAGTAATGGGATGGCTGG + Intronic
941777056 2:169404768-169404790 ATACCCAGTAATGGGATGACTGG - Intergenic
941970936 2:171350472-171350494 ATACCCAGTAATGGGATGACTGG + Intronic
941973068 2:171372993-171373015 ATACCCAGTAATGGGATGACTGG + Intronic
942628908 2:177935003-177935025 ATGCTCAGTACCTGAGTGACAGG + Intronic
942915411 2:181300040-181300062 ATACTCAGTAATGGGATGGCTGG - Intergenic
943077299 2:183210751-183210773 ATGCGCAGTAATGGGATGGCTGG + Intergenic
943287749 2:186026209-186026231 ATGCCCAGTAATGGGATGGCTGG - Intergenic
943496400 2:188626473-188626495 ATGCTCACTAGCTGGATGACAGG + Intergenic
943858887 2:192834449-192834471 ATACTCAGTAATGGGATGGCTGG + Intergenic
943956800 2:194202086-194202108 ATGCTCACTACTTGGATGACAGG - Intergenic
944029812 2:195221808-195221830 ATGCCCAGTAATTGGATTATTGG - Intergenic
944070597 2:195663893-195663915 ATGCTCAGTACCTGGATGACAGG - Intronic
944216407 2:197260592-197260614 ATGCCCAGTAATGGGATGGCTGG + Intronic
944253678 2:197602704-197602726 ATACCCAGTAATGGGATGACTGG - Intronic
944524768 2:200607598-200607620 ATACTCAGTAATGGGATTACTGG - Intronic
944630346 2:201618190-201618212 ATGCCCAGTAATGGGATGGCTGG - Intronic
944947136 2:204701832-204701854 TTGCTCAGTACCTGGATGACAGG - Intronic
945006824 2:205417439-205417461 ATGCCCAGTAATGGGATGGCTGG + Intronic
945393010 2:209287321-209287343 ATACTCAGTAATGGGATGGCTGG - Intergenic
945839655 2:214872384-214872406 ATACCCAGTAATAGGATGACTGG + Intergenic
945867801 2:215195993-215196015 ATACCCAGTAATGGGATGACTGG - Intergenic
946139250 2:217674633-217674655 ATACCCAGTAATTGGATGGCTGG + Intronic
946513191 2:220382725-220382747 ATGCCCAGTAATGGGATGGCTGG + Intergenic
946674870 2:222148675-222148697 ATGCCCAGTAATAGGATGGCTGG - Intergenic
946684273 2:222251619-222251641 ATACTCAGTAATGGGATGGCTGG + Intronic
946712423 2:222520025-222520047 ATACTCAGTAATGGGATTACTGG + Intronic
946801245 2:223418188-223418210 ATGCCCAGTAATGGGATGGCTGG - Intergenic
947283393 2:228481699-228481721 ATACCCAGTAATGGGATGACTGG + Intergenic
947891499 2:233625834-233625856 ATGCTCAGTACTTGGGTGATGGG + Intronic
947896449 2:233678211-233678233 ATGCTCAGTACTTGGGTGATGGG + Intronic
948419156 2:237843974-237843996 ATGCCCAGTAATGGGATGGCTGG + Intergenic
948722183 2:239907878-239907900 ATGCCCAGTAATGGGATGGCTGG - Intronic
1169428884 20:5518506-5518528 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1169515901 20:6316332-6316354 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1170060217 20:12251029-12251051 ATACTCAGTAATGGGATTACTGG + Intergenic
1170147376 20:13191220-13191242 ATACTCAGTAATGGTATTGCTGG - Intergenic
1170327608 20:15174513-15174535 ATGCCCAGTAATGGGATGGCTGG + Intronic
1170380361 20:15753221-15753243 ATGCTCACTATTTGGATGACAGG - Intronic
1170473940 20:16695900-16695922 ATCCTCTGTGATTGAATGACTGG + Intergenic
1170794812 20:19537508-19537530 ATGCCCAGTAATGGGATGGCTGG - Intronic
1170923355 20:20700354-20700376 ATGCTCACTATGTGGATGACGGG + Intronic
1171007451 20:21480499-21480521 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1171201150 20:23243454-23243476 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1171222372 20:23410583-23410605 ATGCTCAGTATCTGGGTGACAGG + Intronic
1171539470 20:25935292-25935314 ATACCCAGTAATGGGATGACTGG + Intergenic
1171738794 20:28833560-28833582 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1171740215 20:28875206-28875228 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1171775823 20:29366567-29366589 ATACCCAGTAATTGGATGGCTGG + Intergenic
1171903867 20:30883383-30883405 ATACCCAGTAATGGGATGACTGG + Intergenic
1171910205 20:30944622-30944644 ATACCCAGTAATTGGATGGCTGG + Intergenic
1171911954 20:30970962-30970984 ATACCCAGTAATTGGATGGCTGG + Intergenic
1173029382 20:39340787-39340809 ATGCTCACTACCTGCATGACGGG + Intergenic
1173131791 20:40400713-40400735 GTGCTCAGTATGTGGATGACAGG - Intergenic
1173214030 20:41063035-41063057 ATGCTCAGTACCTGGGTGACAGG - Intronic
1173232446 20:41210328-41210350 ATGCCCAGTAATGGGATGGCTGG - Intronic
1173394440 20:42665574-42665596 ATACCCAGTAATTGGATGGCTGG - Intronic
1174023692 20:47553908-47553930 ATGCCCAGTAATGGGATGGCTGG + Intronic
1175084768 20:56449090-56449112 ATACTCAGTAATGGGATGGCTGG - Intronic
1176332552 21:5561528-5561550 ATGCCCAGTAATAGTATTGCTGG + Intergenic
1176395205 21:6259423-6259445 ATGCCCAGTAATAGTATTGCTGG - Intergenic
1176441952 21:6729681-6729703 ATGCCCAGTAATAGTATTGCTGG + Intergenic
1176466214 21:7056750-7056772 ATGCCCAGTAATAGTATTGCTGG + Intronic
1176489775 21:7438528-7438550 ATGCCCAGTAATAGTATTGCTGG + Intergenic
1176930641 21:14805725-14805747 ATACTCAGTAATGGGATGGCTGG - Intergenic
1177492033 21:21839043-21839065 ATACTCAGTAATGGGATGGCTGG - Intergenic
1177633102 21:23751914-23751936 ATGCTCTGTCAGTGTGTGACAGG + Intergenic
1177670019 21:24212859-24212881 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1178414207 21:32390848-32390870 ATACCCAGTAATGGGATGACTGG - Intronic
1179648310 21:42789557-42789579 ATGCTCAGTACCTGGGTGACGGG + Intergenic
1180541507 22:16452836-16452858 ATGCCCAGTAATAGGATGGCTGG - Intergenic
1182157529 22:28089145-28089167 ATACTCAGTAATGGGATGGCTGG - Intronic
1182197540 22:28534544-28534566 ATACTCAGTAATGGGATGGCTGG - Intronic
1182750437 22:32637572-32637594 ATGCTCAGTACCTGAGTGACAGG - Intronic
1184818845 22:46893477-46893499 CTGCTCAATAAATGTGTGACAGG + Intronic
1185093914 22:48795468-48795490 GTGCTCAGTAAGTGTGTGACAGG - Intronic
949198766 3:1345410-1345432 ATTATAAGTAATTGTATGGCTGG - Intronic
949248785 3:1957783-1957805 ATACCCAGTAATGGGATGACTGG + Intergenic
949287544 3:2424575-2424597 ATACCCAGTAATGGGATGACTGG + Intronic
949659934 3:6267417-6267439 ATACTCAGTAATGGGATGGCTGG + Intergenic
949664404 3:6320385-6320407 ATACTCAGTAATGGGATGGCTGG - Intergenic
949720372 3:6982348-6982370 ATGCTCAGCAACTGGATGACAGG + Intronic
950329297 3:12143797-12143819 ATACTCAGTAATGGTATTGCTGG + Intronic
950393061 3:12711828-12711850 ATGCTCAGTACCTGGGTGACTGG - Intergenic
950733210 3:14980758-14980780 ATGCTGAGTAATTGCATAAATGG + Intronic
950984408 3:17345551-17345573 ATACTCAGTAATGGGATGGCTGG - Intronic
951060140 3:18196872-18196894 ATGCTCACAACTTGGATGACAGG - Intronic
951209572 3:19960182-19960204 ATGCTGAGTAAATTTATGATAGG + Intronic
951407755 3:22322169-22322191 ATGGTGAGTAATTGTATGTATGG - Intronic
951685002 3:25334159-25334181 ATACCCAGTAATAGGATGACTGG - Intronic
951775188 3:26302289-26302311 ATACTCAGTAATGGAATTACTGG + Intergenic
952141590 3:30485028-30485050 ATGCTCAGTACTTGGGTGAAAGG + Intergenic
952546725 3:34428248-34428270 ATACTCAGTAATGGGATGGCTGG + Intergenic
952587438 3:34909731-34909753 ATGCGCAGTAATGGGATGGCTGG - Intergenic
952592550 3:34974702-34974724 ATGCACAGTAATGGGATGGCTGG + Intergenic
952661425 3:35853947-35853969 ATACTCAGTAATTGGATTGCTGG + Intergenic
952710800 3:36430142-36430164 ATGTTGAGTAATTGAATGAATGG - Intronic
952728288 3:36612851-36612873 ATACTCAGTAATGGGATGGCTGG - Intergenic
953014632 3:39061609-39061631 ATACTCAGTAATGGGATGGCCGG + Intronic
953441465 3:42922072-42922094 ATACTCAGTAATGGGATGGCTGG + Intronic
953506720 3:43492918-43492940 ATGCCCAGTAATGGGATGGCTGG - Intronic
953513876 3:43571316-43571338 ATACTCAGTAATGGGATGGCTGG - Intronic
953756491 3:45650847-45650869 ATGCCCAGTAATGGGATGGCTGG + Intronic
953807301 3:46081793-46081815 ATGCTCACTACCTGAATGACGGG - Intergenic
953988887 3:47468229-47468251 ATGCCCAGTAATGGGATGGCTGG + Intronic
954008677 3:47615290-47615312 ATCCTCAGTAGCTGTATGCCTGG + Intronic
955090083 3:55741952-55741974 ATCCTGACTAAATGTATGACAGG - Intronic
955151098 3:56368057-56368079 ATGCTCAGTACCTGGGTGACGGG + Intronic
955464178 3:59219045-59219067 ATACTCAGTAATGGGATGGCTGG + Intergenic
955648312 3:61164735-61164757 ATTCTCAGTACCTGGATGACAGG - Intronic
955865585 3:63380197-63380219 ATACTCAGTAATGGGATGGCTGG + Intronic
955937887 3:64120107-64120129 ATGCTCAGTACCTGGGTGACAGG + Intronic
955982905 3:64545239-64545261 ATGCCCAGTAATGGGATGGCTGG - Intronic
956215892 3:66848414-66848436 ATACCCAGTAATTGGATGGCTGG - Intergenic
957147907 3:76447523-76447545 ATACTCAGTAATGGGATGGCTGG - Intronic
957148304 3:76452684-76452706 ATACTCAGTAATGGGATGGCTGG + Intronic
957400059 3:79699929-79699951 ATGCTCAGTACCTGGGTGACAGG - Intronic
957410532 3:79834191-79834213 ATGCCCAGTAATGGGATGGCTGG - Intergenic
957537677 3:81527848-81527870 ATACCCAGTAATGGGATGACTGG - Intronic
957644841 3:82907635-82907657 ATGCCCAGTAATGGGATGGCTGG - Intergenic
957655954 3:83075581-83075603 ATGCTCACTACCTGTGTGACAGG + Intergenic
957757419 3:84509003-84509025 ATACCCAGTAATGGGATGACTGG + Intergenic
957769961 3:84677652-84677674 ATGCCCAGTAATGGGATGGCTGG + Intergenic
957931762 3:86887640-86887662 ATGCTCAGTAATGGGATTGCTGG - Intergenic
957992086 3:87639117-87639139 ATGCTCAGTACCTGTGTGATGGG - Intergenic
958066698 3:88552845-88552867 ATACTCAGTAATGGGATGGCTGG - Intergenic
958070774 3:88608409-88608431 ATGCCCAGTAATGGGATGGCTGG - Intergenic
958093073 3:88902719-88902741 ATACTCAGTAATGGGATTACTGG + Intergenic
958174004 3:89972186-89972208 ATGCTCACTACCTGGATGACAGG + Intergenic
958214504 3:90545017-90545039 ATACCCAGTAATGGTATGGCTGG - Intergenic
958421454 3:93936309-93936331 ATGCTCACTATTTGGGTGACAGG + Intronic
958607408 3:96376525-96376547 ATACTCAGTAATCGGATGGCTGG + Intergenic
958812951 3:98882931-98882953 ATGCCCAGTAATGGGATGGCTGG + Intronic
959019723 3:101175425-101175447 ATACTCAGTAATGGTATTGCTGG - Intergenic
959324068 3:104913722-104913744 ATGATCAGTACCTGTGTGACAGG + Intergenic
959435259 3:106307140-106307162 ATACCCAGTAATGGGATGACTGG - Intergenic
960151889 3:114257795-114257817 ATGCCCAGTAATGGGATGGCTGG - Intergenic
960189700 3:114688281-114688303 ATGCTCAGTACTTGGGTGATGGG + Intronic
960563094 3:119107097-119107119 ATACTCAGTAATGGGATGGCTGG + Intronic
960656411 3:120009315-120009337 ATGCTGAGTAATGGGATGGCTGG - Intronic
961063834 3:123857278-123857300 ATACCCAGTAATGGGATGACTGG - Intronic
961527682 3:127517184-127517206 ATGCCCAGTAATGGGATGGCTGG - Intergenic
961926025 3:130481555-130481577 ATACTCAGTAATGGGATGGCTGG + Intronic
962002524 3:131313331-131313353 ATACCCAGTAATGGTATCACTGG + Intronic
962094008 3:132275037-132275059 ATACTCAGTAATGGAATGGCTGG + Intronic
962304670 3:134275146-134275168 ATGCCCAGTAATGGGATTACTGG - Intergenic
962361454 3:134746431-134746453 ATGCTCAGTAATGGGACCACTGG + Intronic
963577338 3:147077391-147077413 ATGCTCAGTACCTGGGTGACAGG + Intergenic
963581480 3:147131250-147131272 ATGCTCAGTACTTGAGTGACAGG - Intergenic
963581645 3:147133443-147133465 ATGCTTAGAAATTTTATGACAGG + Intergenic
963679882 3:148361033-148361055 ATACCCAGTAATGGGATGACTGG + Intergenic
964259592 3:154820504-154820526 ATGCCCAGTAATGGGATGGCTGG + Intergenic
964393367 3:156220227-156220249 ATGCACAGTAATGGGATCACTGG + Intronic
964694929 3:159496736-159496758 ATACTCAGTAATGGGATGGCTGG - Intronic
964702842 3:159587978-159588000 ATACCCAGTAATTGGATGGCTGG + Intronic
964780174 3:160328623-160328645 ATACCCAGTAATGGTATCACTGG - Intronic
964827390 3:160843762-160843784 ATACCCAGTAATGGGATGACTGG - Intronic
964891768 3:161545015-161545037 ATACCCAGTAATGGGATGACTGG + Intergenic
964950835 3:162291024-162291046 ATGCTCGGTAACTGAATGTCAGG - Intergenic
965015032 3:163146991-163147013 ATACCCAGTAATGGGATGACTGG + Intergenic
965029883 3:163352255-163352277 ATACCCAGTAATGGGATGACTGG + Intergenic
965049703 3:163629994-163630016 ATGCTCACTAACTGGGTGACAGG - Intergenic
965050676 3:163643140-163643162 ATACTCAGTAATGGGATGGCTGG - Intergenic
965147212 3:164922267-164922289 ATGCCCAGTAATGGGATGGCTGG - Intergenic
965161116 3:165134923-165134945 ATGCCCAGTAATGGGATGGCTGG + Intergenic
965181432 3:165408481-165408503 ATGCCCAGTAATGGGATGGCTGG - Intergenic
965193798 3:165567431-165567453 ATGCTCAGTACCTGAATGATGGG + Intergenic
965345849 3:167549202-167549224 ATGCCCAGTAATGGGATGGCTGG + Intronic
965527428 3:169735969-169735991 ATACTCAGTAATGGGATGGCTGG - Intergenic
965883893 3:173420588-173420610 ATACCCAGTAATGGGATGACTGG + Intronic
965889800 3:173498563-173498585 ATACCCAGTAATGGGATGACTGG + Intronic
966271027 3:178105923-178105945 CTGCTCAATAATTTTATGAATGG + Intergenic
966319313 3:178683376-178683398 ATGCTCAGTACCTATGTGACAGG + Intronic
967108818 3:186274897-186274919 ATGCCCAGTAATGGGATGGCTGG + Intronic
967172701 3:186835394-186835416 ATGCTCAGTACTTGAGTGATGGG + Intergenic
967210628 3:187165085-187165107 ATGCTCAGTACCTGAATGATGGG + Intronic
967398723 3:189036328-189036350 ATGCTCACTACTTGGGTGACAGG + Intronic
967569401 3:191011051-191011073 ATGCCCAGTAATGGGATGGCTGG + Intergenic
967701726 3:192600928-192600950 ATGCTCAGTAGTAGGATTACTGG - Intronic
967867159 3:194199556-194199578 ATGCTCAGTAGATGTAAGACAGG + Intergenic
969060508 4:4430447-4430469 ATGTTCAGTACTTTTATGACAGG - Intronic
969852910 4:9976150-9976172 ATGTTCAGTACTTGTGTGATGGG + Intronic
970469949 4:16367802-16367824 ATACCCAGTAATGGTATGGCTGG + Intergenic
970496652 4:16632918-16632940 ATGCCCAGTAATGGGATGGCTGG - Intronic
970560042 4:17273769-17273791 ATGCTCACTACTTGGGTGACAGG + Intergenic
970656896 4:18241307-18241329 ATGCTCCCTATTTGGATGACAGG - Intergenic
970687946 4:18589695-18589717 ATACCCAGTAATGGGATGACTGG + Intergenic
970744420 4:19278066-19278088 ATGCTCAGCAGTTGTGTGAAAGG + Intergenic
970773009 4:19638741-19638763 ATACCCAGTAATGGGATGACTGG + Intergenic
970895923 4:21104094-21104116 ATGCCCAGTAATGGGATGGCTGG + Intronic
971045152 4:22797959-22797981 ATGCTCACTACCTGGATGACAGG - Intergenic
971099464 4:23447359-23447381 ATACCCAGTAATGGGATGACTGG + Intergenic
971420911 4:26473423-26473445 ATGCTCAGTACCTGGATGATGGG + Intergenic
971610846 4:28724467-28724489 ATGCTCAGTGCTTGAATGATGGG - Intergenic
971646810 4:29217250-29217272 ATGCCCAGTAATGGGATGGCTGG - Intergenic
971668549 4:29525701-29525723 ATACTCAGTAATGGGATGGCTGG - Intergenic
972114077 4:35606009-35606031 ATGCCCAGTAATGGGATGGCTGG + Intergenic
972236622 4:37141915-37141937 ATAGTCTGTAATTGTATGATTGG + Intergenic
972362669 4:38342698-38342720 GAACTCAGTAATTGTATGACTGG + Intergenic
972926869 4:44020152-44020174 ATGCTCAGTACCTGGATGATGGG - Intergenic
972935039 4:44123569-44123591 ATACTCAGTAATGGGATGGCTGG - Intergenic
972951763 4:44334444-44334466 ATTCTCAGAACTAGTATGACTGG - Intronic
972984258 4:44744499-44744521 ATACTCAGTAATGGGATGGCTGG + Intergenic
972994679 4:44865203-44865225 ATACTCAGTAATGGGATTACAGG + Intergenic
973106743 4:46348406-46348428 ATGCCCAGTAATGGGATGGCTGG - Intronic
973133606 4:46678192-46678214 ATACTCAGTAATGGGATGGCTGG + Intergenic
973315786 4:48758712-48758734 ATACCCAGTAATGGGATGACTGG - Intronic
973568397 4:52212025-52212047 ATACTCAGTAATGGTATTGCTGG - Intergenic
973711995 4:53639380-53639402 ATGCTCAGTACCTGGGTGACAGG + Intronic
974110535 4:57520537-57520559 ATACTCAGTAATGGAATGGCTGG - Intergenic
974177148 4:58338953-58338975 ATGCCCAGTAATGGGATGGCTGG - Intergenic
974238497 4:59212087-59212109 ATACCCAGTAATGGGATGACTGG - Intergenic
974315671 4:60277586-60277608 ATGCCTAGTAATGGGATGACTGG + Intergenic
974431252 4:61799270-61799292 ATTCACAATAATTCTATGACAGG + Intronic
974530611 4:63102526-63102548 ATACTCAGTAATTGGATGGCTGG - Intergenic
974668573 4:64998512-64998534 ATACTCAGTAATGGGATTACTGG - Intergenic
974680783 4:65159288-65159310 ATACTCAGTAATGGGATGGCTGG + Intergenic
974720369 4:65730212-65730234 ATGCCCAGTAATGGGATTACTGG - Intergenic
974802072 4:66830300-66830322 ATACTCAGTAATGGGATGGCTGG + Intergenic
974823580 4:67098819-67098841 ATACTCAGTAATGGGATGGCTGG - Intergenic
974861868 4:67532378-67532400 ATGCCCAGTAATGGGATGGCTGG - Intronic
974878942 4:67730731-67730753 ATACTCAGTAATGGGATGGCTGG + Intergenic
974937522 4:68425805-68425827 ATGCCCAGTAATGGGATGGCTGG - Intergenic
974938714 4:68438513-68438535 ATGCCCAGTAATGGGATGGCTGG - Intergenic
974972701 4:68849163-68849185 ATACTCAGTAATGGGATCACTGG - Intergenic
975301318 4:72794753-72794775 ATACTCAGTAATGGGATTACTGG - Intergenic
975472185 4:74782610-74782632 ATGCCCAGTAATGGGATTACTGG + Intronic
975522948 4:75319786-75319808 ATGCCCAGTAATGGGATGGCTGG - Intergenic
975678256 4:76849557-76849579 ATTCTCAGCAATTGTTCGACAGG + Intergenic
975752720 4:77540353-77540375 ATGCTCAGTACCTGCATGATGGG - Intronic
975941272 4:79649782-79649804 ATGCTCAGTACCTGAATGATGGG - Intergenic
976079566 4:81340273-81340295 ATGCTCAGTACCTGGGTGACAGG - Intergenic
976230024 4:82833036-82833058 ATGCCCAGTAATGGGATGGCTGG - Intronic
976517281 4:85983285-85983307 ATACCCAGTAATTGGATGGCTGG + Intronic
976533451 4:86183649-86183671 ATACCCAGTAATGGGATGACTGG + Intronic
976912463 4:90324179-90324201 ATACCCAGTAATTGGATGGCTGG + Intronic
976969175 4:91083042-91083064 ATGCCCAGTAATGGGATGGCTGG - Intronic
976976603 4:91173148-91173170 ATGCTAAGTAATTATATGTGAGG + Intronic
977027362 4:91835339-91835361 ATGCTCACTACTTGGGTGACAGG + Intergenic
977165832 4:93695307-93695329 ATACTCATTTATTGTAGGACTGG + Intronic
977219287 4:94320271-94320293 ATGCCCAGTAATGGGATCACTGG + Intronic
977273745 4:94949800-94949822 ATACTCAGTAATGGGATTACTGG + Intronic
977277950 4:95002074-95002096 ATGCTCACTACTTGGATGATGGG - Intronic
977288143 4:95134378-95134400 ATACTCAGTAATGGGATGGCTGG + Intronic
977481166 4:97577631-97577653 ATGCTCAGTACATGGGTGACAGG + Intronic
977978788 4:103298051-103298073 ATGCCCAGTAATGGTATTGCTGG + Intergenic
977980101 4:103311057-103311079 ATACCCAGTAATGGTATGGCTGG + Intergenic
978142263 4:105331429-105331451 ATACCCAGTAATGGGATGACTGG - Intergenic
978211796 4:106146025-106146047 ATACTCAGTAATGGGATGGCTGG - Intronic
978274540 4:106934127-106934149 ATGCCCAGAAATTGTGTAACAGG + Intronic
978536387 4:109767763-109767785 ATGCCCAGTAATGGGATGGCTGG - Intronic
978537764 4:109780628-109780650 ATGCCCAGTAATGGGATGGCTGG - Intronic
978598766 4:110406360-110406382 ATACTCAGTAATGGGATGGCAGG + Intronic
979026582 4:115585020-115585042 ATGCTCAGTACCTGCATGACAGG - Intergenic
979072464 4:116225830-116225852 ATACTCAGTAATGGGATTACTGG - Intergenic
979108404 4:116717576-116717598 ATGTTCAGTAATTGTATGCCAGG + Intergenic
979117648 4:116847959-116847981 ATGCTCACTAACTGGGTGACAGG + Intergenic
979462193 4:120996572-120996594 ATACTCAGTAATGGGATCACTGG + Intergenic
979751548 4:124285980-124286002 ATACCCAGTAATTGGATGGCTGG + Intergenic
980024754 4:127752050-127752072 ATACTCAGTAATGGGATGGCTGG - Intronic
980233156 4:130069835-130069857 ATGCCCAGTAATGGGATGGCTGG + Intergenic
980303010 4:131018177-131018199 ATGCTCAGTAATGGGATCCCTGG + Intergenic
980621256 4:135307439-135307461 ATACCCAGTAATGGGATGACTGG + Intergenic
980688260 4:136258452-136258474 ATGCTCACTATTTGGATGATGGG - Intergenic
981375727 4:144013400-144013422 ATACCCAGTAATTGGATGGCTGG - Intronic
981378540 4:144043912-144043934 ATACCCAGTAATTGGATGGCTGG - Intergenic
981447521 4:144857158-144857180 ATGCTCAGTACCTGCATGACAGG + Intergenic
981514426 4:145591828-145591850 ATGCCCAGTAATGGGATGGCTGG + Intergenic
981679810 4:147383947-147383969 ATGCTCAGTACATGATTGACAGG + Intergenic
981685770 4:147452930-147452952 ATACTCAGTAATGGGATGGCTGG - Intergenic
981814824 4:148818524-148818546 ATACTCAGTAATGGGATGGCTGG - Intergenic
981988049 4:150881567-150881589 ATACTCAGTACTTGGGTGACAGG + Intronic
982629541 4:157814450-157814472 ATGCTCAGTACCTGGGTGACAGG + Intergenic
982669827 4:158306955-158306977 ATGCCCAGTAATGGGATCACTGG + Intergenic
982686002 4:158489609-158489631 ATACTCAGTAATGGGATTACTGG + Intronic
982931504 4:161413554-161413576 ATGCTCAGTAATGGGATTGCTGG - Intronic
983096941 4:163573822-163573844 ATACTCAGTAATGGGATGGCTGG + Intronic
983358922 4:166703048-166703070 ATGCCCAGTAATGGGATCACTGG - Intergenic
983361207 4:166725728-166725750 ATGCTCAGTAATAGGATTGCTGG + Intergenic
983418677 4:167490287-167490309 ATACTCAGTAATGGGATGGCTGG - Intergenic
983655049 4:170074296-170074318 ATGCTCAGTACCTGGGTGACAGG - Intronic
983681193 4:170355294-170355316 ATGCCCAGTAATGGGATGGCTGG + Intergenic
983691383 4:170473398-170473420 ATACCCAGTAATTGGATGGCTGG - Intergenic
983701080 4:170594779-170594801 ATGCTCAGCAATTATGTAACAGG + Intergenic
983701298 4:170597686-170597708 ATACCCAGTAATTGGATGGCTGG - Intergenic
983704864 4:170644888-170644910 ATACCCAGTAATTGGATGGCTGG - Intergenic
984010223 4:174361683-174361705 ATACTCAGTATTTGGGTGACGGG + Intergenic
984640633 4:182160525-182160547 ATGCTAAGTAATTCTGTGAATGG - Intronic
984665193 4:182419501-182419523 ATGCCCAGTAATGGGATGGCTGG - Intronic
984831258 4:183976608-183976630 ATGCTCACTACCTGGATGACAGG + Intronic
985327911 4:188794162-188794184 ATGCTCAGTAATTTAAAGAAAGG + Intergenic
985366738 4:189238952-189238974 ATGCTCAATACCTGGATGACAGG - Intergenic
985982234 5:3480332-3480354 ATACTCAGTAATGGGATGGCTGG - Intergenic
986057080 5:4148644-4148666 ATACTCAGTAATGGGATGGCTGG - Intergenic
986813236 5:11382024-11382046 ATGCTCAGTACCTGGGTGACAGG + Intronic
986866711 5:11997844-11997866 ATGCTCAGTACCTGTGTGATGGG + Intergenic
987175654 5:15305806-15305828 AAGCTCAGTACCTGGATGACAGG - Intergenic
987395506 5:17419292-17419314 ATGTTCACTACTTGTGTGACAGG + Intergenic
987641885 5:20622871-20622893 ATACTCAGTAATGGGATGGCTGG - Intergenic
987775665 5:22362562-22362584 ATACTCAGTAATGGGATGGCTGG - Intronic
987921386 5:24285610-24285632 ATACTCAGTAATGGGATGGCTGG + Intergenic
988003140 5:25375335-25375357 ATGCTCACTACTTGGGTGACAGG - Intergenic
988104670 5:26729322-26729344 ATGCTCACTACCTGGATGACAGG - Intergenic
988224112 5:28389919-28389941 ACACCCAGTAATTGGATGACTGG - Intergenic
988257723 5:28843512-28843534 ATACTCAGTAATGGGATGGCTGG + Intergenic
988374886 5:30423882-30423904 ATACTCAGTAATGGGATGGCTGG + Intergenic
988587054 5:32516300-32516322 ATACTCAGTAATGGGATGGCTGG + Intergenic
988689733 5:33560403-33560425 ATGCCCAGTAATGGGATGGCTGG - Intronic
988889204 5:35596396-35596418 ATACCCAGTAATGGGATGACTGG + Intergenic
989284440 5:39683025-39683047 ATACTCAGTAATGGGATGGCTGG + Intergenic
989299263 5:39869648-39869670 ATGCTCAGTACCTGCATGACAGG - Intergenic
989359962 5:40590504-40590526 ATACTCAGTAATGGGATTACTGG + Intergenic
989420590 5:41235586-41235608 ATACTCAGTAATGGGATGGCTGG + Intronic
989421836 5:41249205-41249227 ATGCTCAGTACTTGGGTGAGGGG + Intronic
989429198 5:41332575-41332597 ATACTCAGTAATGGGATGGCTGG - Intronic
989520202 5:42392458-42392480 ATACCCAGTAATGGGATGACTGG + Intergenic
989623496 5:43408120-43408142 ATGCCCAGTAATGGGATGGCTGG - Intronic
989713585 5:44431569-44431591 ATGTTCAGTAAATGTCAGACTGG - Intergenic
989799773 5:45523368-45523390 ATACTCAGTAATGGGATGGCTGG + Intronic
989820639 5:45791758-45791780 ATACTCAGTAATGGGATGGCTGG - Intergenic
989827132 5:45871161-45871183 ATACTCAGTAATGGGATGGCTGG - Intergenic
989835227 5:45980227-45980249 ATACTCAGTAATGGGATGGCTGG + Intergenic
989850187 5:46198909-46198931 ATACTCAGTAATGGGATGGCTGG - Intergenic
990134958 5:52633884-52633906 ATACTCAGTAATGGGATGGCTGG + Intergenic
990337403 5:54788245-54788267 ATGCCCAGTAATGGCATGCCTGG + Intergenic
990340575 5:54818578-54818600 ATGCCCAGTAATGGGATGGCTGG - Intergenic
990351683 5:54923590-54923612 ATGCCCAGTAATGGGATGGCTGG - Intergenic
990530076 5:56664686-56664708 ATGCTCACTACTTGGGTGACAGG - Intergenic
990534930 5:56711990-56712012 ATGCTCACTACCTGAATGACAGG + Intergenic
990541446 5:56776817-56776839 ATGCCCAGTAATGGGATGGCTGG + Intergenic
990634019 5:57703314-57703336 ATGCTCAGTACCTGGCTGACAGG - Intergenic
990686460 5:58308382-58308404 ATGCCCAGTAATGGGATGGCTGG - Intergenic
990702119 5:58484963-58484985 ATACTCTGTGATTGAATGACTGG + Intergenic
990924539 5:61005447-61005469 ATGCCCAGTAATGGGATGGCTGG + Intronic
990924750 5:61007783-61007805 ATACCCAGTAATGGGATGACTGG - Intronic
991212482 5:64121963-64121985 ATGCTCACTACTTGGATGACAGG - Intergenic
991495860 5:67225233-67225255 ATACCCAGTAATGGGATGACTGG + Intergenic
991519589 5:67480939-67480961 ATGCTCACTACTTGGGTGACAGG + Intergenic
991540516 5:67722639-67722661 ATACCCAGTAATGGGATGACTGG + Intergenic
991551151 5:67837212-67837234 ATACTCAGTAATGGGATGGCTGG - Intergenic
991563641 5:67982158-67982180 ATGCCCAGTAATGGGATGGCTGG - Intergenic
991649939 5:68841958-68841980 ATGCTCAGTACCTGGATGACAGG - Intergenic
991654204 5:68886733-68886755 ATACTCAGTAATGGGATTACTGG + Intergenic
992032225 5:72733221-72733243 ATGCCCAGTAATGGGATGGCTGG - Intergenic
992274771 5:75103480-75103502 ATGCCCAGTAATTGGATTGCTGG - Intronic
992580488 5:78170266-78170288 ATACTCAGTAATGGGATCACTGG + Intronic
992607445 5:78473564-78473586 ATGCTCACTACCTGGATGACAGG - Intronic
992652360 5:78872297-78872319 ATGCCCAGTAATGGGATGGCTGG - Intronic
992772686 5:80063044-80063066 ATGCCCAGTAATGGGATGGCTGG + Intronic
993024843 5:82633150-82633172 ATGCCCAGTAATGGGATGGCTGG + Intergenic
993374257 5:87130793-87130815 ATTCTCAGTAGTTGTGTGATGGG + Intergenic
993592067 5:89806514-89806536 ATGCCCAGTAATGGGATCACTGG - Intergenic
993665155 5:90686724-90686746 ATACTCAGTAATGGGATGGCTGG + Intronic
993699829 5:91105348-91105370 ATGCTCAGTAGTGGGATGGCTGG + Intronic
993742762 5:91561003-91561025 ATACCCAGTAATTGGATGGCTGG - Intergenic
993812423 5:92498119-92498141 ATACCCAGTAATGGGATGACTGG + Intergenic
993815656 5:92542042-92542064 ATGCCCAGTAATGGGATCACTGG - Intergenic
994127960 5:96190824-96190846 ATGCTCAGTACCTGGGTGACAGG - Intergenic
994338248 5:98595060-98595082 ATACTCAGTAATGGGATGGCTGG - Intergenic
994491910 5:100458611-100458633 ATACTCAGTAATGGGATGACTGG + Intergenic
994526853 5:100916526-100916548 ATGCCCAGTAATGGGATGGCTGG + Intergenic
994734152 5:103531744-103531766 ATACTCAGTAGTTGAATTACTGG - Intergenic
994987939 5:106961938-106961960 ATGCTCAGTAATGGGATTGCTGG - Intergenic
995117330 5:108496038-108496060 ATGCCCAGTAATGAGATGACTGG - Intergenic
995152555 5:108866067-108866089 ATACTCAGTAATGGGATGGCTGG - Intronic
995327500 5:110907718-110907740 ATGCCCAGTAATGGGATGGCTGG - Intergenic
995330362 5:110939587-110939609 ATGCCCAGTAATGGGATGGCTGG - Intergenic
995413716 5:111886453-111886475 ATACTCAGTAATGGGATGGCTGG - Intronic
995505479 5:112855800-112855822 ATGCCCAGTACTTGGAAGACAGG + Intronic
995529681 5:113080284-113080306 ATGCTCAGTAATGGGATGGCTGG - Intronic
995605772 5:113853748-113853770 ATACCCAGTAATGGGATGACTGG + Intergenic
995642472 5:114273375-114273397 ATGCCCAGTAATGGGATTACTGG + Intergenic
995708330 5:115008799-115008821 AAGTTCAGTATTTTTATGACTGG - Intergenic
995713799 5:115061829-115061851 ATGCCCAGTAATGGGATGGCTGG - Intergenic
995720225 5:115122875-115122897 ATGCCCAGTAATGGGATGGCTGG - Intergenic
996276884 5:121677808-121677830 ATGCCCAGTAATGGGATGGCTGG - Intergenic
996368931 5:122732816-122732838 ATGTTCAGTAAATGTTTGGCGGG + Intergenic
996895985 5:128483208-128483230 ACGCTCAGTACCTGGATGACAGG + Intronic
997455611 5:134015266-134015288 ATGCTCAATACCTGGATGACAGG + Intergenic
997851669 5:137338528-137338550 ATACTCAGTAATGGGATGGCTGG + Intronic
997861173 5:137418314-137418336 ATACTCAGTAATGGGATGGCTGG + Intronic
998382990 5:141738963-141738985 ATGCTTATTGATTGAATGACTGG - Intergenic
998437801 5:142127989-142128011 TTGGTCAGAAATTATATGACAGG + Intronic
998764337 5:145468426-145468448 ATACCCAGTAATTGGATGGCTGG + Intergenic
998809862 5:145955456-145955478 ATGCTCAGTACCTGGGTGACAGG + Intronic
999064991 5:148676063-148676085 ATTCTCATTAATTGAATCACTGG - Intronic
999834643 5:155356202-155356224 ATACTCAGTAATGGGATGGCTGG + Intergenic
1000411841 5:160941586-160941608 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1000499511 5:162031436-162031458 ATACCCAGTAATGGGATGACTGG + Intergenic
1000737953 5:164928958-164928980 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1000741692 5:164976368-164976390 ATGCTCAGTACCTATGTGACAGG - Intergenic
1000746530 5:165040895-165040917 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1000873802 5:166610234-166610256 ATGCTCACTATATGTATGATGGG + Intergenic
1001348333 5:170930920-170930942 ATGCCCAGTAATGGGATGACTGG + Intronic
1001805848 5:174585435-174585457 ATGCTCAGTACCTGTGTGATAGG - Intergenic
1001983872 5:176057367-176057389 ATACTCAGTAATGGGATGGCTGG - Intronic
1001986578 5:176078689-176078711 ATACTCAGTAATGGGATGGCTGG + Intronic
1002233602 5:177786692-177786714 ATACTCAGTAATGGAATGGCTGG + Intronic
1202772971 5_GL000208v1_random:30389-30411 ATACTCAGTAATGGGATGGCTGG + Intergenic
1002831365 6:824459-824481 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1002936432 6:1677427-1677449 ATGCCCAGTAATGGGATGGCTGG - Intronic
1003026326 6:2558633-2558655 ATGCCCAGGAATTTAATGACAGG + Intergenic
1003649277 6:7943693-7943715 ATACTCAGTAATGGGATGGCTGG + Intronic
1003700273 6:8456686-8456708 ATGCTCAGTAATGGGATTGCTGG + Intergenic
1003993842 6:11517691-11517713 ATGTTCACTATTTGGATGACAGG + Intergenic
1004457675 6:15806089-15806111 ATACCCAGTAATGGGATGACTGG + Intergenic
1004608438 6:17215690-17215712 ATGCTCACTACTTGGATGATGGG - Intergenic
1004730567 6:18354292-18354314 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1005968897 6:30745709-30745731 ATGCTCAGTACCTGGGTGACAGG + Intergenic
1007199159 6:40090895-40090917 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1007347797 6:41246539-41246561 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1007871412 6:45043411-45043433 ATGCTCACTACTTGGGTGACTGG - Intronic
1007995128 6:46299148-46299170 ATGCTCACTACTTGGATGATGGG + Intronic
1008069958 6:47089478-47089500 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1008083157 6:47215666-47215688 ATACTCAGTAATGGTATTACTGG - Intergenic
1008083881 6:47223583-47223605 ATACTCAGTTATGGTATTACTGG - Intergenic
1008163630 6:48108082-48108104 ATGCCCAGTAATAGGATGGCTGG - Intergenic
1008195693 6:48517276-48517298 ATACCCAGTAATGGGATGACTGG + Intergenic
1008333812 6:50275442-50275464 ATGCCCAGTAATGGAATGGCTGG + Intergenic
1008529473 6:52442805-52442827 ATGCCCAGTAATGGGATGGCTGG + Intronic
1008835073 6:55817231-55817253 ATGCCCAGTAATGGGATGGCTGG - Intronic
1008915125 6:56778893-56778915 ATACCCAGTAATGGGATGACTGG + Intronic
1009028144 6:58024458-58024480 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1009232621 6:61082310-61082332 ATACTCAGTAATGGGATGGCTGG + Intergenic
1009454123 6:63834683-63834705 ATGCCCAGTAATGGGATGGCTGG - Intronic
1009454864 6:63844365-63844387 ATACTCAGTAATTGGATTGCTGG + Intronic
1009483756 6:64194010-64194032 ATACTCAGTAATGGGATGGCTGG + Intronic
1009513658 6:64585368-64585390 ATGCTCACTACTTGGATGATGGG + Intronic
1009514235 6:64594391-64594413 ATACTCAGTAATGGGATGGCTGG + Intronic
1009537069 6:64900872-64900894 ATGCCCAGTAATTATATTACTGG - Intronic
1009921398 6:70066080-70066102 ATACCCAGTAATGGTATGGCTGG - Intronic
1009987657 6:70801027-70801049 ATACTCAGTAATGGGATGGCTGG + Intronic
1010399588 6:75433187-75433209 ATACCCAGTAATGGTATGGCTGG + Intronic
1010604497 6:77871596-77871618 ATGCTCAGTACATGGGTGACAGG + Intronic
1010620786 6:78071566-78071588 ATACTCAGTAATGGGATGGCTGG - Intergenic
1010667963 6:78652350-78652372 ATACTCAGTAATGGGATGGCTGG - Intergenic
1010680601 6:78794602-78794624 ATACCCAGTAATGGTATGGCTGG - Intergenic
1010853253 6:80803960-80803982 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1011168360 6:84476974-84476996 ATACTCAGTAATGGGATGGCTGG - Intergenic
1011200126 6:84826939-84826961 ATACTCAGTAATGGTATGGCTGG + Intergenic
1011295399 6:85821549-85821571 ATACCCAGTAATGGGATGACTGG - Intergenic
1011305971 6:85927103-85927125 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1011601802 6:89066480-89066502 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1011926010 6:92645559-92645581 ATGCCCAGTAACTGGATGGCTGG - Intergenic
1012043760 6:94242946-94242968 ATACTCAGTAATGGGATGGCTGG - Intergenic
1012156587 6:95826554-95826576 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1012162098 6:95898700-95898722 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1012481406 6:99671307-99671329 ATACTCAGTAATGGGATGGCTGG + Intergenic
1012587411 6:100940705-100940727 ATGCTCAGTAATGGGATTGCTGG + Intergenic
1013331804 6:109110049-109110071 ATGCCCAGTAATGGGATCACTGG + Intronic
1013439091 6:110143972-110143994 ATACCCAGTAATGGGATGACTGG + Intronic
1013484611 6:110584821-110584843 ATACTCAGTAATGGGATGGCTGG - Intergenic
1013544210 6:111139782-111139804 ATGCTCAGTAATAGGATTGCTGG + Intronic
1013862934 6:114658737-114658759 ATGCCCAGTAATGGGATTACTGG - Intergenic
1014133770 6:117864579-117864601 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1014368922 6:120580670-120580692 ATGCCCAGTAATGGGATTACTGG + Intergenic
1014433606 6:121397539-121397561 ATGCTCAGTACCTGGGTGACAGG - Intergenic
1014585084 6:123188096-123188118 ATGCTCAGTAATTGGATTGCTGG - Intergenic
1015005280 6:128272840-128272862 ATGCTCAGTAATGGGATGGCTGG - Intronic
1015080739 6:129222852-129222874 ATACCCAGTAATGGGATGACTGG + Intronic
1015180246 6:130354305-130354327 ATACTCAGTAATGGGATTACTGG - Intronic
1015374484 6:132493941-132493963 ATGCTCAGTAATTGTATGACAGG - Intronic
1016296879 6:142582624-142582646 ATACTCAGTAATGGGATGGCTGG - Intergenic
1016378366 6:143447877-143447899 ATGCTCAGTAATGGGATGGCTGG - Intronic
1017330783 6:153196159-153196181 ATACTCAGTAATGGGATGGCTGG - Intergenic
1018265125 6:162016292-162016314 ATGCTCAGTAATTTTCTAATCGG - Intronic
1018531961 6:164774946-164774968 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1019050771 6:169181617-169181639 ATACCCAGTAATGGGATGACTGG - Intergenic
1019941609 7:4296512-4296534 ATACTCAGTAATGGGATGGCTGG + Intergenic
1020348908 7:7196573-7196595 ATGCCCAGTAATGGGATGGCTGG + Intronic
1020703469 7:11512416-11512438 ATACTCAGTAATGGAATGGCTGG - Intronic
1020885697 7:13816795-13816817 ATGCTCAGAACTTGGGTGACCGG - Intergenic
1021037061 7:15812618-15812640 ATGCTCAGTACTTGGGTGAGGGG - Intergenic
1021176244 7:17453142-17453164 ATGCTCTATAATTGTATTGCAGG + Intergenic
1021589732 7:22248019-22248041 ATGCTCAGTACCTGGGTGACGGG + Intronic
1021789735 7:24192853-24192875 ATGCTCAGGCATTGTAAGAGTGG - Intergenic
1021843883 7:24745444-24745466 ATGATGAGGAATTGAATGACTGG - Intronic
1022188205 7:27989915-27989937 ATGCCCAGTAATAGGATGGCTGG - Intronic
1022406482 7:30095035-30095057 ATACTCAGTAATGGGATGGCTGG + Intronic
1022667181 7:32422425-32422447 ATGCTCACTACCTGTGTGACTGG - Intergenic
1022986523 7:35660387-35660409 ATGCCCAGTAATGGGATGGCTGG + Intronic
1023740139 7:43273222-43273244 ATGCTCAGTACCTGGTTGACAGG + Intronic
1024267017 7:47614603-47614625 ATGCTGAGTAATCGAATGGCTGG + Intergenic
1024352945 7:48385670-48385692 ATACTCAGTAATGGGATTACTGG + Intronic
1024826768 7:53399486-53399508 ATACCCAGTAATGGGATGACTGG + Intergenic
1025033715 7:55577691-55577713 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1025537815 7:62028264-62028286 ATACTCAGTAATGGGATGGCTGG + Intergenic
1026192148 7:68138754-68138776 ATGTTCAATATTTGGATGACAGG + Intergenic
1027294062 7:76748235-76748257 ATGCTCAGTAATGGGATTGCTGG + Intergenic
1027456914 7:78403509-78403531 ATACCCAGTAATTGGATGGCTGG + Intronic
1027539131 7:79445797-79445819 ATACCCAGTAATTGGATGGCTGG - Intronic
1027541513 7:79472600-79472622 ATGCTCACTACCTGGATGACGGG - Intergenic
1027578055 7:79955963-79955985 ATGCCCAGTAATGGTATTGCTGG - Intergenic
1027677393 7:81177352-81177374 ATACCCAGTAATGGGATGACTGG + Intronic
1027686572 7:81286089-81286111 ATACGCAGTAATGGGATGACTGG - Intergenic
1027896291 7:84050224-84050246 ATGCCCAGTAATGGGATGGCTGG + Intronic
1027930150 7:84521984-84522006 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1028050558 7:86179583-86179605 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1028117924 7:87022588-87022610 ATACCCAGTAATGGGATGACTGG + Intronic
1028121685 7:87062918-87062940 ATACCCAGTAATGGGATGACTGG + Intergenic
1028255038 7:88584966-88584988 ATACTCAGTAATGGGATGGCTGG + Intergenic
1028279396 7:88903036-88903058 ATGCTTATTACTTGTTTGACAGG - Intronic
1028305072 7:89252921-89252943 ATGCTCAGTAACTGGGTGACGGG + Intronic
1028335546 7:89649621-89649643 ATACTCAGTAGTTGGATTACTGG + Intergenic
1028561581 7:92181779-92181801 ATGCTCAGTACCTGGATGATGGG - Intergenic
1028616684 7:92776419-92776441 ATACTCAGTAATGGGATCACTGG + Intronic
1028642738 7:93061474-93061496 ATGCTCACTACTTGGGTGACAGG + Intergenic
1028713864 7:93941510-93941532 ATGCTCAGTACCTGGATGATGGG - Intergenic
1029015325 7:97310411-97310433 ATACCCAGTAATTGGATGGCTGG - Intergenic
1029802342 7:102962464-102962486 ATACTCAGTAATGGGATGGCTGG - Intronic
1029808522 7:103021961-103021983 ATACTCAGTAATGGGATGGCTGG - Intronic
1030404588 7:109095151-109095173 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1030767037 7:113422772-113422794 ATATTCATTAATTTTATGACTGG + Intergenic
1030778973 7:113573762-113573784 ATACCCAGTAATGGGATGACTGG - Intergenic
1030793659 7:113760295-113760317 ATACCCAGTAATGGGATGACTGG - Intergenic
1030794586 7:113771881-113771903 AGGCTCATTAATTGTTTGCCAGG - Intergenic
1030970624 7:116050778-116050800 ATGCCCAGTAATGGGATGGCTGG - Intronic
1031093483 7:117390547-117390569 ATACTCAGTAATGGGATGGCTGG + Intronic
1031128490 7:117803432-117803454 ATGCTCACTACTTGGGTGACAGG + Intronic
1031139264 7:117923721-117923743 ATACCCAGTAATGGGATGACTGG - Intergenic
1031175411 7:118342381-118342403 ATACCCAGTAATGGGATGACTGG + Intergenic
1031378521 7:121057385-121057407 ATGCTCAGTACCTGGGTGACAGG - Intronic
1031517876 7:122723659-122723681 ATACCCAGTAATGGGATGACTGG - Intronic
1031792774 7:126130837-126130859 ATGCTCACTACCTGTGTGACAGG + Intergenic
1031838892 7:126713077-126713099 ATACTCAGTAATGGGATTACTGG - Intronic
1032535807 7:132662652-132662674 ATACTCAGTAATGGGATGGCTGG + Intronic
1032687001 7:134244685-134244707 ATGCCCAGTAATGGGATGGCTGG - Intronic
1032978776 7:137256674-137256696 ATACTCAGTAATGGGATGGCTGG + Intronic
1033022901 7:137744996-137745018 ATGTTCACTACTTGGATGACAGG + Intronic
1033381298 7:140822059-140822081 ATGCTCAGTACTTGGATGATGGG + Intronic
1033413509 7:141142021-141142043 ATGCTCAGTAACTGGGTGACAGG - Intronic
1033526604 7:142221002-142221024 ATCATCAGTACTTGTATGAGAGG - Intronic
1033650293 7:143337254-143337276 GTGCTCAGTAAATGTAGGAAGGG - Intronic
1033769836 7:144537535-144537557 ATACTCAGTAATGGGATGGCTGG - Intronic
1033776548 7:144618118-144618140 ATACTCAGTAATGGGATGACTGG - Intronic
1033839177 7:145353249-145353271 ATACTCAGTAATGGGATGGCTGG + Intergenic
1033860130 7:145614632-145614654 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1033863890 7:145664169-145664191 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1033914603 7:146308459-146308481 ATGCGCAGTAATGGGATGGCTGG - Intronic
1035638981 8:1168390-1168412 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1035645725 8:1217468-1217490 ATACCCAGTAATTGGATTACTGG + Intergenic
1036495126 8:9263305-9263327 ATGCTCAGTACCTGGGTGACAGG + Intergenic
1036965948 8:13298764-13298786 ATGCTCACTACTTGAGTGACGGG + Intronic
1036974074 8:13390486-13390508 ATACTCAGTAATTGGATTGCTGG + Intronic
1037182246 8:16021791-16021813 ATGCTCAGTATCTGAGTGACGGG - Intergenic
1037406543 8:18548685-18548707 GAGCTCAGTGACTGTATGACAGG + Intronic
1037429293 8:18792807-18792829 ATGCCCAGTAATGGGATGGCTGG - Intronic
1037732417 8:21538683-21538705 ATACCCAGTAATGGGATGACTGG + Intergenic
1038103784 8:24410654-24410676 ATACTCAGTAATGGTATTGCTGG + Intergenic
1038656233 8:29454820-29454842 ATACCCAGTAATGGGATGACTGG - Intergenic
1038673390 8:29600609-29600631 ATACCCAGTAATGGGATGACTGG - Intergenic
1038877808 8:31570970-31570992 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1039063234 8:33588950-33588972 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1039090796 8:33827672-33827694 ATGCTCAGTACTTGGGTGACAGG + Intergenic
1039092778 8:33850180-33850202 ATGCTCAGTACCTGGATGAAGGG - Intergenic
1039111603 8:34046608-34046630 ATGCTCAGTATTTGGGTGATGGG - Intergenic
1039191397 8:34980331-34980353 ATGTTCAGTATTTGGGTGACTGG - Intergenic
1039265781 8:35822415-35822437 ATGCTCAGTAATGGGATTGCTGG - Intergenic
1039625247 8:39043716-39043738 ATGTTCACTATTTGAATGACAGG - Intronic
1039849606 8:41352457-41352479 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1040099495 8:43485671-43485693 ATGCTCAGTAATGGGATGGCTGG - Intergenic
1040118155 8:43648839-43648861 ATACTCAGTAATGGGATGGCTGG - Intergenic
1040961949 8:53043678-53043700 ATACTCAGTAATGGGATGGCTGG + Intergenic
1041000551 8:53446301-53446323 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1041018471 8:53614997-53615019 ATACCCAGTAATGGGATGACTGG - Intergenic
1041100426 8:54391386-54391408 ATGCTCAGTAAATGTTAGATAGG + Intergenic
1041147004 8:54887527-54887549 ATGCTCAGTACCTGGATGATCGG - Intergenic
1041204287 8:55482027-55482049 ATACTCAGTAATGGGATGGCTGG - Intronic
1041288678 8:56286907-56286929 ATACTCAGTAATGGGATTACTGG - Intergenic
1041335151 8:56773731-56773753 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1041523295 8:58778038-58778060 ATACTCAGTAATGGTATTATTGG - Intergenic
1041572110 8:59349591-59349613 ATACCCAGTAATGGTATTACTGG - Intergenic
1041600091 8:59706648-59706670 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1041818308 8:61999795-61999817 ATACTCAGTAATGGGATGGCTGG - Intergenic
1041841636 8:62278888-62278910 ATGCCCAGTAATTGGATGGCTGG + Intronic
1041842530 8:62288751-62288773 ATGCCCAGTAATAGGATGGCTGG + Intronic
1042002661 8:64143682-64143704 ATGATCAGTAATTCTATTGCTGG + Intergenic
1042015940 8:64311307-64311329 ATGTTCACTATTTGGATGACAGG + Intergenic
1042094930 8:65204188-65204210 ATGCTCAGTACCTGGATGACAGG + Intergenic
1042171244 8:65993362-65993384 ATACACAGTAATGGGATGACTGG + Intergenic
1042465791 8:69129254-69129276 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1042579493 8:70261083-70261105 ATGCCCAGTAATGGGATGGCTGG - Intronic
1042620200 8:70695687-70695709 ATACTCAGTAATGGGATGGCTGG + Intronic
1042713157 8:71742021-71742043 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1042763571 8:72296751-72296773 ATACCCAGTAATGGGATGACTGG - Intergenic
1042879224 8:73468936-73468958 ATACTCAGTAATGGGATGGCTGG - Intronic
1042958828 8:74280812-74280834 ATGCTCCGTAATTGCAAGGCAGG - Intronic
1043070927 8:75634957-75634979 ATACTCAGTAATGGGATGGCTGG + Intergenic
1043202114 8:77383214-77383236 ATACTCAGTAATGGGATGGCTGG + Intergenic
1043658320 8:82701779-82701801 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1043726466 8:83617805-83617827 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1043930573 8:86086167-86086189 ATGCTCACTACTTGAGTGACAGG + Intronic
1044080783 8:87880285-87880307 ATACCCAGTAATTGGATGGCTGG + Intergenic
1044144183 8:88691205-88691227 ATACTCAGTAATGGGATGGCTGG - Intergenic
1044179211 8:89167695-89167717 ATACCCAGTAATGGGATGACTGG - Intergenic
1044180829 8:89192035-89192057 ATACCCAGTAATGGGATGACTGG - Intergenic
1044353348 8:91192355-91192377 ATACTCAGTAATGGGATGGCTGG + Intronic
1044448696 8:92308875-92308897 ATACCCAGTAATTGGATCACTGG + Intergenic
1044718080 8:95119535-95119557 ATACTCAGTAATGGGATGGCTGG + Intergenic
1044816843 8:96122166-96122188 ATACTCAGTAATGGGATGGCTGG - Intergenic
1044901864 8:96955107-96955129 ATACTCAGTAATGGGATGGCTGG + Intronic
1044936775 8:97301099-97301121 ATACTCAGTAATGGGATGGCTGG - Intergenic
1044948766 8:97415704-97415726 ATACTCAGTAATGGGATGGCTGG - Intergenic
1044967798 8:97590088-97590110 ATACTCAGTAATGGGATGGCTGG + Intergenic
1045606535 8:103783777-103783799 ATGCCCAGTAATGGGATGGCTGG + Intronic
1045641675 8:104258298-104258320 TTACTGAGTAATTGTATGTCTGG - Intergenic
1045788994 8:105958922-105958944 ATACTCAGTAATGGCATGGCTGG - Intergenic
1045874474 8:106963069-106963091 ATACCCAGTAATTGGATGGCTGG + Intergenic
1045938610 8:107712434-107712456 ATACCCAGTAATTGGATGGCTGG + Intergenic
1046066872 8:109207775-109207797 ATACTCAGTAATGGGATGGCTGG - Intergenic
1046073516 8:109287678-109287700 ATGCTCAGTACCTGGGTGACAGG + Intronic
1046408937 8:113813681-113813703 ATGCTCACTACCTGAATGACAGG - Intergenic
1046435118 8:114177735-114177757 ATACTCAGTAATGGGATGGCTGG + Intergenic
1046557748 8:115796492-115796514 ATGCCCAGTAATGGGATGGCTGG + Intronic
1046992712 8:120477884-120477906 ATGCCCAGTAATGGGATGGCTGG - Intronic
1047016437 8:120728427-120728449 ATGCTCAGTACCTGGGTGACAGG - Intronic
1047091310 8:121578682-121578704 ATGCCCAGTAATGGGATTACTGG + Intergenic
1047770627 8:128027474-128027496 ATGCTCAGTAAGTGTTGGCCAGG - Intergenic
1047804906 8:128349143-128349165 ATACCCAGTAATGGGATGACTGG - Intergenic
1048098862 8:131325051-131325073 ATACCCAGTAATTGGATGGCTGG - Intergenic
1048120500 8:131575685-131575707 ATGCCCAGTAATGGTATTGCTGG - Intergenic
1048148769 8:131872465-131872487 ATACTCAGTAATGGGATGGCTGG - Intergenic
1048804175 8:138224079-138224101 ATGCTCAGTACCTGGGTGACAGG + Intronic
1049986563 9:957042-957064 ATGCTCAGTACCTGGGTGACAGG - Intronic
1050049452 9:1583951-1583973 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1050817071 9:9828135-9828157 ATACTCAGTAATGGGATGGCTGG - Intronic
1050829471 9:9992431-9992453 ATGCCCAGTAATGGGATGGCTGG - Intronic
1050930016 9:11311032-11311054 ATGCTCAGTATCTGCTTGACAGG + Intergenic
1050954447 9:11637180-11637202 ATGCCCAGTAATGGGACGACTGG + Intergenic
1051010508 9:12407136-12407158 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1051185792 9:14459999-14460021 ATACTCAGTAATGGGATGGCTGG - Intergenic
1051298672 9:15624822-15624844 ATGCCCAGTAATGGGATCACTGG + Intronic
1051515437 9:17925336-17925358 ATACTCAGTAATGGGATGGCTGG - Intergenic
1051563276 9:18467393-18467415 ATGATCAGTAACTCTTTGACAGG + Intergenic
1051719383 9:20020202-20020224 ATACCCAGTAATTGGATGGCTGG - Intergenic
1051725110 9:20081109-20081131 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1051786615 9:20751667-20751689 ATACCCAGTAATGGGATGACTGG + Intronic
1051940805 9:22503384-22503406 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1052098436 9:24412673-24412695 ATACCCAGTAATGGGATGACTGG - Intergenic
1052114958 9:24639248-24639270 ATACCCAGTAATGGGATGACTGG + Intergenic
1052217811 9:25988207-25988229 ATACTCAGTAATGGGATTACTGG - Intergenic
1052529746 9:29666536-29666558 ATGTTCACTAATTGCATGATGGG + Intergenic
1052604488 9:30681706-30681728 ATACTCAGTAATGGGATGGCTGG - Intergenic
1053561776 9:39203701-39203723 ATACCCAGTAATGGGATGACTGG - Intronic
1053827590 9:42041719-42041741 ATACCCAGTAATGGGATGACTGG - Intronic
1054135342 9:61415251-61415273 ATACCCAGTAATGGGATGACTGG + Intergenic
1054425951 9:65067490-65067512 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1054602970 9:67145722-67145744 ATACCCAGTAATGGGATGACTGG + Intergenic
1054938470 9:70714269-70714291 ATACTCAGTAATGGGATGGCTGG - Intronic
1054940161 9:70732262-70732284 ATACTCAGTAATGGGATGGCTGG - Intronic
1055133130 9:72798346-72798368 ATACCCAGTAATGGGATGACTGG - Intronic
1055177437 9:73337073-73337095 ATGCCCAGTAATTGGATTGCTGG - Intergenic
1055218446 9:73897112-73897134 ATGCTCAGTAATGGGATGGCTGG + Intergenic
1055239104 9:74162982-74163004 ATGCTCAGTACCTGGATGACAGG + Intergenic
1055367751 9:75563257-75563279 ATGCTCAGTAATGGGATGGCTGG + Intergenic
1055386329 9:75766471-75766493 ATACCCAGTAATTGGATTACTGG + Intergenic
1055755031 9:79549200-79549222 ATACCCAGTAATGGGATGACTGG - Intergenic
1055808340 9:80121804-80121826 ATACTCAGTAATGGGATGGCTGG - Intergenic
1055978696 9:81978818-81978840 ATGCTCAGTACCTGGGTGACAGG - Intergenic
1056182992 9:84103486-84103508 ATGCTCAGTACCTGGGTGACGGG + Intergenic
1056240882 9:84645469-84645491 ATGCCCAGTAATGGGATGACTGG + Intergenic
1056361522 9:85862269-85862291 ATGCTCAGTAATGGCATGGCTGG + Intergenic
1056562522 9:87744265-87744287 ATGCCCAGTAATGGGATCACTGG - Intergenic
1056565426 9:87768518-87768540 ATGCTCAGTATTTGGGTGACTGG - Intergenic
1056887988 9:90462374-90462396 ATACTCAGTAATGGGATGGCTGG - Intergenic
1057012138 9:91614077-91614099 ATGCCCAGTAATGGGATGGCTGG - Intronic
1057109187 9:92450605-92450627 ATACTCAGTAATGGGATGTCTGG + Intronic
1057175419 9:92993975-92993997 ATGCCCAGTAATGGGATGGCTGG + Intronic
1057985874 9:99713233-99713255 ATGCTCAGTACCTGGGTGACAGG - Intergenic
1058036020 9:100253925-100253947 ATGCCCAGTAATGGGATGGCTGG + Intronic
1058075508 9:100646391-100646413 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1058096936 9:100872405-100872427 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1058243341 9:102595386-102595408 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1058294295 9:103286554-103286576 ATACCCAGTAATGGGATGACTGG - Intergenic
1058442337 9:105020994-105021016 ATGCTCACTACTTGGATGACGGG + Intergenic
1058511941 9:105728598-105728620 ATACCCAGTAATGGGATGACTGG + Intronic
1059087310 9:111318240-111318262 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1059126907 9:111697701-111697723 ATACCCAGTAATGGTATGGCTGG + Intronic
1059178558 9:112190235-112190257 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1059573443 9:115465454-115465476 ATGCTCACTAACTGGATAACAGG + Intergenic
1059910545 9:119038949-119038971 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1059952058 9:119476415-119476437 ATACTCAGTAATGGGATGGCTGG - Intergenic
1060335192 9:122715429-122715451 ATACCCAGTAATTGGATGGCTGG - Intergenic
1061637420 9:131921656-131921678 ATGCCCAGTAATGGGATGGCTGG - Intronic
1203429539 Un_GL000195v1:78804-78826 ATGCCCAGTAATAGTATTGCTGG - Intergenic
1203356543 Un_KI270442v1:154153-154175 ATACTCAGTAATGGGATGGCTGG - Intergenic
1203686417 Un_KI270757v1:67591-67613 ATACCCAGTAATGGGATGACTGG - Intergenic
1185658299 X:1704278-1704300 ATACTCAGTAATGGGATGGCTGG + Intergenic
1185987173 X:4848035-4848057 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1186111288 X:6259088-6259110 ATGTTCACTATTTGCATGACGGG - Intergenic
1186202929 X:7172217-7172239 ATAATCAGTAATTGTATTATAGG + Intergenic
1186218266 X:7323319-7323341 ATGTTCACTACTTGGATGACAGG - Intronic
1186219570 X:7335117-7335139 ATACCCAGTAATGGTATGGCTGG + Intronic
1186666957 X:11726940-11726962 ATGCTCAGTACCTGGTTGACAGG - Intergenic
1186698118 X:12059558-12059580 ATGCTCAGTACCTGGGTGACAGG - Intergenic
1186910679 X:14161198-14161220 ATGCTCAGTAATGGGATTGCTGG + Intergenic
1186914088 X:14201199-14201221 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1186938667 X:14479480-14479502 ATCCTCAGTACCTGGATGACGGG - Intergenic
1187089916 X:16085338-16085360 ATGCTCAGTACCTGGGTGACAGG + Intergenic
1187199098 X:17117784-17117806 ATACCCAGTAATGGGATGACTGG + Intronic
1188326933 X:28816336-28816358 ATGCTCAGTAACTGGGTGATGGG - Intronic
1188354846 X:29178103-29178125 ATACTCAGTAATGGGATGGCTGG + Intronic
1188384705 X:29541825-29541847 ATGCTCAGTACCTGTGTGAGAGG + Intronic
1188423933 X:30024517-30024539 ATTATAAGTAATTGTTTGACTGG - Intergenic
1188485198 X:30674772-30674794 ATGCTCACTAACTGGGTGACGGG - Intronic
1188708274 X:33362441-33362463 ATGCCCAGTAATGGGATTACTGG - Intergenic
1189041405 X:37544536-37544558 ATGCCCAGTAATGGGATGGCTGG - Intronic
1189049429 X:37628957-37628979 ATGCCCAGTAATGGGATGGCTGG + Intronic
1189609913 X:42721259-42721281 ATACCCAGTAATGGGATGACTGG + Intergenic
1190017466 X:46839646-46839668 ATGCTCAGTAAACGTATCATTGG - Intronic
1190132560 X:47763178-47763200 ATACTCAGTAATAGGATTACTGG + Intergenic
1190357675 X:49620570-49620592 ATACCCAGTAATGGGATGACTGG + Intergenic
1190441631 X:50480657-50480679 ATGCTCACTACCTGGATGACAGG - Intergenic
1190504858 X:51117346-51117368 ATACTCAGTAATGGGATGGCTGG - Intergenic
1190870087 X:54417550-54417572 ATGCTCAGTACCTGGGTGACAGG + Intergenic
1191028531 X:55941998-55942020 ATACTCAGTAATGGGATGGCTGG - Intergenic
1191028994 X:55947118-55947140 ATACTCAGTAATGGGATGGCTGG - Intergenic
1191075899 X:56452897-56452919 ATACTCAGTAATGGGATGGCTGG - Intergenic
1191092821 X:56641634-56641656 ATACTCAGTAATGGGATGGCTGG - Intergenic
1191096551 X:56679322-56679344 ATGCTCAGTAATAGGATTTCTGG - Intergenic
1191147732 X:57186080-57186102 ATACTCAGTAATGGGATTACTGG + Intergenic
1191611021 X:63113752-63113774 ATACCCAGTAATGGTATTACTGG - Intergenic
1191647485 X:63497720-63497742 ATACCCAGTAATGGGATGACTGG - Intergenic
1191739314 X:64419617-64419639 ATGCCCAGTAATAGAATGGCTGG + Intergenic
1191803624 X:65108767-65108789 ATGCTCTACATTTGTATGACTGG + Intergenic
1191916255 X:66205012-66205034 ATGCTCACTACCTGGATGACAGG - Intronic
1191926344 X:66314890-66314912 ATACTCAGTAATGGGATGGCTGG + Intergenic
1191932420 X:66388673-66388695 ATACTCAGTAATGGGATGGCTGG + Intergenic
1191959703 X:66687499-66687521 ATACCCAGTAATGGGATGACTGG + Intergenic
1191963997 X:66736173-66736195 ATACCCAGTAATGGGATGACTGG + Intergenic
1192061934 X:67837030-67837052 ATACCCAGTAATGGGATGACTGG - Intergenic
1192096987 X:68222410-68222432 ATACCCAGTAATGGGATGACTGG - Intronic
1192289924 X:69783801-69783823 ATACCCAGTAATGGGATGACTGG + Intronic
1192324391 X:70119960-70119982 ATGTTCAATAAATGTATGATAGG + Intergenic
1192376948 X:70572482-70572504 ATACTCAGTAATGGGATGGCTGG - Intronic
1192386472 X:70677086-70677108 ATGCTCAGTAATTTTTTTGCTGG + Intronic
1192725000 X:73740545-73740567 ATACTCAGTAATGGGATGGCTGG - Intergenic
1192879408 X:75267069-75267091 ATACCCAGTAATTGGATGGCTGG - Intergenic
1192903883 X:75528908-75528930 ATGCACAGTACTTGGGTGACAGG - Intergenic
1192921374 X:75710405-75710427 ATACCCAGTAATGGGATGACTGG + Intergenic
1192930939 X:75805316-75805338 ATACCCAGTAATCGTATGGCTGG + Intergenic
1192949279 X:75999293-75999315 ATGCCCAGTAATTGGATTGCTGG + Intergenic
1193131131 X:77920823-77920845 ATACTCAGTAATGGGATTACTGG + Intronic
1193229044 X:79021629-79021651 ATACCCAGTAATGGGATGACTGG - Intergenic
1193313446 X:80036552-80036574 ATGCTCAGTACGTGGGTGACGGG - Intergenic
1193316903 X:80075641-80075663 ATACTCAGTAATGGGATGGCTGG - Intergenic
1193415822 X:81222682-81222704 ATGCCCAGTAATGGGATGGCTGG + Intronic
1193419415 X:81265718-81265740 ATGCCCAGTAATGGGATGGCTGG + Intronic
1193559143 X:82996063-82996085 ATGCACAGTAATGGGATGGCTGG - Intergenic
1193559587 X:83001359-83001381 ATACTCAGTAATGGGATGACTGG - Intergenic
1193582331 X:83281417-83281439 ATACTCAGTAATGGGATGGCTGG + Intergenic
1193583386 X:83291893-83291915 ATACCCAGTAATGGGATGACTGG - Intergenic
1193604982 X:83555720-83555742 ATGCTTAGTATCTGTGTGACAGG + Intergenic
1193831075 X:86289931-86289953 ATACCCAGTAATTGGATGGCTGG + Intronic
1193877863 X:86884294-86884316 ATACCCAGTAATGGGATGACTGG - Intergenic
1193929383 X:87533185-87533207 ATACCCAGTAATGGCATGACTGG - Intronic
1194035203 X:88862852-88862874 ATGCTCAGTAATGGGATTGCTGG + Intergenic
1194272221 X:91830381-91830403 AGGCACAGTAATTATAAGACTGG - Intronic
1194442279 X:93947364-93947386 ATGCTCAGTACCTGCATGATGGG + Intergenic
1194544387 X:95214687-95214709 ATGCCCAGTAATGGAATGGCTGG - Intergenic
1194628117 X:96249763-96249785 ATACTCAGTAATGGGATGGCTGG - Intergenic
1194648947 X:96492040-96492062 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1194829168 X:98599097-98599119 ATGCTCAGTAATGGAATTGCTGG - Intergenic
1194904068 X:99551655-99551677 ATGCTCACTACTTGGGTGACAGG - Intergenic
1194913190 X:99672767-99672789 ATGCCCAGTAATGGTATTGCTGG - Intergenic
1195121657 X:101760257-101760279 ATGCTCAGTACCTGGGTGACAGG - Intergenic
1195204269 X:102579917-102579939 ATACTCAGTAATGGGATGGCTGG - Intergenic
1195354628 X:104027382-104027404 ATACTCAGTAATGGGATGGCTGG + Intergenic
1195714178 X:107802507-107802529 ATGTTCAGTACCTGGATGACAGG - Intergenic
1195847459 X:109243500-109243522 ATACTCAGTAATGGGATTACTGG + Intergenic
1196149152 X:112353314-112353336 ATGCCCAGTAATAGGATGGCTGG - Intergenic
1196223858 X:113142219-113142241 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1196307564 X:114122343-114122365 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1196562685 X:117169457-117169479 ATACTCAGTAATGGGATGGCTGG - Intergenic
1196632055 X:117953036-117953058 ATACTCAGTAATGGGATGGCTGG - Intronic
1196728226 X:118916301-118916323 ATGCTTATTAGTTGCATGACTGG - Intergenic
1196896641 X:120343456-120343478 ATACCCAGTAATTGGATTACTGG + Intergenic
1197145951 X:123172458-123172480 ATGCTCACTACTTGGGTGACAGG + Intergenic
1197260336 X:124310527-124310549 ATACTCAGTAATGGGATCACTGG + Intronic
1197409992 X:126104635-126104657 ATACCCAGTAATGGTATGGCTGG + Intergenic
1197507985 X:127332245-127332267 ATACTCAGTAATGGGATGGCTGG - Intergenic
1197527495 X:127580439-127580461 ATACTCAGTAATGGGATGGCTGG + Intergenic
1197672493 X:129293567-129293589 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1197865441 X:131011801-131011823 ATGCTTAATAAATGTTTGACAGG + Intergenic
1198168883 X:134085074-134085096 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1198172662 X:134122799-134122821 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1198347767 X:135775803-135775825 ATACTCAGTAATGGGATGGCTGG - Intergenic
1198349672 X:135793065-135793087 ATACTCAGTAATGGGATGGCTGG - Intergenic
1198351576 X:135810340-135810362 ATACTCAGTAATGGGATGGCTGG - Intergenic
1198353486 X:135827603-135827625 ATACTCAGTAATGGGATGGCTGG - Intergenic
1198355392 X:135844858-135844880 ATACTCAGTAATGGGATGGCTGG - Intergenic
1198357302 X:135862143-135862165 ATACTCAGTAATGGGATGGCTGG - Intergenic
1198359216 X:135879423-135879445 ATACTCAGTAATGGGATGGCTGG - Intergenic
1198365577 X:135936365-135936387 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1198558293 X:137819614-137819636 ATGCTCAGTACCTGGGTGACGGG + Intergenic
1198818433 X:140618195-140618217 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1198820122 X:140638556-140638578 ATGCCCAGTAATGGGATGACTGG - Intergenic
1199037648 X:143072117-143072139 GTGCTCAGTAATTGTGTGATGGG + Intergenic
1199140541 X:144306577-144306599 ATGCCCAGTAATGGGATGGCTGG + Intergenic
1199413060 X:147548016-147548038 ATACCCAGTAATGGAATGACTGG - Intergenic
1199458194 X:148053127-148053149 ATGCTCAGTACTTGGGTGATGGG - Intergenic
1199621826 X:149708330-149708352 ATGCTCACTACTTGAGTGACGGG + Intronic
1199803812 X:151277489-151277511 ATACCCAGTAATGGGATGACTGG - Intergenic
1200036183 X:153332933-153332955 ATGTTCAGTACTTGGATGACAGG + Intergenic
1200589467 Y:5051803-5051825 AGGCACAGTAATTATATAACTGG - Intronic
1200872476 Y:8117490-8117512 ATGCCCAGTAATGGGATGGCTGG - Intergenic
1200881962 Y:8223785-8223807 ATACCCAGTAATGGTATGGCTGG - Intergenic
1200889321 Y:8306208-8306230 ATACCCAGTAATGGTATGGCTGG + Intergenic
1200948822 Y:8872018-8872040 ATACCCAGTAATTGGATGGCTGG + Intergenic
1201246840 Y:12013078-12013100 ATACCCAGTAATGGGATGACTGG - Intergenic
1201387934 Y:13463375-13463397 ATACTCAGTAATGGGATGGCTGG + Intronic
1201394102 Y:13529510-13529532 ATACCCAGTAATTGGATGGCTGG - Intergenic
1201410718 Y:13696792-13696814 ATACCCAGTAATGGGATGACTGG - Intergenic
1201415128 Y:13741230-13741252 ATACCCAGTAATGGGATGACTGG + Intergenic
1201480222 Y:14430786-14430808 ATGCTCACTACTTGGTTGACGGG + Intergenic
1201591172 Y:15616515-15616537 ATACTCAGTAATGGGATGGCTGG - Intergenic
1201626355 Y:16018940-16018962 ATACCCAGTAATAGGATGACTGG + Intergenic
1201669839 Y:16506744-16506766 ATACTCAGTAATGGGATGGCTGG - Intergenic
1201740325 Y:17317197-17317219 ATACCCAGTAATTGGATGGCTGG - Intergenic
1202022718 Y:20482674-20482696 ATACCCAGTAATGGTATGGCTGG - Intergenic
1202084715 Y:21124045-21124067 ATACCCAGTAATTGGATGGCTGG + Intergenic
1202586327 Y:26431847-26431869 ATGCCCAGTAATGGGATTACTGG + Intergenic