ID: 1015374905

View in Genome Browser
Species Human (GRCh38)
Location 6:132499457-132499479
Sequence TTGCAAGTGTAGATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 279}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015374905 Original CRISPR TTGCAAGTGTAGATGGAGGA AGG (reversed) Intronic
901044334 1:6386368-6386390 TTACAAGAGTAGAGGGAGGAGGG + Intronic
901909033 1:12439430-12439452 CTGCAATTTTAGATGGGGGAGGG - Intronic
902725127 1:18330485-18330507 ATGCCACTGTAGCTGGAGGAAGG + Intronic
903468856 1:23570900-23570922 TTGCAGAAGTAGATGGAGGTGGG + Intergenic
903963767 1:27073287-27073309 TTGGAAGTGCAGAGGGAGGATGG - Intergenic
904198326 1:28802475-28802497 TTGCAAGTGGAGGTTGATGAGGG - Intergenic
904679584 1:32219734-32219756 TTGCAACAGTAGATGGAAGAAGG + Intronic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905592337 1:39175128-39175150 TTGCAAGAGAGGATGGAGCAAGG - Intronic
907785833 1:57611759-57611781 TGGCAAGAGTAGATGTAGCAAGG - Intronic
908673108 1:66570767-66570789 CTACAAGTTTAAATGGAGGATGG - Intronic
910048663 1:82950565-82950587 TTGGACGTATAGATGGAGTAAGG + Intergenic
910929072 1:92424433-92424455 TATCAAGTGTAGATGGAAGAAGG + Intergenic
911272394 1:95818589-95818611 CTGCAAGTAGAGATGGAGAATGG - Intergenic
914376167 1:147075867-147075889 TTCCAGGTGTGGGTGGAGGAAGG - Intergenic
916340288 1:163726190-163726212 TATTAAATGTAGATGGAGGATGG - Intergenic
916488251 1:165278574-165278596 CTGCAGGTGAAGAGGGAGGATGG - Intronic
916561662 1:165938996-165939018 ATGCACCTGAAGATGGAGGAAGG - Intergenic
917601635 1:176580157-176580179 TTGGAAGTGTAGCAGGAAGAGGG - Intronic
917687407 1:177431398-177431420 TCTCAAGTGCACATGGAGGAAGG - Intergenic
917751384 1:178056661-178056683 TGGTAAATGGAGATGGAGGAAGG - Intergenic
918366499 1:183813319-183813341 TTGCTAGTGTATATGGAGGAAGG - Intronic
919525500 1:198643858-198643880 TTGCAAGGGCAGATGGAATATGG + Intronic
920841239 1:209555776-209555798 TTGTGAGTGTATATGGATGACGG + Intergenic
921345998 1:214185694-214185716 TTGAAAGTGTAGAATTAGGATGG - Intergenic
924327661 1:242911875-242911897 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1064110368 10:12533615-12533637 TTTCAAGAGTAGAGGGAGGCAGG - Intronic
1065722073 10:28636704-28636726 TTGCAAGTGTGCATGGAGCAGGG + Intergenic
1066392802 10:34991966-34991988 TTGGAAGTGGGGATGGAGCAAGG + Intergenic
1066615641 10:37290973-37290995 CTGCCAATGGAGATGGAGGAAGG + Intronic
1068440567 10:57050089-57050111 TGTCCAGTGTAGATGGAAGAAGG - Intergenic
1068613395 10:59085733-59085755 TGAGAAGTGTAGAAGGAGGAAGG + Intergenic
1068766449 10:60769538-60769560 TGGCAAGTAGAGATGGAAGAAGG - Intergenic
1069148190 10:64922447-64922469 TTGGAAGTGTAGCTGGGGGTGGG + Intergenic
1069788961 10:71007218-71007240 TTGGATGGGTAGATGGATGATGG - Intergenic
1070210774 10:74318271-74318293 ATGGAGGTGGAGATGGAGGAAGG - Intronic
1072582748 10:96753827-96753849 TAGCAAGGGTGGGTGGAGGATGG + Intergenic
1072663830 10:97380124-97380146 TTGAAAGTGTGGCTGGGGGAGGG - Intronic
1074124461 10:110517028-110517050 GTGTAAGTGTGGAAGGAGGAGGG + Intergenic
1076600071 10:131651671-131651693 TTGCTAATGCAGATGAAGGAGGG - Intergenic
1078337381 11:10474808-10474830 GTGCAAGTGTGGGTGGGGGAAGG + Intronic
1078473496 11:11610696-11610718 TTCTAAGAGTAAATGGAGGAAGG - Intronic
1080969756 11:37258478-37258500 TTGGAAGTGTTGAAGGAGGAGGG + Intergenic
1084088357 11:66865052-66865074 TTGGAAGTGGGGATGGAGGGAGG + Intronic
1084682989 11:70677934-70677956 ATGCCAGTGGAGATGGTGGAAGG - Intronic
1088943221 11:114481894-114481916 TTGCAAGTGTATAGGAAGGGTGG - Intergenic
1090029445 11:123194914-123194936 TAGCAAGAGGAGAAGGAGGAGGG + Exonic
1090339096 11:125999723-125999745 GTGACAGTGTGGATGGAGGAAGG - Intronic
1090725367 11:129520943-129520965 TTGCTGGTGTGGATGCAGGATGG + Intergenic
1091395053 12:149306-149328 TTGCATGTGCAGTGGGAGGAAGG + Intronic
1091604325 12:1937139-1937161 TTGTCAGTGTAGATGCAGGTGGG - Intergenic
1093006857 12:14060667-14060689 GTGCTAGTGTAGATGGAGAAAGG + Intergenic
1093184882 12:16008385-16008407 TTGCCAGTGTAGATGGGGTGGGG + Intronic
1094213223 12:27914428-27914450 TGGGAAGTGTAGGGGGAGGAGGG + Intergenic
1096531214 12:52243997-52244019 TTGGAGGTGTTGATGGGGGAAGG + Intronic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1096867402 12:54572963-54572985 TTGCAGGTTCGGATGGAGGAAGG + Intronic
1097622533 12:61957986-61958008 ATGCTATTGTAGATGGAGGTTGG - Intronic
1097811606 12:64024991-64025013 TAGCAAATGTAAATGGAGGATGG + Intronic
1097953302 12:65456839-65456861 TTGCCCTTGTGGATGGAGGAGGG + Intronic
1099199844 12:79662806-79662828 TGGCATGTGAAGATGGAGTAAGG + Intronic
1101462084 12:104906369-104906391 TTGGAGGTGTAGATGGAGCTTGG + Intronic
1104357913 12:128104490-128104512 ATGCAGGTGGAGATAGAGGAAGG - Intergenic
1105483580 13:20803509-20803531 TTGGGAGTGAAGATGGAGAAAGG - Intronic
1108716955 13:53090346-53090368 TTGCCATTGTAGATGGAGGCTGG + Intergenic
1110272815 13:73609936-73609958 TTGCATGTGTTGAAGTAGGAGGG + Intergenic
1111002147 13:82198330-82198352 TTGTAATAGAAGATGGAGGATGG + Intergenic
1112332094 13:98484576-98484598 TTGGAAGTGCAGAAGGACGAGGG - Intronic
1113386040 13:109849146-109849168 CTGCATGTGTAGAAGGATGATGG + Intergenic
1113612216 13:111655123-111655145 TGGGGAGTGAAGATGGAGGAAGG + Intronic
1114733876 14:25022950-25022972 TTGCAAGGGAAGATGGGGTAAGG + Intronic
1114753933 14:25237241-25237263 TTGCATGTGTATGTGGATGAGGG + Intergenic
1115165310 14:30441622-30441644 TTGCAACTGTAGGTGGAGACAGG - Intergenic
1116544058 14:46140749-46140771 TTGGAAGGGTAAAAGGAGGAGGG - Intergenic
1116997053 14:51335305-51335327 TAGCTAGTGTAGAGGGATGATGG + Intergenic
1117274461 14:54178765-54178787 TTACAAGTGTATACGGAGGTGGG + Intergenic
1117363317 14:54999336-54999358 ATGCATGTGAAGATGGGGGAGGG + Intronic
1120793645 14:88608017-88608039 TTGCAAGGTGAGATGGGGGATGG - Intronic
1120858782 14:89235760-89235782 TTGTCTGTGAAGATGGAGGATGG + Intronic
1121257843 14:92544297-92544319 TTCCAGGTGTAGATGTAGGCGGG - Intronic
1123058830 14:105585337-105585359 ATGGAAGGGTGGATGGAGGATGG - Intergenic
1123083157 14:105705563-105705585 ATGGAAGGGTGGATGGAGGATGG - Intergenic
1125107154 15:35985532-35985554 TGGCAAGGGCAGATGGAGGAGGG + Intergenic
1125167605 15:36726683-36726705 TTGCAATGTTAGATGGAGAATGG - Intronic
1126850370 15:52793071-52793093 TTGCATGTGTGGAGGGAGGACGG + Intergenic
1129672838 15:77616617-77616639 TTGCAGGTGCAGGGGGAGGAGGG - Intronic
1130630659 15:85565552-85565574 TACCAACTGTAGATGTAGGAAGG + Intronic
1133492953 16:6289242-6289264 TTGGAAGTGTGGATATAGGATGG + Intronic
1133564177 16:6977712-6977734 TTGAAATTGTGGGTGGAGGAAGG + Intronic
1136381857 16:29899629-29899651 GAGGAAGTGCAGATGGAGGAGGG + Intergenic
1136450941 16:30353980-30354002 CTGCAGGAGGAGATGGAGGAAGG - Exonic
1136604952 16:31327225-31327247 ATGCAAGATTAGATGGGGGACGG + Intronic
1137579717 16:49626590-49626612 GTGGATGGGTAGATGGAGGATGG - Intronic
1137579736 16:49626700-49626722 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579754 16:49626775-49626797 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579771 16:49626850-49626872 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579781 16:49626892-49626914 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579793 16:49626951-49626973 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579802 16:49626986-49627008 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579819 16:49627061-49627083 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579829 16:49627103-49627125 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579857 16:49627229-49627251 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579868 16:49627276-49627298 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579879 16:49627323-49627345 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579901 16:49627418-49627440 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579912 16:49627465-49627487 ATGAATGGGTAGATGGAGGATGG - Intronic
1137579924 16:49627524-49627546 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579935 16:49627568-49627590 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579959 16:49627688-49627710 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580000 16:49627866-49627888 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580017 16:49627941-49627963 ATGGATGGGTAGATGGAGGATGG - Intronic
1137619972 16:49869707-49869729 TTGGAAGAGTAGATGCAGAAAGG + Intergenic
1139139687 16:64246198-64246220 CTGAAAGTGTGGAGGGAGGAAGG + Intergenic
1140893502 16:79305380-79305402 TTCCAACAGTAGATGGAGGTTGG - Intergenic
1141012266 16:80413877-80413899 AAGCAAGTGAGGATGGAGGAGGG + Intergenic
1143284923 17:5781800-5781822 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143284929 17:5781834-5781856 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143284946 17:5781924-5781946 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1144660703 17:17067606-17067628 GTGGAACTGTGGATGGAGGAGGG + Intronic
1146572116 17:33961847-33961869 TGGAAAGTGGAGATGGAGGTTGG - Intronic
1146931462 17:36781074-36781096 TTGCAAGTTGAGACGAAGGAGGG - Intergenic
1147484756 17:40801861-40801883 ATGGAAGTGAAGAAGGAGGATGG + Intergenic
1150905552 17:69333013-69333035 CTGGCAGTGAAGATGGAGGAAGG + Intergenic
1152473645 17:80503833-80503855 GTGGATGTGTGGATGGAGGATGG + Intergenic
1156668249 18:39434879-39434901 TGGCAAGTGAAGTTGGGGGAAGG + Intergenic
1157475284 18:48020142-48020164 GTGGAAGTCTGGATGGAGGAGGG - Intergenic
1159491054 18:69135064-69135086 TTGAAAGTGTAAAAGGATGAGGG - Intergenic
1160312442 18:77808479-77808501 TTCCAAGGGTGGAGGGAGGAAGG - Intergenic
1160681819 19:415181-415203 ATGGATGTGTAGATGGGGGATGG + Intergenic
1160681860 19:415434-415456 ATGGATGTGTAGATGGGGGATGG + Intergenic
1160960283 19:1717886-1717908 ATTCATGGGTAGATGGAGGACGG + Intergenic
1160960326 19:1718084-1718106 ATTCATGGGTAGATGGAGGATGG + Intergenic
1161619295 19:5289924-5289946 TTGCAAGAGGACATGGTGGAGGG - Intronic
1161675734 19:5647504-5647526 TTGGAAGAGGAGATGAAGGAGGG + Intronic
1162062935 19:8107688-8107710 ATGAATGGGTAGATGGAGGATGG + Intronic
1162404001 19:10462636-10462658 TGGAAAGTGAAGATGGAGAAGGG - Intronic
1163148251 19:15396840-15396862 GTGCAAGTGTTGCTGGAGGAGGG - Intronic
1166170205 19:41023076-41023098 TTACGAGTGTATCTGGAGGAAGG - Intergenic
1168441034 19:56367429-56367451 TCACAAATGGAGATGGAGGAGGG + Intronic
927407036 2:22782355-22782377 TTGAATGTGTTGATGGAGGGTGG + Intergenic
928061323 2:28116165-28116187 AGGCTAATGTAGATGGAGGAGGG + Intronic
928853630 2:35779210-35779232 TGGCAAGTGAAGATTAAGGAAGG + Intergenic
929434611 2:41918944-41918966 TTGTTGGTATAGATGGAGGATGG + Intergenic
932087321 2:68774126-68774148 TGCCAAGTGTTGCTGGAGGAAGG - Intronic
932425940 2:71635210-71635232 ATGAAAGTGTAGAAGGAGAAAGG - Intronic
933429454 2:82156989-82157011 TTGTAATTGCAGATGGATGATGG - Intergenic
935148958 2:100417060-100417082 TTGTAATTGTAGATGGAGAGAGG - Intronic
935355671 2:102197282-102197304 TTGCAGGTGAAGATGCTGGAAGG + Intronic
936807385 2:116352256-116352278 TTACAAGTGTATATTGTGGATGG - Intergenic
939481526 2:142753977-142753999 AAGTAAGTGTAGATGGAGAAGGG + Intergenic
939722815 2:145676574-145676596 TTCCAAGGGGAGATGGAAGATGG - Intergenic
941465137 2:165816703-165816725 TTGGAAGGGTAGAAGGTGGATGG + Intergenic
941653691 2:168120891-168120913 TAGCAAGTGTAGAGGGAAGGAGG - Intronic
942455528 2:176135923-176135945 TTGCAAGATGAGAGGGAGGAGGG + Intergenic
943139004 2:183954595-183954617 TTGCAAGTGGAGAGGAAGGGAGG + Intergenic
943939195 2:193969337-193969359 TTGTAAGTGGAGTTGGGGGAGGG - Intergenic
943945838 2:194062592-194062614 TTGTAACTGTAGATGCAGCATGG + Intergenic
944744673 2:202643284-202643306 TGGTAAATGTAGATGGAGCAAGG + Intronic
945686600 2:212978365-212978387 TTGCACTTGTAGTTGAAGGAGGG - Intergenic
946378827 2:219331033-219331055 TGGCAAGTGGTGATGGAGGAAGG - Intronic
1169840339 20:9928839-9928861 TTGGGAGTGTGGATGGAGGATGG + Intergenic
1174480948 20:50831130-50831152 TTGCAAGAATGGATGGAGGCTGG + Intronic
1174852124 20:54005824-54005846 TGTCAAGTGGACATGGAGGAAGG + Intronic
1175172124 20:57088124-57088146 TTACAAGAGCAGATGGCGGATGG - Intergenic
1178279714 21:31270979-31271001 TTGTCATTTTAGATGGAGGAGGG - Intronic
1179072885 21:38089482-38089504 TTGAAGATGAAGATGGAGGAAGG + Intronic
1179328575 21:40375645-40375667 TTGCTATTCTAGATGAAGGAGGG - Intronic
1179330037 21:40391007-40391029 TTGCAAGTGTAGGGAGTGGAGGG + Intronic
1179343447 21:40533802-40533824 TTTCAAACCTAGATGGAGGAAGG - Intronic
1179570722 21:42277350-42277372 TTGCAAGTGTAGGTGGATGGAGG - Intronic
1183035454 22:35137783-35137805 CTGCCAGTGGACATGGAGGATGG + Intergenic
1183781281 22:40000515-40000537 TTGCCAGTGTAGCTGAATGAGGG - Intronic
1183857170 22:40642663-40642685 TTGCATGTGTATATGGAGACAGG + Intergenic
1184339159 22:43876411-43876433 GTGCAAGTGCAAATGTAGGATGG - Intergenic
1184388027 22:44187310-44187332 TTGGACGTGAAGATGGAGGTGGG - Intronic
950381644 3:12620447-12620469 AAGAAAGTGTGGATGGAGGAAGG - Intronic
950534220 3:13570025-13570047 ATGCAGGTGAGGATGGAGGATGG + Intronic
951855600 3:27193497-27193519 TTGGATGTGTTGCTGGAGGAGGG - Intronic
952040937 3:29261114-29261136 TGGCAAGACTAGAAGGAGGAGGG + Intergenic
952478058 3:33731574-33731596 GTGCAGGTGTAGATGGTGCAGGG - Intergenic
953791564 3:45951621-45951643 TGGTCAGTGTAGATGGTGGAGGG + Intronic
954848812 3:53582937-53582959 TTGAAAGTGTAGGAGGAAGAGGG + Intronic
955590586 3:60530714-60530736 TGGCAAGTCAAGATGGATGATGG + Intronic
957177758 3:76833748-76833770 TTACCAGTGTAAAGGGAGGAAGG - Intronic
957219812 3:77367348-77367370 TTGCAAGTGTCCTTGGAGTACGG + Intronic
960871461 3:122254007-122254029 TTACAAGTCTGGATTGAGGAAGG + Exonic
961209964 3:125118041-125118063 TGGCAAGTGGAGAAGGAGGCTGG - Intronic
962257766 3:133884146-133884168 TTGCCAGTGTAGCTGGTGCATGG - Intronic
962908557 3:139826807-139826829 TTGCAAGTGGAGAGGGAGGGTGG - Intergenic
966929843 3:184669320-184669342 TTGCAAGTGTTGAAGGAGCCAGG + Intronic
967617600 3:191590861-191590883 TTGCAATTGTAAAAGAAGGATGG - Intergenic
968939909 4:3632372-3632394 TTTCCAGTGGAGAAGGAGGAGGG + Intergenic
969166122 4:5315612-5315634 TGGAAAGAGTAGATGAAGGAAGG + Intronic
969198018 4:5578643-5578665 ATGGAAGTGTGGATGGAGGGAGG + Intronic
969304746 4:6319147-6319169 CTGGATGTGAAGATGGAGGAGGG - Intergenic
970018083 4:11535052-11535074 TTGCATTTGGAGATGGAGGAGGG + Intergenic
970056095 4:11973588-11973610 TTGCAAGTGTTGATGGTGGGAGG + Intergenic
970187171 4:13469505-13469527 TTGGAACTGAAGTTGGAGGAAGG - Intronic
971461630 4:26904965-26904987 TTGAAAGTGTAGACAGTGGATGG + Intronic
971778231 4:30995847-30995869 TTGCACGAGAAGATGGAGGCAGG - Intronic
974373722 4:61049559-61049581 TTGCAAGAGATGATGGAGGGGGG + Intergenic
974468801 4:62292700-62292722 TTGCAAGGGCAGAAGGAAGAAGG - Intergenic
975376351 4:73650841-73650863 GTGCAAGTGTATATGTTGGAAGG - Intergenic
976978437 4:91193011-91193033 TTGCATGTATAGTTTGAGGAAGG - Intronic
978353020 4:107840414-107840436 GTGAAAATGTATATGGAGGAGGG - Intronic
978607805 4:110501427-110501449 TTGAAAGTAGAGAGGGAGGAGGG - Intronic
979105742 4:116684580-116684602 ATGAAGGTGTAGATGCAGGAGGG + Intergenic
980492412 4:133545053-133545075 TTGCAAGTCTAGGTGAAAGATGG + Intergenic
981765348 4:148242288-148242310 TTGCTGGTGGGGATGGAGGAAGG + Intronic
982802000 4:159717365-159717387 TAGCAATTTGAGATGGAGGATGG - Intergenic
983711646 4:170724081-170724103 TTGTATGTGTACATGTAGGAGGG + Intergenic
985337389 4:188911432-188911454 ATGCAGGTGCAGATGGAGGTTGG - Intergenic
986822427 5:11482317-11482339 TTGTATGTGTAGGTGGTGGAGGG - Intronic
988010717 5:25479278-25479300 ATGCTAGTGTAGATGGAATATGG + Intergenic
988806981 5:34749552-34749574 TTGCTATTCTAGATGGAGGCAGG + Intronic
988879778 5:35488740-35488762 ATGCAAGAGTAGATGGAGCATGG - Intergenic
988988116 5:36640823-36640845 GTGGCAGTGTAGATGAAGGAGGG - Intronic
989725806 5:44585053-44585075 TTGCATTTGAAGATGGTGGATGG + Intergenic
991145594 5:63299364-63299386 TGACAAGTGGAGGTGGAGGAGGG - Intergenic
991598748 5:68331520-68331542 TTGCCTTTGAAGATGGAGGAAGG + Intergenic
992483838 5:77176923-77176945 TTCCAAGTCTAGCTGGAGGTGGG - Intergenic
993862518 5:93153492-93153514 TTCCATGGGTAGAGGGAGGAGGG - Intergenic
994816270 5:104591779-104591801 TAGCAGGTGGAGAAGGAGGAGGG - Intergenic
995245300 5:109928621-109928643 TAGAAAGTGGAGATGGGGGATGG + Intergenic
995589596 5:113685656-113685678 TTGCCAGTGTACATGGAGGGGGG - Intergenic
996503024 5:124237887-124237909 TTGCAGGGGTACATGGAGGAGGG - Intergenic
997128929 5:131257206-131257228 TTGGAAGTGAAGTTGGACGATGG - Intronic
997214647 5:132100761-132100783 ATGCAGGTGCAGCTGGAGGAAGG - Intergenic
997405760 5:133645366-133645388 GGGCAAGTGTTGATGCAGGATGG + Intergenic
998111532 5:139506405-139506427 TTGCCAGTGGACATGGATGAGGG - Intergenic
998989085 5:147795252-147795274 CTGAAGGTGTGGATGGAGGAGGG - Intergenic
999225615 5:150021110-150021132 TAGCAAGTCAAGATGGGGGAAGG - Intronic
999371982 5:151061335-151061357 GGGAAAATGTAGATGGAGGAGGG - Intronic
1000281543 5:159786633-159786655 TTGCAGTTGTAGATGTGGGAGGG + Intergenic
1004384358 6:15159631-15159653 TTGCCTGGGTAGATGGAGGATGG - Intergenic
1005430912 6:25756016-25756038 GTACAAGTGTTGATGGTGGATGG - Intronic
1007790297 6:44304769-44304791 TTGCAACTGTATACAGAGGACGG - Exonic
1009762178 6:68021735-68021757 TTGAAAGTATAGTTGGAGGAAGG - Intergenic
1010128956 6:72469060-72469082 TTGGAAGTGGGGATGCAGGAAGG + Intergenic
1012708631 6:102568211-102568233 TTACAAGAGTAGATTGAGGAAGG + Intergenic
1015312950 6:131784720-131784742 CTCCAAGTGTAGATGGAGGTTGG - Intergenic
1015374905 6:132499457-132499479 TTGCAAGTGTAGATGGAGGAAGG - Intronic
1015557854 6:134481722-134481744 TTGCAAGGGTGAAGGGAGGATGG + Intergenic
1016073294 6:139766781-139766803 TTGCAAGTGTCTATTGAAGAGGG + Intergenic
1016700976 6:147053861-147053883 TTAGAAGAGTAGATGGAGCATGG - Intergenic
1017391737 6:153947208-153947230 TTCCAAGGAGAGATGGAGGAGGG + Intergenic
1018041221 6:159923918-159923940 TTGCTATTGTAGATGGTGGGGGG + Intergenic
1019142228 6:169956144-169956166 TGGCAAGTGTTGATGCAGGATGG + Intergenic
1020595868 7:10206550-10206572 TTGTAAGTGTAAATTTAGGATGG - Intergenic
1020680618 7:11232473-11232495 TTGAAAGAGAAGGTGGAGGAGGG + Intergenic
1021364439 7:19759220-19759242 TTGCAAGAGTAGCTGAAGTAAGG - Intronic
1022094910 7:27133235-27133257 TTGCAAAGGGAGATTGAGGAAGG - Intronic
1022179314 7:27903086-27903108 ATGCTAGTGTAGATGGCAGAAGG - Intronic
1022488353 7:30797758-30797780 ATTCAAGTGTGGAAGGAGGAAGG + Intronic
1022513508 7:30959610-30959632 TTGTAAGAGAAGATGAAGGATGG + Intronic
1022982317 7:35615759-35615781 TTGTATGTGAGGATGGAGGAGGG - Intergenic
1027595673 7:80170763-80170785 TTGGAAGTGGAGCTGGTGGAAGG - Intronic
1028033655 7:85950646-85950668 TTTCCAGGGTAGATGGGGGAGGG + Intergenic
1029859916 7:103559539-103559561 ATGCAAGTGTATAAGGAAGAGGG - Intronic
1030805402 7:113912140-113912162 GTACATGTGTATATGGAGGATGG - Intronic
1030983670 7:116214791-116214813 TTAGAACTGTAGATGGAGTATGG - Intronic
1033036323 7:137879330-137879352 GTGGAAGTGTGGAGGGAGGAGGG + Exonic
1033234172 7:139625105-139625127 TTGGAAGGATAGATGGACGAGGG - Intronic
1033337134 7:140463444-140463466 TTGCAGGTATAGCTAGAGGAAGG - Intronic
1033965190 7:146966641-146966663 GAGCAAGTATATATGGAGGATGG + Intronic
1034775016 7:153817955-153817977 TTTCAAGTGGAGGTGGGGGAGGG + Intergenic
1034969625 7:155410943-155410965 CTGCCTGTGAAGATGGAGGAAGG - Intergenic
1035185831 7:157125373-157125395 ATGCAAGTGTGGAGGGAGGGAGG - Intergenic
1035288608 7:157822611-157822633 ATGAAAGGGTAGATGGATGATGG - Intronic
1035929409 8:3764165-3764187 GTGCAAATCTAAATGGAGGAGGG - Intronic
1037172849 8:15914124-15914146 CTGGAAGTGAAGAGGGAGGAGGG + Intergenic
1037447064 8:18975988-18976010 TTAGAAGTGTAAATGGTGGATGG - Intronic
1038497641 8:28015092-28015114 TTTTAAGTGTGGGTGGAGGAGGG - Intergenic
1040580930 8:48697980-48698002 GTGCAGGTGAAGATGGAAGACGG - Intergenic
1041674685 8:60526354-60526376 TTGGTTGTGAAGATGGAGGAAGG - Intronic
1043147528 8:76676819-76676841 ATGCGAGTGTAGCTGGAGGAGGG + Intergenic
1046363581 8:113194959-113194981 GGGCAATTGAAGATGGAGGAAGG - Intronic
1047946465 8:129885882-129885904 CTGCAAGTGAGAATGGAGGATGG - Intronic
1049371973 8:142272301-142272323 GTGGATGGGTAGATGGAGGAAGG - Intronic
1050628946 9:7538555-7538577 TTGAGAGTGAAGATGGAGGCAGG + Intergenic
1051508803 9:17854743-17854765 TTGCTAGGGTAGGTGGAAGAAGG - Intergenic
1054450842 9:65402903-65402925 TTTCCAGTGGAGAAGGAGGAGGG - Intergenic
1054850739 9:69843986-69844008 TTAAAAATGTAGATGGAAGAAGG - Intronic
1055280918 9:74673698-74673720 TTCCAAGTAAAGATGGAGAAAGG - Intronic
1055411488 9:76034572-76034594 CTCCAAGTGTAGATGGTGGAAGG - Intronic
1057274912 9:93671047-93671069 GTGCAGGTGTAGATGCAGGTGGG + Intronic
1059465492 9:114466622-114466644 CTGCAAGTGTAGTGGGGGGAAGG + Intronic
1059476503 9:114551849-114551871 TTGTAGGTGAAGATGGAGAATGG - Intergenic
1059564430 9:115369270-115369292 TTGGAAGTGGTGATGGAGAATGG - Intronic
1059635038 9:116162052-116162074 TTGCAAGTGTACAGAGAGGAGGG - Intronic
1185774417 X:2791023-2791045 TTTCAAGTTATGATGGAGGAAGG + Intronic
1186026943 X:5323703-5323725 TTGCAAAGGTATATGGAGAAGGG + Intergenic
1186698622 X:12065526-12065548 ATGGAAGTGGAGAGGGAGGAAGG - Intergenic
1188297149 X:28463356-28463378 TTGGAAGTCTAGAGGGCGGAAGG + Intergenic
1188563209 X:31493782-31493804 TGGCAAGAGTAGATGCAGAAAGG + Intronic
1189100971 X:38189310-38189332 TGCCAGGTGTAGAAGGAGGAGGG - Intronic
1190072738 X:47292456-47292478 TTACAGGTGGAGAAGGAGGAGGG + Intergenic
1190813337 X:53906320-53906342 CTGCAAGTGGAGATGAAAGAAGG + Intergenic
1192819157 X:74625449-74625471 TTGAAAGTCTAGTTGGGGGAGGG - Intergenic
1192886480 X:75340153-75340175 TTGCTAGTGTAGATGTAGCGTGG + Intergenic
1193640217 X:84003226-84003248 GTGCAAGTATAGGTGGAGGAGGG - Intergenic
1194128446 X:90049113-90049135 ATGTAGGTGTAGATGGAAGAGGG - Intergenic
1195276920 X:103290335-103290357 TTTCAAGTGTTGTTGGAGGTGGG - Intergenic
1195876011 X:109541324-109541346 TTTCCAGTGGAGATGGAGCAAGG + Intronic
1197865334 X:131011037-131011059 TTGAAAGGGTAGATGGGGGGAGG + Intergenic
1198699718 X:139383481-139383503 TTGTATGTGTAGATGGGGGTGGG + Intergenic
1199069790 X:143462687-143462709 TCGCACGTGTGGTTGGAGGATGG - Intergenic
1199981434 X:152922713-152922735 TTGCCAGTGCGGATGGAGGCAGG + Exonic
1201225074 Y:11810788-11810810 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1201305906 Y:12550384-12550406 ATGCATGTGTAGATGGATGGAGG + Intergenic
1202088496 Y:21163704-21163726 GAGCAGGTGCAGATGGAGGAAGG + Intergenic