ID: 1015375727

View in Genome Browser
Species Human (GRCh38)
Location 6:132508180-132508202
Sequence TGCTTGCATGGTTTTGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 999
Summary {0: 1, 1: 0, 2: 5, 3: 71, 4: 922}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015375727_1015375734 25 Left 1015375727 6:132508180-132508202 CCTGTCTCAAAACCATGCAAGCA 0: 1
1: 0
2: 5
3: 71
4: 922
Right 1015375734 6:132508228-132508250 TAAAGAGTTCCATCAAGTCAAGG 0: 1
1: 0
2: 0
3: 13
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015375727 Original CRISPR TGCTTGCATGGTTTTGAGAC AGG (reversed) Intronic
900434349 1:2621277-2621299 TGTTTGTTTGTTTTTGAGACAGG - Intronic
900614514 1:3559018-3559040 TGTTTGTTTTGTTTTGAGACAGG - Intronic
901350301 1:8589432-8589454 TGTTTGTTTGTTTTTGAGACAGG - Intronic
901369908 1:8788090-8788112 TGCTTTTATTTTTTTGAGACAGG - Intronic
901419571 1:9141754-9141776 TGTTTGCTTTGTTTTGAGACAGG + Intergenic
901579233 1:10226963-10226985 TGTTTGTTTGTTTTTGAGACAGG - Intronic
901647386 1:10723943-10723965 TGCTGGCATGGTTTGGACTCGGG - Intronic
901737978 1:11324364-11324386 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
902140747 1:14351551-14351573 TGTTTGTTTGTTTTTGAGACTGG - Intergenic
902396720 1:16135874-16135896 TTCTTTCATTTTTTTGAGACAGG + Intronic
902724396 1:18325286-18325308 TGCTTGGATGTTTTTGACACAGG - Intronic
903056322 1:20638634-20638656 TGTTTGTTTTGTTTTGAGACAGG - Intronic
903206555 1:21786683-21786705 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
903387556 1:22937474-22937496 TGTTTTTATGTTTTTGAGACAGG - Intergenic
903444905 1:23416495-23416517 TGTTTGTTTGTTTTTGAGACAGG + Intronic
903602001 1:24549307-24549329 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
903767825 1:25746297-25746319 TGTTTGTTTGTTTTTGAGACAGG - Intronic
904099674 1:28014055-28014077 TGTTTGTTTTGTTTTGAGACAGG - Intronic
904193500 1:28766108-28766130 TGTTTTCATTGTTTTGAGATAGG + Intronic
904209674 1:28878602-28878624 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
904516787 1:31061921-31061943 TGTTTGTTTGTTTTTGAGACAGG - Intronic
904518907 1:31078634-31078656 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
904520119 1:31088598-31088620 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
904713601 1:32449940-32449962 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
904714408 1:32456462-32456484 TGGTTTCATGGTTATGATACAGG + Intergenic
905007810 1:34725071-34725093 TGTTTACATGGTTTTGAATCCGG - Intronic
905616089 1:39400509-39400531 TGTTTGTTTGTTTTTGAGACAGG + Intronic
905628062 1:39501529-39501551 TGTTTGTTTTGTTTTGAGACAGG + Intronic
905809935 1:40904916-40904938 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
906223472 1:44102037-44102059 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
906335184 1:44923807-44923829 TTCTTTCATTTTTTTGAGACAGG + Intronic
906459354 1:46025509-46025531 TGCTGGCATGGGTGGGAGACAGG - Intronic
906721098 1:48005379-48005401 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
907058798 1:51399541-51399563 TGTTTGTTTGTTTTTGAGACAGG - Intronic
907207712 1:52788722-52788744 TGTTTGTTTGTTTTTGAGACAGG - Intronic
907393868 1:54176524-54176546 TGTTTGTTTTGTTTTGAGACAGG - Intronic
907559059 1:55371641-55371663 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
908175201 1:61548699-61548721 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
908353231 1:63306807-63306829 TCATTTCATGGTTTTGAGTCTGG - Intergenic
908463195 1:64366380-64366402 TGCTTGCTTGCCTTTGAGACGGG + Intergenic
909319114 1:74259764-74259786 TGTTTGTTTGTTTTTGAGACAGG - Intronic
909342507 1:74547637-74547659 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
910344403 1:86219303-86219325 TGCTTAAATGGCTCTGAGACAGG - Intergenic
910530147 1:88226614-88226636 TGATTGCCTGGCTTGGAGACAGG - Intergenic
910544142 1:88395260-88395282 TTCTTGAATGGTTTTCAAACTGG - Intergenic
910658439 1:89643095-89643117 TGTTTGTTTGTTTTTGAGACAGG + Intronic
910871633 1:91838981-91839003 TGTTTGTTTGTTTTTGAGACAGG + Intronic
910966757 1:92815705-92815727 TGTTTGTTTGTTTTTGAGACCGG + Intergenic
911420572 1:97635823-97635845 TGCTTCTTTGTTTTTGAGACAGG + Intronic
911633787 1:100211775-100211797 TTCTTGTTTGTTTTTGAGACAGG + Intronic
912663811 1:111561127-111561149 TGTTTGTTTGTTTTTGAGACAGG + Intronic
912921677 1:113874294-113874316 TGTTTGTTTTGTTTTGAGACAGG + Intergenic
913153848 1:116074735-116074757 TGTTTGGTTTGTTTTGAGACAGG + Intergenic
913487964 1:119351129-119351151 TGCTATCCTTGTTTTGAGACAGG - Intergenic
913684937 1:121222619-121222641 TGTTAGCTTGTTTTTGAGACAGG - Intronic
914036779 1:144010242-144010264 TGTTAGCTTGTTTTTGAGACAGG - Intergenic
914152675 1:145057705-145057727 TGTTAGCTTGTTTTTGAGACAGG + Intronic
914214594 1:145613790-145613812 TGTTTGTTTTGTTTTGAGACAGG + Intronic
914240910 1:145852250-145852272 TGTTTGTTTGTTTTTGAGACAGG - Intronic
914466536 1:147934180-147934202 TGTTTGTTTTGTTTTGAGACAGG + Intronic
914741273 1:150467377-150467399 TGTTTGTTTGTTTTTGAGACGGG + Intronic
915257707 1:154647555-154647577 TGTTTGCTTGTTTTTGACACAGG + Intergenic
915387691 1:155511529-155511551 TGTTTGTTTGTTTTTGAGACAGG + Intronic
915424517 1:155813424-155813446 TGTTTGTTTGTTTTTGAGACAGG - Intronic
916144038 1:161724244-161724266 TGCTTGAAGGGTTTTAAAACAGG + Intronic
917082233 1:171268090-171268112 TGTTTGTTTGTTTTTGAGACAGG + Intronic
917338345 1:173948608-173948630 TGTTTGTTTGTTTTTGAGACAGG + Intronic
917870688 1:179239337-179239359 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
918029523 1:180791275-180791297 TGTTTGTTTGTTTTTGAGACAGG + Intronic
918432710 1:184478667-184478689 TGCTTGCCTGATCTTGAGATTGG + Intronic
918503966 1:185230751-185230773 TGTTTGTTTTGTTTTGAGACAGG + Intronic
918555715 1:185797307-185797329 TGGTTGGTTGTTTTTGAGACTGG + Intronic
919035290 1:192299817-192299839 TGTTTGTTTTGTTTTGAGACAGG + Intergenic
919139758 1:193556166-193556188 TGCTTGCATGCTACTGTGACAGG - Intergenic
919384899 1:196909001-196909023 CACTTGCATGGTTTGGAGCCCGG - Intronic
919449158 1:197749851-197749873 TGTTTGTTTGTTTTTGAGACAGG + Intronic
919681854 1:200443489-200443511 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
919886347 1:201937758-201937780 TGTTTGTTTGTTTTTGAGACAGG - Intronic
920117974 1:203634668-203634690 TGTTTGTTTGTTTTTGAGACCGG + Intronic
920289436 1:204907985-204908007 TGTTTGTTTGTTTTTGAGACAGG + Intronic
920472254 1:206241176-206241198 TGTTAGCTTGTTTTTGAGACAGG - Intronic
920634844 1:207691733-207691755 TACTTGCGTTGTTTGGAGACTGG - Intronic
920681970 1:208080127-208080149 AAATTGCATGGGTTTGAGACGGG + Intronic
920724640 1:208422737-208422759 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
920822679 1:209396114-209396136 TGTTTGCTTGGTTTTGACCCAGG - Intergenic
920940183 1:210474854-210474876 TGTTTGTTTGTTTTTGAGACAGG + Intronic
921030938 1:211334650-211334672 TGTTTGTTTTGTTTTGAGACGGG - Intronic
921036531 1:211384286-211384308 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
921119298 1:212123111-212123133 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
921831808 1:219735416-219735438 TGTTTGTTTGTTTTTGAGACAGG - Intronic
921896627 1:220408101-220408123 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
922017010 1:221658360-221658382 TTCTTTCTTTGTTTTGAGACAGG - Intergenic
922166682 1:223121522-223121544 TGATTGTTTTGTTTTGAGACAGG + Intronic
922310933 1:224390130-224390152 TGCTTTTATTTTTTTGAGACAGG + Intronic
922439082 1:225637211-225637233 TTGTTGCTTGGTTGTGAGACAGG + Intronic
922965417 1:229686955-229686977 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
923354844 1:233144174-233144196 TTTTTTCATGTTTTTGAGACAGG - Intronic
923721706 1:236472532-236472554 TGTTTGCTTGTTTTTGAGATGGG + Intronic
923813525 1:237347305-237347327 TGTTTGTTTGTTTTTGAGACGGG - Intronic
923831674 1:237565269-237565291 TGTTTGTTTTGTTTTGAGACAGG + Intronic
924178990 1:241422768-241422790 TTGTTGTTTGGTTTTGAGACAGG + Intergenic
924265560 1:242277975-242277997 TGTTTGTTTGTTTTTGAGACAGG - Intronic
924304531 1:242673422-242673444 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
924742054 1:246800129-246800151 TACTTACATTTTTTTGAGACAGG + Intergenic
1063116220 10:3073841-3073863 TGTTTGTTTGTTTTTGAGACGGG + Intronic
1063148353 10:3316799-3316821 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1063407253 10:5808317-5808339 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1063448853 10:6137647-6137669 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1063478186 10:6347066-6347088 TGTTTGTCTTGTTTTGAGACAGG + Intergenic
1063683624 10:8214337-8214359 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1064153108 10:12881599-12881621 TGTTTGTTTTGTTTTGAGACAGG - Intergenic
1064201423 10:13288138-13288160 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1064463466 10:15556848-15556870 TGTTTGCTTGCTTTTGAGAAGGG + Intronic
1064480623 10:15736909-15736931 TATTTGCATGTATTTGAGACAGG - Intergenic
1064830441 10:19459403-19459425 TGCTTGAATTGATTTGAGACAGG + Intronic
1065113866 10:22465245-22465267 TGCTTCCACAGTTTTGAGCCAGG - Intergenic
1065210207 10:23395654-23395676 TGTTTGTCTGTTTTTGAGACAGG - Intergenic
1065301622 10:24327494-24327516 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1065386692 10:25141049-25141071 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1065477318 10:26154184-26154206 TGTTTGTTTGTTTTTGAGACTGG + Intronic
1065673523 10:28148435-28148457 TTCATGCAAGGTTTTAAGACGGG - Intronic
1065721477 10:28632120-28632142 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1065911045 10:30305706-30305728 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1065936675 10:30526513-30526535 TGCTTTCTTTGTTTTGATACAGG + Intergenic
1066212403 10:33252600-33252622 TGTTTGCATGGTAATGAAACAGG - Intronic
1066415586 10:35218332-35218354 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1066719265 10:38320500-38320522 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1067095548 10:43297152-43297174 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1067480333 10:46592573-46592595 TGTTTGCTTGTTTTTGAGACAGG + Intronic
1067614404 10:47749226-47749248 TGTTTGCTTGTTTTTGAGACAGG - Intergenic
1068378662 10:56217357-56217379 TGCTTGCATGCTACTGTGACAGG - Intergenic
1068526244 10:58133628-58133650 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1068529048 10:58164218-58164240 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1068529329 10:58167014-58167036 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1069005796 10:63316164-63316186 TGCGTGTTTGCTTTTGAGACAGG - Intronic
1069948750 10:72005117-72005139 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1070052348 10:72901617-72901639 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1070247995 10:74749758-74749780 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1070316955 10:75322832-75322854 TGGTTAGTTGGTTTTGAGACAGG - Intergenic
1070816543 10:79328164-79328186 TTTTTGTTTGGTTTTGAGACAGG - Intergenic
1070847044 10:79531565-79531587 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1071488441 10:86119327-86119349 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1071629810 10:87209202-87209224 TGTTTGCTTGTTTTTGAGACAGG - Intergenic
1071675840 10:87655370-87655392 TGTTTGTTTTGTTTTGAGACAGG + Intergenic
1072108797 10:92298575-92298597 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1072984326 10:100126682-100126704 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1073223504 10:101896222-101896244 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1073258001 10:102167366-102167388 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1073304801 10:102494627-102494649 TGGTTGGTTGGTTTTGAGACAGG - Intronic
1073545620 10:104346351-104346373 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1073932277 10:108589339-108589361 TGTTTGCTTGTTTTTGAGACAGG - Intergenic
1074375276 10:112935448-112935470 TGTTTGTTTGTTTTTGAGACGGG - Intergenic
1074816743 10:117147784-117147806 TGCTTGCATTGTTTTCACATGGG - Intergenic
1075051475 10:119185556-119185578 TGCTATCATGGTTTAGAGAAAGG + Intergenic
1075051575 10:119186266-119186288 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1075377530 10:121990791-121990813 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1076913961 10:133410049-133410071 TTTTTGCTTGTTTTTGAGACAGG + Intronic
1077518458 11:3016620-3016642 TTTTTGTCTGGTTTTGAGACAGG + Intronic
1078368368 11:10724983-10725005 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1078628579 11:12981139-12981161 TGCTTGTTTTGTTTTGAGACAGG + Intergenic
1079041245 11:17062353-17062375 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1079777502 11:24550935-24550957 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1080277504 11:30519261-30519283 TGTTTGTTTGCTTTTGAGACAGG - Intronic
1080376234 11:31716017-31716039 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1080410803 11:32023155-32023177 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1080521242 11:33069598-33069620 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1080542039 11:33276381-33276403 TGTTTTCATATTTTTGAGACAGG + Intronic
1080548685 11:33349452-33349474 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1080797431 11:35578095-35578117 TGTTTGTTTTGTTTTGAGACAGG - Intergenic
1082649566 11:55772248-55772270 TGTTTGCTTGTTTTTGAGACAGG - Intergenic
1082825914 11:57578729-57578751 TGTTTGTATGTTTTTGAGACAGG - Intergenic
1083255527 11:61493213-61493235 TGGTTGGTTGTTTTTGAGACAGG + Intergenic
1084295195 11:68208841-68208863 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1084511163 11:69605047-69605069 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1084759781 11:71262656-71262678 TTGTTTCATTGTTTTGAGACAGG - Intergenic
1085227011 11:74930807-74930829 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1085635372 11:78155169-78155191 TGATTGTCTGTTTTTGAGACAGG - Intergenic
1085921948 11:80967926-80967948 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1086005168 11:82028320-82028342 GGCTTGTCTGGTTTTAAGACAGG - Intergenic
1086101979 11:83110206-83110228 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1087178111 11:95114134-95114156 TGATTGATTGATTTTGAGACAGG + Intronic
1087778532 11:102278795-102278817 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1088247451 11:107832799-107832821 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1088479405 11:110280820-110280842 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1088870023 11:113882854-113882876 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1089414195 11:118273209-118273231 TTTTTGCTTGCTTTTGAGACAGG - Intergenic
1089481672 11:118810604-118810626 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1089516228 11:119033538-119033560 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1089858053 11:121564580-121564602 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1090120243 11:124019375-124019397 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1091161584 11:133426605-133426627 TCCTTGCATGGTTTTCAGGTTGG - Intronic
1091539595 12:1447508-1447530 TGTTTGTTTGTTTTTGAGACGGG - Intronic
1091788167 12:3255581-3255603 TGCTTCCATGGAATTGACACAGG - Intronic
1093564723 12:20588926-20588948 TGTTTGTTTGTTTTTGAGACGGG + Intronic
1093761843 12:22919892-22919914 TGCCTCTATGGTTCTGAGACAGG + Intergenic
1093929135 12:24937519-24937541 TGTTTGCTTGTTTTTGAGATAGG + Intronic
1093954197 12:25197466-25197488 TGTTTGTTTTGTTTTGAGACAGG + Intronic
1094172498 12:27508505-27508527 TGCTTGCTTGTTTTAGAGACAGG - Intergenic
1094574817 12:31675412-31675434 TTCTTGTTTGTTTTTGAGACAGG - Intronic
1095834781 12:46625647-46625669 TTCTTGTTTTGTTTTGAGACAGG - Intergenic
1096276370 12:50211637-50211659 TGTTTGCTTGCTTTTGAGACAGG - Intronic
1096297375 12:50395098-50395120 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1096346907 12:50856689-50856711 TACTTGTTTGTTTTTGAGACAGG + Intronic
1096357595 12:50954718-50954740 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1096641095 12:52995030-52995052 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1096844232 12:54396687-54396709 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1097826702 12:64181564-64181586 TGCGTGGATGGTTCTGAGTCAGG + Intergenic
1098174742 12:67779021-67779043 TGTTTGTTTTGTTTTGAGACAGG - Intergenic
1098289281 12:68941377-68941399 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1098538366 12:71621742-71621764 AGATTTCAGGGTTTTGAGACTGG - Intronic
1098787383 12:74776641-74776663 TGCTTGCTTGCTTTTGAGACAGG - Intergenic
1098894201 12:76038928-76038950 TGCATGCATGGTTCTGAGAAAGG + Exonic
1099466612 12:82995796-82995818 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1100173547 12:92004569-92004591 TGCTTGCTTGCTTTAGAGACAGG + Intronic
1100181686 12:92093075-92093097 GGTTTGCTTGTTTTTGAGACAGG + Intronic
1100364564 12:93907809-93907831 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1100471934 12:94901428-94901450 TGTTTTCTTGTTTTTGAGACAGG - Intronic
1100634232 12:96419769-96419791 TGTTTGTTTTGTTTTGAGACAGG - Intergenic
1100899579 12:99222608-99222630 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1101327397 12:103728155-103728177 TGATTGTTTGTTTTTGAGACAGG + Intronic
1101620340 12:106380741-106380763 TTTTTGTTTGGTTTTGAGACTGG - Intronic
1101666515 12:106821117-106821139 TGCTGGCATCTTTGTGAGACAGG + Intronic
1101766131 12:107701130-107701152 TGCTTACTTTTTTTTGAGACAGG + Intronic
1101782791 12:107850401-107850423 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1101881355 12:108628255-108628277 TTCTTGTTTTGTTTTGAGACAGG - Intronic
1102021692 12:109687694-109687716 TGTTTGTTTTGTTTTGAGACAGG + Intergenic
1102501449 12:113355707-113355729 TGTTTTCTTGGGTTTGAGACAGG - Intronic
1102651644 12:114446763-114446785 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1103306417 12:119968266-119968288 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1103365084 12:120376303-120376325 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1103857109 12:123979682-123979704 TGTTTGTTTTGTTTTGAGACAGG + Intronic
1104229047 12:126865787-126865809 TGTTTGTTTGGTTTTGAGACAGG - Intergenic
1105295287 13:19083780-19083802 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1105561636 13:21497700-21497722 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1106326531 13:28696099-28696121 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1107682989 13:42870031-42870053 GGCTTGCCTGGTTTTAGGACAGG + Intergenic
1107772483 13:43803888-43803910 TGTTTGTTTTGTTTTGAGACAGG - Intergenic
1107847105 13:44526094-44526116 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1108216786 13:48193392-48193414 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1108377367 13:49825900-49825922 TGATTGATTGATTTTGAGACAGG - Intergenic
1109279162 13:60336336-60336358 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1109588787 13:64447423-64447445 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1109919665 13:69039456-69039478 TGCCTGTTTGTTTTTGAGACAGG - Intergenic
1110004140 13:70245061-70245083 TGTTTGGTTGGTTTTTAGACAGG + Intergenic
1110403911 13:75127298-75127320 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1111713603 13:91849193-91849215 AAATTGCATGGTTTTGAAACAGG - Intronic
1111807144 13:93051767-93051789 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1112473929 13:99713991-99714013 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1112525589 13:100143758-100143780 TGTTTGTTTGGTTTTGAGTCAGG + Intronic
1112596706 13:100814357-100814379 TGTTTGTTTTGTTTTGAGACAGG + Intergenic
1113471061 13:110546741-110546763 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1114322989 14:21562491-21562513 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1115101695 14:29708855-29708877 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1115710322 14:36043060-36043082 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1116454279 14:45100222-45100244 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1116791747 14:49346707-49346729 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1116808205 14:49513857-49513879 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1116830859 14:49718286-49718308 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1117130351 14:52680052-52680074 TTTTTGCTTGTTTTTGAGACAGG - Intronic
1117352970 14:54899450-54899472 TATTTTCATGTTTTTGAGACAGG - Intronic
1117366459 14:55034123-55034145 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1117374617 14:55109192-55109214 TGTTTGTTTTGTTTTGAGACAGG + Intergenic
1117675771 14:58153170-58153192 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1117904162 14:60566874-60566896 TGCTTGCATGGTTTTAAGGTGGG + Intergenic
1117961178 14:61163563-61163585 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1117990424 14:61427590-61427612 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1118766391 14:68912381-68912403 TTTTTGCTTGTTTTTGAGACAGG + Intronic
1118896682 14:69951089-69951111 TGTCTGCATGGTTTTGACATGGG + Intronic
1119123474 14:72101170-72101192 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1119237815 14:73034369-73034391 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1119791944 14:77358911-77358933 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1120437909 14:84502829-84502851 GGCTTGCCTGGTTTTAGGACAGG + Intergenic
1120837037 14:89049190-89049212 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1121497597 14:94405374-94405396 TGCTTGTTTGTTTTTGAGACAGG + Intergenic
1121761510 14:96448948-96448970 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1122729915 14:103788669-103788691 TGCTTTGATTGTTTTGAGACAGG - Intronic
1122743368 14:103884509-103884531 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1124132936 15:27006205-27006227 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1124421340 15:29525722-29525744 GGCTGGCATGGGTTTGAGAGGGG + Intronic
1124578104 15:30927201-30927223 TGTTTGTTTTGTTTTGAGACAGG - Intronic
1124916475 15:33979477-33979499 TGCTTGCTTGTTTTTGAGACAGG - Intronic
1125045920 15:35241870-35241892 GGCTTGTCTGGTTTTAAGACAGG - Intronic
1125508472 15:40280844-40280866 TGCTTTCATTGTCTTGAGACAGG + Intronic
1126004549 15:44243737-44243759 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1126146496 15:45478450-45478472 TGCTTGCAAGTTTTTGTGACTGG - Intergenic
1126797660 15:52273315-52273337 TGTTTGTCTGTTTTTGAGACAGG - Intronic
1127153170 15:56099535-56099557 TCCTGCCAGGGTTTTGAGACAGG + Intronic
1127223122 15:56901119-56901141 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1127921260 15:63496125-63496147 AGCTTGCATGGTTTGCACACTGG + Intergenic
1128091332 15:64920974-64920996 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1128259180 15:66220541-66220563 TTTTTGCTTTGTTTTGAGACAGG + Intronic
1128267923 15:66283223-66283245 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1128286342 15:66440095-66440117 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1128654478 15:69450432-69450454 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1128822640 15:70673865-70673887 TGGTTGGTTGGTTTTGAGACAGG + Intronic
1128827717 15:70735681-70735703 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1128844732 15:70881221-70881243 TGTTTGCTTGTTTTAGAGACAGG - Intronic
1128894495 15:71359828-71359850 TGTTTGCTTGTTTTTGAGACAGG - Intronic
1130003849 15:80074507-80074529 TTCATACATGTTTTTGAGACAGG - Intronic
1130065345 15:80598213-80598235 TGTTTGTTTTGTTTTGAGACAGG - Intergenic
1130882005 15:88063287-88063309 TGCTTGCATGAGTTGGTGACTGG - Intronic
1131003609 15:88957908-88957930 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1131196244 15:90357495-90357517 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1131254627 15:90853963-90853985 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1131301769 15:91206041-91206063 TGGTTGTTTGTTTTTGAGACAGG + Intronic
1132079148 15:98850380-98850402 TGCTTCCATGGTCTGGAGACTGG + Intronic
1132346045 15:101109565-101109587 TGTTTGCTTGTTTTTGAGACAGG + Intergenic
1132920547 16:2388042-2388064 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1133023782 16:2978810-2978832 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1133061796 16:3179771-3179793 TGCTTGCAGAGTTGTGAGGCTGG - Intergenic
1133079939 16:3310619-3310641 TGTTTGTTTTGTTTTGAGACGGG - Intronic
1133268086 16:4596674-4596696 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1133359492 16:5162981-5163003 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1133967547 16:10542390-10542412 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1134218741 16:12336938-12336960 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1134642545 16:15840724-15840746 TGGTTGGATGGTTTTGAGACAGG - Intronic
1134788839 16:16969953-16969975 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1135082834 16:19451126-19451148 TGTTTGTTTGATTTTGAGACAGG - Intronic
1135252379 16:20911926-20911948 TGCTTGTTTGTTTTTGAGATGGG + Intronic
1135260185 16:20974025-20974047 TGTTTGTTTGTTTTTGAGACTGG + Intronic
1135377692 16:21963473-21963495 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1135824357 16:25713520-25713542 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1135982154 16:27156273-27156295 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1136094224 16:27943058-27943080 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1136102715 16:28007516-28007538 TGGTTGGTTGGTTTTGAGACAGG + Intronic
1136788618 16:32950918-32950940 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1136881194 16:33903016-33903038 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1137302501 16:47165838-47165860 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1137369243 16:47889372-47889394 TGCTTGTTTGTTTTTAAGACAGG - Intergenic
1137544748 16:49394871-49394893 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1138150519 16:54652374-54652396 TGGGTGCATGGTTTTAAAACTGG + Intergenic
1138701681 16:58869706-58869728 TGCTTGGATAGTTTTGAGCATGG + Intergenic
1139611972 16:68065623-68065645 TGTTTGTTTTGTTTTGAGACAGG - Intronic
1139704493 16:68731830-68731852 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1140237888 16:73175020-73175042 TGGTTGGTTGGTTTTGAGAGGGG - Intergenic
1140415354 16:74770381-74770403 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1140463146 16:75157799-75157821 TGGTTGGTTTGTTTTGAGACCGG + Intronic
1140485420 16:75289604-75289626 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1140523362 16:75601438-75601460 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1140982837 16:80127153-80127175 AACTTGCTTGGTTTTGGGACTGG + Intergenic
1141004710 16:80341350-80341372 TGCCTGCATGGTTGTGAGTGTGG + Intergenic
1141087051 16:81103297-81103319 TGCTTGCTTGCTTTTGAGAAAGG - Intergenic
1141759174 16:86016069-86016091 TGCTTGCAAGGTCTGGAGCCAGG - Intergenic
1203090814 16_KI270728v1_random:1212408-1212430 TGGTTGTTTGTTTTTGAGACAGG - Intergenic
1142834589 17:2575559-2575581 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1143657294 17:8302956-8302978 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1143724737 17:8837244-8837266 TGCCTCCATGGTTTTGAGCCTGG - Intronic
1144552840 17:16256704-16256726 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1144598596 17:16592826-16592848 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1144694798 17:17295634-17295656 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1146962492 17:36995571-36995593 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1147279072 17:39342874-39342896 TGTTTGTTTGGTTTTGAGACAGG - Intronic
1147850330 17:43437470-43437492 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1148015677 17:44520459-44520481 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1148019578 17:44544514-44544536 TGTTTGTTTTGTTTTGAGACAGG + Intergenic
1148023219 17:44567445-44567467 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1148061600 17:44840534-44840556 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1148172012 17:45529357-45529379 TGGTTGCTTTGTTTTTAGACAGG - Intergenic
1148204318 17:45770226-45770248 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1148277274 17:46316437-46316459 TGGTTGCTTTGTTTTTAGACAGG + Intronic
1148299390 17:46534015-46534037 TGGTTGCTTTGTTTTTAGACAGG + Intronic
1148364006 17:47039207-47039229 TGGTTGCTTTGTTTTTAGACAGG + Intronic
1148613442 17:48980738-48980760 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1148828334 17:50411561-50411583 TTGTTGGTTGGTTTTGAGACAGG + Intergenic
1149908112 17:60545557-60545579 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1150330220 17:64288229-64288251 TGTGTGCCTGGTTCTGAGACGGG - Intergenic
1150403124 17:64875271-64875293 TGGTTGCTTTGTTTTTAGACAGG - Intronic
1150902150 17:69292101-69292123 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1151176389 17:72291919-72291941 TGTTTGCTTGCTTTTGAAACAGG + Intergenic
1151701999 17:75748354-75748376 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1152530077 17:80913456-80913478 TGTTTGTTTTGTTTTGAGACAGG + Intronic
1153138634 18:1946363-1946385 TGCTTGTTTGTTTTTGAGATAGG - Intergenic
1153446305 18:5176432-5176454 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1153604828 18:6822058-6822080 TGTCTGCATGTTTTTGAGTCAGG + Intronic
1153802152 18:8680971-8680993 TGTTTGCTTGCTTTTGAGATGGG + Intergenic
1153901083 18:9617349-9617371 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1155156105 18:23158970-23158992 TGTTTGCTTGTTTTTGAGACAGG + Intronic
1155292080 18:24352294-24352316 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1155363330 18:25025633-25025655 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1155450578 18:25958953-25958975 TGTTTGGGTGGTTTTGAGGCAGG - Intergenic
1155639678 18:27998615-27998637 TGCTTGTTTGTTCTTGAGACAGG + Intronic
1156235496 18:35199479-35199501 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1157265400 18:46215311-46215333 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1157548679 18:48565707-48565729 AGCTTGCATGGTTGTGTGCCAGG - Intronic
1158249768 18:55474778-55474800 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1158391015 18:57044982-57045004 TGCTTGCAGGGTTCTTAGCCAGG - Intergenic
1158570978 18:58596824-58596846 TGTTTGTTTGCTTTTGAGACAGG + Intronic
1158870289 18:61680410-61680432 TGCTTGTTTGTTTTTGAGACAGG + Intergenic
1158870454 18:61682257-61682279 TATTTGCTTGTTTTTGAGACAGG + Intergenic
1160181605 18:76641684-76641706 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1160940151 19:1616760-1616782 TACTTGTTTTGTTTTGAGACAGG - Intronic
1160971631 19:1770429-1770451 TTCTTGTTTTGTTTTGAGACAGG - Intronic
1161377801 19:3949203-3949225 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1161799302 19:6407223-6407245 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1161919513 19:7255581-7255603 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1161931570 19:7344062-7344084 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1161955675 19:7493508-7493530 TTCTTGTTTGTTTTTGAGACAGG + Intronic
1162083050 19:8230843-8230865 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1162131407 19:8528214-8528236 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1162158383 19:8695229-8695251 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1162179169 19:8855569-8855591 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1162353264 19:10164607-10164629 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1162376210 19:10306807-10306829 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1162586832 19:11564919-11564941 TGCTTGATTGATTTTGAGACAGG + Intronic
1163046253 19:14644729-14644751 TGTTTGTTTGTTTTTGAGACGGG + Intronic
1163324985 19:16597724-16597746 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1163488009 19:17600643-17600665 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1163686042 19:18712262-18712284 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1163718532 19:18886547-18886569 TGTTTGTTTTGTTTTGAGACAGG - Intronic
1163735770 19:18979523-18979545 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1163841584 19:19614324-19614346 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1164938466 19:32232813-32232835 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1165698335 19:37918264-37918286 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1165765370 19:38347203-38347225 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1166104942 19:40593246-40593268 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1166138371 19:40791354-40791376 TGCATGGATGGTTTTGAAAAAGG - Intronic
1166162200 19:40962606-40962628 TGTTTGTTTGTTTTTGAGACTGG - Intergenic
1166692122 19:44828695-44828717 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1166875750 19:45896281-45896303 TGCTTGTTTGTTTTTGAGACAGG - Intronic
1166967938 19:46541777-46541799 TTATTGCATTTTTTTGAGACAGG + Intronic
1166971818 19:46573965-46573987 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1167096844 19:47379235-47379257 TGCGTGGATGGTTTGGGGACCGG - Intronic
1167106171 19:47431032-47431054 TGTTTGTTTTGTTTTGAGACAGG + Intronic
1167139370 19:47639007-47639029 TGTTTTAATGTTTTTGAGACAGG + Intronic
1167280584 19:48565766-48565788 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1167317579 19:48774308-48774330 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1167596555 19:50431440-50431462 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1167634688 19:50647659-50647681 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1167694383 19:51006116-51006138 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1167701490 19:51049841-51049863 TGCTTGTGTGTTTTTGAGACAGG - Intergenic
1168135118 19:54345696-54345718 TGTTTGTTTGTTTTTGAGACGGG - Intergenic
1168363107 19:55759692-55759714 TTCTTTAATTGTTTTGAGACAGG + Intronic
1168364059 19:55769692-55769714 TTCTTTAATTGTTTTGAGACAGG + Intronic
1168482245 19:56730712-56730734 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1168697804 19:58415193-58415215 TGTTTGTTTGTTTTTGAGACAGG + Intronic
925649334 2:6072771-6072793 TGCTTCCATGGTTATGAAATTGG - Intergenic
925852135 2:8092140-8092162 TTCTTTCATTCTTTTGAGACAGG - Intergenic
925974869 2:9135053-9135075 TGCTTGCTTTTTTTTGTGACAGG - Intergenic
927067426 2:19487476-19487498 TGTTTGTATGGGTTTCAGACAGG - Intergenic
927348629 2:22078718-22078740 TGCTTGCTTGGTTCTGGGATTGG - Intergenic
927473159 2:23391430-23391452 TGTTTTCTTTGTTTTGAGACGGG + Intronic
927664136 2:25018020-25018042 TGTTTGGTTTGTTTTGAGACAGG - Intergenic
927668689 2:25050953-25050975 TGTTTGCATGGTATTAAGATTGG + Intronic
927763992 2:25786847-25786869 TGTTTGTTTGTTTTTGAGACAGG - Intronic
928264425 2:29799493-29799515 TGTTTGTTTTGTTTTGAGACAGG - Intronic
928608531 2:32967991-32968013 TGTTTGTTTGTTTTTGAGACAGG + Intronic
928962393 2:36941149-36941171 TACTTCCTTTGTTTTGAGACAGG - Intronic
928965566 2:36971698-36971720 TGTTTGCTTGTATTTGAGACAGG + Intronic
928967574 2:36992573-36992595 TGTTTGTTTGTTTTTGAGACAGG - Intronic
929076529 2:38083379-38083401 GGCTTGCTTGGTTTTAGGACAGG + Intronic
929191871 2:39147573-39147595 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
929553961 2:42912507-42912529 TGTTTGTTTGTTTTTGAGACTGG - Intergenic
929644157 2:43610597-43610619 TGCTTGTTTGTTTTAGAGACAGG - Intergenic
929772773 2:44906489-44906511 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
929792256 2:45031910-45031932 TGTTTGTTTTGTTTTGAGACAGG - Intergenic
929850645 2:45586355-45586377 TGCTTGCATGGTATTTAGTATGG - Intronic
930011783 2:46942909-46942931 TGTTTGTTTGTTTTTGAGACAGG + Intronic
930123675 2:47780318-47780340 TGGTTGTTTTGTTTTGAGACAGG - Intronic
930396875 2:50832652-50832674 TGTTTGTTTGTTTTTGAGACGGG - Intronic
930633713 2:53782169-53782191 TGTTTGTTTGTTTTTGAGACAGG - Intronic
930679043 2:54235827-54235849 TGGTTGGTTGGTTTTGAGACAGG - Intronic
930798016 2:55413200-55413222 TGTTTGTTTGTTTTTGAGACAGG - Intronic
931245868 2:60492359-60492381 TGTTTGTTTGTTTTTGAGACAGG - Intronic
931652542 2:64481601-64481623 TGGTTGTGTTGTTTTGAGACAGG + Intergenic
931947578 2:67327562-67327584 AGCTTGCATGTTTTTGAGAGGGG - Intergenic
931965589 2:67529922-67529944 TGCTTGCATGGTTGGGAGATGGG + Intergenic
932326558 2:70866190-70866212 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
932402724 2:71492885-71492907 TGTTTGTTTGTTTTTGAGACAGG + Intronic
932778280 2:74542285-74542307 TGATTCCTTGTTTTTGAGACAGG - Intronic
933192963 2:79357318-79357340 TGTTTGTTTGTTTTTGAGACAGG - Intronic
933265002 2:80172324-80172346 TCATTTCATTGTTTTGAGACAGG + Intronic
933361172 2:81286670-81286692 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
933480155 2:82846553-82846575 TGCTTAAATGGTTTTGAAAAAGG + Intergenic
933712803 2:85340030-85340052 TGTTTGTTTTGTTTTGAGACGGG + Intergenic
934200289 2:89879629-89879651 TGATTACATTGGTTTGAGACAGG + Intergenic
934476444 2:94596703-94596725 AGCTTTCTTGTTTTTGAGACAGG + Intronic
934704340 2:96466175-96466197 TGTTTGTTTGTTTTTGAGACGGG + Intergenic
934881160 2:97980797-97980819 AGATTGTATGGTTTTAAGACTGG - Intronic
935053890 2:99548735-99548757 GGTTTGGTTGGTTTTGAGACCGG - Intronic
935693409 2:105750018-105750040 TGTTTGTTTGCTTTTGAGACAGG - Intronic
936021760 2:109000525-109000547 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
936457399 2:112685858-112685880 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
936665149 2:114586243-114586265 TGCTTGCTTGTTTTTGAGACAGG - Intronic
937459727 2:122075405-122075427 TGTTTGTTTTGTTTTGAGACAGG - Intergenic
937738863 2:125324307-125324329 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
937975436 2:127579589-127579611 TGTTTGTTTGTTTTTGAGACAGG + Intronic
938006803 2:127793733-127793755 TGTTTTCATTTTTTTGAGACAGG - Intronic
938939700 2:136158962-136158984 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
938988899 2:136607826-136607848 TGATTGTTTGTTTTTGAGACAGG - Intergenic
939696804 2:145335922-145335944 TGTTTGCTTGCTTTAGAGACTGG + Intergenic
939984251 2:148814420-148814442 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
940098456 2:150005864-150005886 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
940151822 2:150610846-150610868 CGCCTGGATGGTTGTGAGACTGG - Intergenic
940653556 2:156461392-156461414 TGTTTGTTTGTTTTTGAGACAGG + Intronic
941899444 2:170664129-170664151 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
941918149 2:170825387-170825409 TGTTTGTTTGTTTTTGAGACAGG - Intronic
941982308 2:171472183-171472205 TGTTTGTTTTGTTTTGAGACAGG + Intronic
942076874 2:172364263-172364285 TGCTTGTTTGTTTTTGAGATAGG - Intergenic
942223811 2:173797380-173797402 TGCTTGCCTGGATTTGTGACTGG - Intergenic
942318566 2:174716373-174716395 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
942570329 2:177307651-177307673 TGTTTGTTTGTTTTTGAGACAGG - Intronic
942582951 2:177440675-177440697 TGATTGCTTGGTTTTGAAATTGG + Intronic
942735654 2:179109181-179109203 TGGTTGCATGTATTTTAGACAGG - Exonic
943157343 2:184199522-184199544 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
943281344 2:185937704-185937726 TGCTTGTGTGTGTTTGAGACAGG + Intergenic
943418071 2:187633773-187633795 TTCTTATATGGTTTGGAGACAGG - Intergenic
943492620 2:188574641-188574663 TGTTTGTTTGTTTTTGAGACAGG - Intronic
943751217 2:191511453-191511475 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
944088308 2:195874813-195874835 TGTTTGTTTGTTTTTGAGACAGG - Intronic
944144110 2:196487306-196487328 TGCTTGTTTGTTTTTGAGACAGG - Intronic
944171152 2:196779730-196779752 TGTTTGTTTGTTTTTGAGACAGG + Intronic
944512716 2:200480386-200480408 GGAGTGCATGTTTTTGAGACAGG + Exonic
944555441 2:200883766-200883788 TTCTTGTTTCGTTTTGAGACAGG + Intronic
944568118 2:201012452-201012474 TGTTTGTTTGTTTTTGAGACAGG - Intronic
944580874 2:201131706-201131728 TGTTTGTTTGTTTTTGAGACAGG + Intronic
944644103 2:201761293-201761315 TGGTTGCATCGTTCTGGGACTGG + Exonic
944786532 2:203076469-203076491 TGTTTGTTTGTTTTTGAGACAGG - Intronic
944790867 2:203124324-203124346 TTCTTGTTTGTTTTTGAGACAGG - Intronic
944813233 2:203348935-203348957 TGTTTGTTTGTTTTTGAGACAGG + Intronic
944814134 2:203358120-203358142 TGTTTGTTTGTTTTTGAGACAGG + Intronic
945298276 2:208192402-208192424 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
945875829 2:215277586-215277608 TGTTTGTTTGCTTTTGAGACAGG + Intergenic
946286117 2:218704276-218704298 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
946593240 2:221274841-221274863 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
947478782 2:230477927-230477949 TGTTTGTTTTGTTTTGAGACAGG - Intronic
947886268 2:233574421-233574443 TGTATGTATGTTTTTGAGACAGG + Intergenic
1168783371 20:514336-514358 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1169121517 20:3099321-3099343 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1169740634 20:8889860-8889882 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1169749527 20:8977398-8977420 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1170044851 20:12073976-12073998 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1171350298 20:24497206-24497228 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1171720595 20:28559200-28559222 TGTTTGTTTGTTTTTGAGACGGG + Intergenic
1171784906 20:29454664-29454686 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1171972743 20:31574368-31574390 TGCTTGTTGGTTTTTGAGACAGG + Intronic
1172071268 20:32259057-32259079 TGATTGATTGATTTTGAGACAGG - Intergenic
1172353420 20:34261626-34261648 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1172382246 20:34505047-34505069 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1172466358 20:35157991-35158013 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1172715876 20:36963165-36963187 AGATTGGGTGGTTTTGAGACGGG - Intergenic
1173269488 20:41519275-41519297 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1173550395 20:43929150-43929172 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1173769271 20:45644345-45644367 GGCTTGCTTGTTTTTGAGACAGG + Intergenic
1174001659 20:47379289-47379311 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1174105952 20:48162234-48162256 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1174465198 20:50711953-50711975 TGATTGATTGATTTTGAGACAGG + Intergenic
1174603582 20:51744169-51744191 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1174698396 20:52583280-52583302 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1174984345 20:55433043-55433065 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1175087597 20:56473123-56473145 TGTTTGTTTGTTTTTGAGACGGG - Intronic
1175363920 20:58437893-58437915 CTCTTGCATGGTTTTGGGAAGGG + Intronic
1176046518 20:63095780-63095802 TGCTTGCTTGCTTTTGAGCCTGG + Intergenic
1177797564 21:25794519-25794541 TGCTTGTTTGGTTTTGAGAAAGG - Intergenic
1178277792 21:31254696-31254718 TGTTTGTTTTGTTTTGAGACAGG - Intronic
1178299622 21:31441434-31441456 TGCTTGCAGGTTTGTGAGAGGGG - Intronic
1178335185 21:31736439-31736461 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1178557683 21:33607624-33607646 TGCTTGTTTATTTTTGAGACAGG - Intronic
1178669391 21:34577591-34577613 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1178852005 21:36220514-36220536 TGTTTGTTTGGTTTTGAGACAGG + Intronic
1178862894 21:36304198-36304220 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1179252371 21:39682695-39682717 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1179283898 21:39959659-39959681 TGTTTGTTTGTTTTTGAGACCGG + Intergenic
1179331475 21:40406594-40406616 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1179638115 21:42727331-42727353 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1179825695 21:43964932-43964954 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1179963840 21:44788703-44788725 TTGTTGCTTAGTTTTGAGACAGG + Intronic
1180053815 21:45346589-45346611 TGTTGGCTTGTTTTTGAGACAGG + Intergenic
1181153608 22:20902877-20902899 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1181361145 22:22337160-22337182 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1181564332 22:23725364-23725386 TGTTTGCTTGTTTTAGAGACAGG + Intergenic
1181870192 22:25891996-25892018 TGCTTTTATTTTTTTGAGACAGG - Intronic
1181941471 22:26480910-26480932 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1182261810 22:29078250-29078272 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1182442172 22:30371004-30371026 TGCATGGATGTTTGTGAGACAGG + Intronic
1182700562 22:32234013-32234035 TGCTTGCATGGGGCTGAGAAGGG + Intronic
1182721469 22:32404682-32404704 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1183207782 22:36431542-36431564 TGTTTGTTTGTTTTTGAGACGGG + Intergenic
1183439337 22:37814563-37814585 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1183684888 22:39356070-39356092 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1183785240 22:40025409-40025431 TGCTTTTATTTTTTTGAGACAGG - Intronic
1183916504 22:41124941-41124963 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1183917524 22:41134323-41134345 TGCATGTGTGTTTTTGAGACTGG + Intronic
1184581804 22:45422985-45423007 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1185260998 22:49863189-49863211 TGGTTGGTTGGTTTTGAGGCAGG + Intronic
949783476 3:7715458-7715480 TGCTTTATTTGTTTTGAGACAGG - Intronic
950736788 3:15015805-15015827 TGCTTGTTTGTTTTTGAGATGGG + Intronic
951720837 3:25696142-25696164 TGTTTGTTTTGTTTTGAGACAGG + Intergenic
952300166 3:32097781-32097803 TGTTTGCTTTTTTTTGAGACAGG - Intergenic
952353879 3:32566916-32566938 TTCTTGAAAGGTTTTGAGAATGG - Intronic
952797254 3:37251688-37251710 TGTATGTATGTTTTTGAGACAGG + Intronic
952893634 3:38061671-38061693 TGTTTGTTTGTTTTTGAGACCGG + Intronic
953887254 3:46722074-46722096 TTCTAGGATGGTTTTGAGAAAGG + Intronic
953940335 3:47089439-47089461 TCCTTGCCTTTTTTTGAGACAGG - Intronic
954318583 3:49815212-49815234 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
955155261 3:56410657-56410679 TGTTTGTTTGGTTTTGAGATAGG + Intronic
955174101 3:56595918-56595940 TGTTTGCTTGTTTTTGAGACAGG + Intronic
955637986 3:61051274-61051296 TGTTTGTTTGTTTTTGAGACAGG + Intronic
956039521 3:65131533-65131555 TTCTTTCTTTGTTTTGAGACAGG - Intergenic
956078231 3:65529038-65529060 TGGTTGGTTGGTTTTGAAACAGG - Intronic
956081002 3:65555845-65555867 TGTTTGTTTTGTTTTGAGACAGG - Intronic
956178330 3:66495294-66495316 TGATGGCATTGTCTTGAGACAGG - Intronic
956481943 3:69681885-69681907 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
956616114 3:71174413-71174435 TGTTTGTTTGTTTTTGAGACAGG - Intronic
957064741 3:75512485-75512507 TGCTTGTTTGTTTTTGAGACAGG + Intergenic
957186692 3:76950730-76950752 TGTTTGTTTGTTTTTGAGACAGG + Intronic
957561153 3:81822872-81822894 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
958416564 3:93881314-93881336 TGTTTGTTTGTTTTTGAGACAGG - Intronic
959077544 3:101764775-101764797 TGTTTGTTTGTTTTTGAGACAGG - Intronic
960287745 3:115848416-115848438 TGTTTGTTTGTTTTTGAGACAGG - Intronic
960323328 3:116264605-116264627 TGTTTGTTTGTTTTTGAGACAGG + Intronic
960440340 3:117679075-117679097 TACTTCCATGGTTTTCACACAGG + Intergenic
960810005 3:121618999-121619021 TGTTTGTTTGTTTTTGAGACAGG + Intronic
961096279 3:124159274-124159296 TGTTTGTTTGTTTTTGAGACAGG + Intronic
961439270 3:126943097-126943119 GGCTGGCATGGTTGAGAGACTGG - Intronic
961689945 3:128662054-128662076 TGTTTGTTTGTTTTTGAGACAGG - Intronic
961721162 3:128897192-128897214 TGTTTGTTTGTTTTTGAGACAGG + Intronic
961818301 3:129562502-129562524 TGTTTGTTTGTTTTTGAGACGGG - Intronic
961849186 3:129797735-129797757 TGTTTGTTTTGTTTTGAGACAGG - Intronic
961893588 3:130149813-130149835 GGCTTGTCTGGTTTTAAGACAGG + Intergenic
962133853 3:132711567-132711589 TGTTTGTTTGTTTTTGAGACAGG + Intronic
962247554 3:133808995-133809017 TGTTTGTTTGTTTTTGAGACAGG + Intronic
962522299 3:136208722-136208744 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
962575967 3:136755348-136755370 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
962789666 3:138799681-138799703 TGTTTGTCTGTTTTTGAGACAGG + Intronic
963029312 3:140951837-140951859 TGTTGTCATTGTTTTGAGACAGG + Intronic
963173145 3:142271372-142271394 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
963663493 3:148154748-148154770 GGCTTGCCTGGTTTTAGGACAGG - Intergenic
963836072 3:150059140-150059162 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
964616140 3:158667780-158667802 TGTTTGCCTGTTTTTGAGACAGG - Intronic
965408562 3:168301508-168301530 TGCATGTTTGTTTTTGAGACAGG - Intergenic
965429449 3:168568459-168568481 TGGTTGGTTGGTTTTGAGACAGG + Intergenic
965477945 3:169180920-169180942 TGCTTGCCTTTTTTTAAGACTGG - Intronic
965576708 3:170224527-170224549 TGTTTGTTTGTTTTTGAGACAGG + Intronic
965830220 3:172777891-172777913 TAGTTGCATAGTTTTGAGACAGG - Intronic
966230201 3:177643026-177643048 TGGCTGAATGGTTTTGAAACAGG + Intergenic
968176799 3:196557530-196557552 TGTTTGTTTGTTTTTGAGACAGG - Intronic
968281143 3:197477663-197477685 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
968282514 3:197487739-197487761 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
969009434 4:4049630-4049652 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
969139775 4:5058571-5058593 TGTTTGTTTGTTTTTGAGACAGG + Intronic
969830018 4:9788194-9788216 TGTTTGTTTGTTTTTGAGACAGG + Intronic
970331025 4:14983954-14983976 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
970667336 4:18353203-18353225 TTCTTGGATGGTGTTGACACTGG + Intergenic
971180701 4:24326306-24326328 GGCTTGTCTGGTTTTAAGACAGG - Intergenic
971215284 4:24656927-24656949 TGTTTGTTTTGTTTTGAGACAGG + Intergenic
971836012 4:31763336-31763358 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
971921357 4:32943530-32943552 TGTTTGTTTTGTTTTGAGACAGG - Intergenic
972117271 4:35652166-35652188 TGATTGTTTGTTTTTGAGACAGG + Intergenic
973772805 4:54222225-54222247 TGTTTGTTTGATTTTGAGACAGG + Intronic
973818562 4:54641647-54641669 TCATTGAATGTTTTTGAGACAGG + Intergenic
975114286 4:70661771-70661793 TGTTTGCTTGTTTTTGAGACAGG - Intronic
975135297 4:70868667-70868689 TGTTTGTTTTGTTTTGAGACAGG - Intergenic
975302473 4:72806862-72806884 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
975366519 4:73535631-73535653 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
975481715 4:74888124-74888146 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
975805017 4:78103133-78103155 TCCTTTCATGGTGTTGAGGCTGG - Intronic
976471114 4:85430270-85430292 TGGTTGTTTGTTTTTGAGACAGG + Intergenic
976605732 4:86981016-86981038 TGTTTGTTTTGTTTTGAGACGGG + Intronic
976711280 4:88074144-88074166 TGTTTGTTTGTTTTTGAGACTGG + Intronic
976786603 4:88828140-88828162 TGTTTGTTTGTTTTTGAGACAGG + Intronic
977181299 4:93878396-93878418 TGTTTGTTTTGTTTTGAGACAGG - Intergenic
977187870 4:93962769-93962791 TGTTTGTTTTGTTTTGAGACAGG - Intergenic
977214324 4:94261616-94261638 TGTTTGTTTGTTTTTGAGACGGG + Intronic
977543266 4:98344828-98344850 TGTTTGTTTGTTTTTGAGACAGG + Intronic
977926150 4:102703134-102703156 TGTTTGTTTGTTTTTGAGACAGG + Intronic
978507147 4:109471146-109471168 TCATTTTATGGTTTTGAGACAGG + Intronic
979054475 4:115978271-115978293 GGCTTGCCTGGTTTTAGGACAGG + Intergenic
979461845 4:120992820-120992842 TGTTTGTTTTGTTTTGAGACAGG + Intergenic
979556070 4:122048964-122048986 TGTTTGTTTTGTTTTGAGACAGG + Intergenic
979634043 4:122937138-122937160 TGTTTGTTTGTTTTTGAGACGGG - Intronic
980251364 4:130319958-130319980 TGTTTGTTTGTTTTTGAGACGGG + Intergenic
980389069 4:132121293-132121315 GGCTTGCCTGGTTTTAGGACAGG - Intergenic
980435380 4:132764996-132765018 TGCATGTTTGTTTTTGAGACAGG - Intergenic
980979771 4:139644459-139644481 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
980989627 4:139728207-139728229 TGTTTGTTTTGTTTTGAGACAGG - Intronic
981035236 4:140162193-140162215 TGGTTGGTTGGTTTTGATACAGG + Intergenic
981576584 4:146212513-146212535 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
981808590 4:148746610-148746632 TTCTTGCATTGTTTTGTGATGGG + Intergenic
981828285 4:148970500-148970522 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
981976581 4:150737210-150737232 TGGTTGGTTGGTTTTGAGAGAGG - Intronic
982020322 4:151196421-151196443 TGTTTGTTTGTTTTTGAGACAGG - Intronic
982490959 4:156028930-156028952 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
982563844 4:156964588-156964610 GGATTGCATGGTTTTCAGATTGG - Intronic
982671914 4:158331416-158331438 TGTTTGTTTGTTTTTGAGACGGG + Intronic
983364821 4:166772795-166772817 TGTTTGTTTGCTTTTGAGACAGG + Intronic
983536429 4:168862170-168862192 TGTTTGCTTTGTTTTGAGACAGG + Intronic
983605726 4:169581271-169581293 TGGGTGTATGTTTTTGAGACAGG + Intronic
984393469 4:179167507-179167529 GGCTTGTCTGGTTTTAAGACAGG + Intergenic
984920203 4:184757312-184757334 GGCTTACGTGCTTTTGAGACTGG - Intronic
986354353 5:6909202-6909224 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
986389025 5:7266681-7266703 GGCTTGTCTGGTTTTAAGACAGG - Intergenic
987145508 5:14987735-14987757 TGTTTGTTTGTTTTTGAGACGGG - Intergenic
987783231 5:22465638-22465660 TGTTTGTTTGTTTTTGAGACAGG - Intronic
988594830 5:32581904-32581926 TGTTTGTTTGTTTTTGAGACAGG + Intronic
988784578 5:34554361-34554383 TGTTTGTTTGTTTTTGAGACGGG - Intergenic
989169293 5:38459040-38459062 TGTTTGTTTTGTTTTGAGACAGG + Intronic
989685230 5:44077891-44077913 TGCTTGCTTGGGTATGAGAATGG - Intergenic
990270306 5:54130210-54130232 TGTTTGTTTTGTTTTGAGACAGG - Intronic
990353315 5:54940332-54940354 TGATTGATTGATTTTGAGACAGG + Intergenic
990417222 5:55598011-55598033 TGCCTGCCTGGTTTTTAGCCTGG + Intergenic
990418548 5:55609857-55609879 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
990575958 5:57123733-57123755 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
991405512 5:66297548-66297570 TGCTCACATGGTGATGAGACTGG + Intergenic
991673387 5:69069574-69069596 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
991725549 5:69532238-69532260 TGTTTGTATGTATTTGAGACAGG + Intronic
991772876 5:70056298-70056320 TTCTTTGATGGTTTTGAGAGAGG + Intronic
991852169 5:70931722-70931744 TTCTTTGATGGTTTTGAGAGAGG + Intronic
992423908 5:76635821-76635843 TTCTTTCTTGCTTTTGAGACAGG - Intronic
992449826 5:76866088-76866110 TGTTTGCTTGTTTTTGAGACAGG + Intronic
992453049 5:76890640-76890662 TGTTTGTTTGTTTTTGAGACCGG - Intronic
992637373 5:78737707-78737729 TTCTTGTTTGTTTTTGAGACAGG - Intronic
992698329 5:79313411-79313433 TGTTTGTTTGTTTTTGAGACAGG - Intronic
993711060 5:91225951-91225973 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
994006667 5:94845548-94845570 TGTTTGTTTGTTTTTGAGACAGG + Intronic
994260891 5:97657192-97657214 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
994438954 5:99777140-99777162 TTTTTGCTTTGTTTTGAGACAGG + Intergenic
996329790 5:122315766-122315788 TGTTGGGATGGTTTGGAGACAGG + Intronic
996431108 5:123378583-123378605 TGCTTTTATGAATTTGAGACTGG + Intronic
996711184 5:126545278-126545300 TGTTTGTTTTGTTTTGAGACAGG + Intronic
996726680 5:126678744-126678766 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
996979359 5:129471358-129471380 TTCTTTCATTCTTTTGAGACAGG - Intronic
997270470 5:132532463-132532485 TGTTTGTTTGCTTTTGAGACAGG + Intergenic
997333582 5:133086207-133086229 TGTTTGTTTGTTTTTGAGACAGG - Intronic
997900486 5:137759379-137759401 TGTTTGCTTGTTTTTGAGACAGG + Intergenic
998109390 5:139489376-139489398 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
998457714 5:142286669-142286691 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
998894552 5:146785540-146785562 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1000061979 5:157666158-157666180 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1001182221 5:169531109-169531131 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1001520289 5:172386634-172386656 TGTTTGCTTGTTTTTGAGACAGG + Intronic
1001659306 5:173378840-173378862 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1001953888 5:175834866-175834888 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1002280631 5:178128067-178128089 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1002619262 5:180475345-180475367 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1002645360 5:180650001-180650023 TGCTTGTTTATTTTTGAGACTGG - Intergenic
1002700375 5:181119984-181120006 TGTTTGTCTGTTTTTGAGACAGG + Intergenic
1003009067 6:2409522-2409544 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1003069869 6:2937675-2937697 TGCTTACATGGTAGTGAAACTGG + Intergenic
1003292195 6:4789079-4789101 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1003815492 6:9835801-9835823 TGTTTGCTTGGTTCTGACACAGG + Intronic
1004341249 6:14809651-14809673 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1004371644 6:15057719-15057741 TATTTGCTTGTTTTTGAGACTGG - Intergenic
1004546847 6:16606140-16606162 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1004575366 6:16889044-16889066 GGCTTGTCTGGTTTTAAGACAGG - Intergenic
1005214834 6:23513146-23513168 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1005264451 6:24096749-24096771 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1005304657 6:24501778-24501800 TGATTGTTTGTTTTTGAGACAGG - Intronic
1005501324 6:26431353-26431375 TGTTTCCATGGCTGTGAGACTGG - Intergenic
1005659155 6:27976772-27976794 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1005918895 6:30381019-30381041 TGATTGCATGATTTTAAGAGAGG + Intergenic
1006057394 6:31395645-31395667 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1006069816 6:31490299-31490321 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1007523222 6:42467524-42467546 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1007572702 6:42904675-42904697 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1008025896 6:46635555-46635577 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1008705604 6:54154972-54154994 TGCTGGAATGGGTTTGAAACTGG + Intronic
1008722620 6:54375131-54375153 TTCTTAGATGGTTGTGAGACTGG + Intronic
1008929423 6:56922691-56922713 TGCATGAATGGTTCTAAGACTGG + Intronic
1009658284 6:66573836-66573858 TGCTTGTTTGTTTTTGAGACAGG - Intergenic
1010392927 6:75357401-75357423 TTCTTGTAGGCTTTTGAGACTGG + Intronic
1010407706 6:75523392-75523414 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1010410180 6:75552563-75552585 TGGTTTTTTGGTTTTGAGACCGG + Intergenic
1010586546 6:77663168-77663190 GGCTTGCCTGGTTTTAGGACAGG + Intergenic
1010662456 6:78586483-78586505 GGCTTGTCTGGTTTTAAGACAGG - Intergenic
1010776307 6:79890048-79890070 TGTTTGTTTTGTTTTGAGACAGG - Intergenic
1010819639 6:80397923-80397945 TACTTGCATGGTTTTCAGTAAGG - Intergenic
1010826717 6:80484739-80484761 GGCTTGTCTGGTTTTAAGACAGG + Intergenic
1011623656 6:89266066-89266088 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1011825566 6:91301858-91301880 TGCATGTATGTATTTGAGACAGG + Intergenic
1012071631 6:94626813-94626835 TGTTTGCTCGTTTTTGAGACAGG + Intergenic
1012271090 6:97212805-97212827 TGCTCGAATGGTTTTGACAATGG + Intronic
1012629350 6:101444088-101444110 TGTTTGTTTGTTTTTGAGACGGG + Intronic
1012908457 6:105093634-105093656 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1013039486 6:106419386-106419408 TGCTTGTTGGTTTTTGAGACAGG + Intergenic
1013189726 6:107791954-107791976 TGTTTGCCTGTTTTTGAGACGGG - Intronic
1013504728 6:110788164-110788186 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1013582190 6:111546323-111546345 TGTTTGTCTGTTTTTGAGACAGG - Intergenic
1013872532 6:114783445-114783467 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1014434528 6:121406517-121406539 TGTATGTATGTTTTTGAGACAGG - Intergenic
1014448674 6:121558561-121558583 TTTTTGCTTGTTTTTGAGACAGG + Intergenic
1014557656 6:122853477-122853499 TGCTTCCCTGGTTTTCAGACTGG + Intergenic
1014746182 6:125203586-125203608 TGTCTGCATGGTTTTGAGTTTGG + Intronic
1015150643 6:130032985-130033007 TTTTTGCATGTTTTTGAGACAGG - Intronic
1015375727 6:132508180-132508202 TGCTTGCATGGTTTTGAGACAGG - Intronic
1015396181 6:132737479-132737501 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1015786712 6:136926110-136926132 TGTTTGTTTGTTTTTGAGACGGG - Intergenic
1015923036 6:138284297-138284319 TGTTTGTTTGTTTTTGAGACGGG - Intronic
1016268087 6:142255676-142255698 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1017476423 6:154798803-154798825 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1017756614 6:157534592-157534614 TCATTTCATGTTTTTGAGACAGG + Intronic
1017809644 6:157975743-157975765 TGTTTGTTTTGTTTTGAGACAGG + Intergenic
1018386908 6:163312757-163312779 TGTTTGTTTGTTTTTGAGACAGG + Exonic
1019131194 6:169877238-169877260 TGTTTGGTTGGTTCTGAGACAGG - Intergenic
1019911648 7:4104063-4104085 TGCTTGTTTGTGTTTGAGACGGG + Intronic
1019995138 7:4719139-4719161 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1020029808 7:4924934-4924956 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1020069540 7:5217308-5217330 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1020176151 7:5883679-5883701 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG + Intronic
1020228378 7:6298036-6298058 TGTTTGTTTGGTATTGAGACAGG - Intergenic
1020289122 7:6709219-6709241 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1020436237 7:8165073-8165095 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1020723682 7:11781438-11781460 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1021114653 7:16733899-16733921 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1021154334 7:17191600-17191622 TGGTTTCAAGGTTTTGAGCCTGG - Intergenic
1021694013 7:23258889-23258911 AGGTTGCATGCTTTTGAGACCGG - Intronic
1021986710 7:26104659-26104681 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1022354805 7:29603716-29603738 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1022403532 7:30064540-30064562 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1022739272 7:33106171-33106193 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1023187593 7:37548304-37548326 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1023245729 7:38201692-38201714 TGTTTGTTTTGTTTTGAGACAGG + Intronic
1023440837 7:40183265-40183287 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1023912082 7:44563409-44563431 AGCTTGGATGGTTTTCAGGCTGG - Intergenic
1023989646 7:45120974-45120996 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1024941230 7:54765290-54765312 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1025699844 7:63807936-63807958 TGCTTGTTTGTTTTTGAGATGGG + Intergenic
1025729170 7:64094928-64094950 TGTTTGCTTGTTTTAGAGACAGG - Intronic
1025792165 7:64699424-64699446 TGTTGTCATTGTTTTGAGACAGG + Intronic
1025915137 7:65859795-65859817 TGTTTGTCTGTTTTTGAGACAGG + Intergenic
1025955496 7:66179545-66179567 TGTTTGTTTGTTTTTGAGACCGG - Intergenic
1025956201 7:66185105-66185127 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1026029067 7:66773669-66773691 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1026215986 7:68349337-68349359 TGTTTGTTTTGTTTTGAGACAGG - Intergenic
1026346170 7:69476013-69476035 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1026554141 7:71391484-71391506 TGATTGATTGATTTTGAGACAGG + Intronic
1026645687 7:72166207-72166229 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1026711525 7:72745028-72745050 TGTTTGTTTTGTTTTGAGACAGG + Intronic
1027056625 7:75053906-75053928 TGTTTGTTTGCTTTTGAGACAGG + Intronic
1027731776 7:81883652-81883674 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1028386448 7:90259401-90259423 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1029281847 7:99440354-99440376 TGTTTGTTTGCTTTTGAGACAGG + Intronic
1029521434 7:101065223-101065245 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1029522299 7:101070949-101070971 TGCTTGTTTGTTTTTGAGTCAGG + Intergenic
1029527163 7:101101930-101101952 TGTTTGTTTTGTTTTGAGACAGG - Intergenic
1029527317 7:101102924-101102946 TGGTTGTTTGTTTTTGAGACAGG - Intergenic
1030644651 7:112046651-112046673 TGTTGTCATTGTTTTGAGACAGG - Intronic
1030845376 7:114402597-114402619 TGCTTGCATGGTTTTTGCAGGGG - Intronic
1031311083 7:120197754-120197776 TGTTTGTCTGTTTTTGAGACAGG - Intergenic
1031572455 7:123376251-123376273 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1031933537 7:127712162-127712184 TGCTTGTTTGTTTTTGAGACAGG + Intronic
1032260166 7:130329279-130329301 TGCTTGTTTGTTTTTGAGACAGG - Intergenic
1032432519 7:131873336-131873358 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1032572241 7:133012756-133012778 TTCTTTCTTAGTTTTGAGACAGG - Intronic
1033017187 7:137683379-137683401 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1033057371 7:138070764-138070786 TGTTTGTTTGCTTTTGAGACAGG - Intronic
1033071115 7:138203117-138203139 TGTTTGTTTGGTTTTGAGACAGG - Intergenic
1033386435 7:140880950-140880972 TGCTTTTTTTGTTTTGAGACAGG - Intronic
1033464898 7:141581441-141581463 TGCTTGTCTGGTTTTTGGACAGG + Intronic
1033775503 7:144605726-144605748 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1034185681 7:149174818-149174840 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1034737781 7:153445150-153445172 TGCATGCGTGGCTCTGAGACGGG + Intergenic
1034954442 7:155325880-155325902 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1035199314 7:157250219-157250241 TTGTTGTATTGTTTTGAGACGGG + Intronic
1035204486 7:157286128-157286150 TGGTTGATTGGTTTTGAGATAGG - Intergenic
1036250717 8:7160305-7160327 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1036366772 8:8127151-8127173 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1036884109 8:12538510-12538532 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1036925252 8:12898693-12898715 TGCTTTGATTTTTTTGAGACAGG - Intergenic
1037259189 8:16988022-16988044 TGTTTGCATGGGTTTTAGCCAGG + Intergenic
1037502496 8:19499107-19499129 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1037728736 8:21505919-21505941 TGTTTGTCTTGTTTTGAGACAGG - Intergenic
1037938276 8:22929711-22929733 TCCATGCTTTGTTTTGAGACAGG + Intronic
1037941742 8:22956664-22956686 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1038109623 8:24481054-24481076 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1038285848 8:26205834-26205856 TGTTTGTTTTGTTTTGAGACAGG + Intergenic
1038540812 8:28388530-28388552 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1038635436 8:29282855-29282877 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1038819709 8:30941247-30941269 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1038827125 8:31016045-31016067 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1039336866 8:36601173-36601195 TGTTTGTTTGCTTTTGAGACAGG + Intergenic
1039559150 8:38498638-38498660 TGTTTTTTTGGTTTTGAGACAGG - Intergenic
1039697572 8:39929014-39929036 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1039744073 8:40408004-40408026 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1039779244 8:40767712-40767734 TGCTTGCATGTTTTCGACTCTGG + Exonic
1040421338 8:47242912-47242934 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1042094873 8:65203304-65203326 TGTTTGCTTGTTTTTGAGACAGG - Intergenic
1042277685 8:67023129-67023151 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1042374992 8:68040028-68040050 TGTTTGTTTTGTTTTGAGACAGG + Intronic
1042596329 8:70451978-70452000 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1043105538 8:76105237-76105259 TGCTTGCATGGTTTCTGGCCAGG + Intergenic
1043115779 8:76252175-76252197 TGCTTGCCTGGTGGTGAGAGTGG - Intergenic
1043263147 8:78227238-78227260 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1043384078 8:79731233-79731255 TTCTTGCATTGCTATGAGACTGG + Intergenic
1043816378 8:84807003-84807025 TGCTTTTATTTTTTTGAGACAGG - Intronic
1044519824 8:93186481-93186503 TTCTTTCTTGTTTTTGAGACAGG - Intergenic
1044672732 8:94699634-94699656 TGCTTTTTTTGTTTTGAGACAGG - Intronic
1044801351 8:95960211-95960233 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1045115092 8:98973270-98973292 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1045126995 8:99103333-99103355 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1046745154 8:117868455-117868477 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1048079162 8:131106121-131106143 GTCTTGCATGGTTCTGAGCCAGG + Intergenic
1048617660 8:136095510-136095532 TGCTTGGATGATTATGACACTGG - Intergenic
1048764094 8:137827439-137827461 GGCTTGTCTGGTTTTAAGACAGG + Intergenic
1049036116 8:140077564-140077586 TGCTTGCATGCATTTGAGCAGGG + Intronic
1049811835 8:144578836-144578858 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1049828038 8:144683009-144683031 TTTTTGCTTGTTTTTGAGACAGG - Intergenic
1050438713 9:5637062-5637084 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1050498223 9:6266728-6266750 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1050579360 9:7035015-7035037 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1051012563 9:12436281-12436303 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1051156112 9:14148126-14148148 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1052363527 9:27586095-27586117 TGTTTACAGGGTTCTGAGACTGG + Intergenic
1052782921 9:32799230-32799252 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1053171257 9:35886664-35886686 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1053214547 9:36259664-36259686 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1053249107 9:36559779-36559801 TGTTCGCTTGTTTTTGAGACAGG + Intergenic
1053562668 9:39211873-39211895 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1053681617 9:40489375-40489397 AGCTTTCTTGTTTTTGAGACAGG - Intergenic
1053828472 9:42049845-42049867 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1053931610 9:43117705-43117727 AGCTTTCTTGTTTTTGAGACAGG - Intergenic
1054134482 9:61407166-61407188 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1054282096 9:63135559-63135581 AGCTTTCTTGTTTTTGAGACAGG + Intergenic
1054294708 9:63324892-63324914 AGCTTTCTTGTTTTTGAGACAGG - Intergenic
1054392728 9:64629379-64629401 AGCTTTCTTGTTTTTGAGACAGG - Intergenic
1054427378 9:65134588-65134610 AGCTTTCTTGTTTTTGAGACAGG - Intergenic
1054502999 9:65886952-65886974 AGCTTTCTTGTTTTTGAGACAGG + Intronic
1054602089 9:67137609-67137631 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1054730933 9:68702337-68702359 TGTTTGCTTGCTTTTGAGACAGG - Intergenic
1055023314 9:71692893-71692915 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1055188945 9:73493897-73493919 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1055460474 9:76515510-76515532 TGCTTGTTTGTTTTTAAGACAGG + Intergenic
1055505896 9:76948934-76948956 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1055952672 9:81744756-81744778 TGTTTGCTTGTTTTTGAGACAGG + Intergenic
1055954976 9:81765011-81765033 TGTTTGCTTGTTTTTGAGACAGG - Intergenic
1056163377 9:83920212-83920234 TGTTTGTTTTGTTTTGAGACAGG - Intronic
1056308548 9:85316783-85316805 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1057637173 9:96780166-96780188 TGTTTGTTTGTTTTTGAGACCGG + Intergenic
1057787400 9:98097186-98097208 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1058186753 9:101864174-101864196 TGCTGCCATGGTTTGCAGACTGG + Intergenic
1058411551 9:104738739-104738761 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1058451970 9:105105530-105105552 TGCTTCCATGCTCTTGAGAAAGG - Intergenic
1058816605 9:108688812-108688834 TGCTTCTATGTTTTTGAGATTGG - Intergenic
1058965923 9:110038320-110038342 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1059105835 9:111510647-111510669 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1059178677 9:112191391-112191413 TTTTTGTTTGGTTTTGAGACAGG - Intergenic
1059501583 9:114758386-114758408 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1059667309 9:116460746-116460768 TGCTTGCAGGCTTGTGACACTGG + Intronic
1060498390 9:124134568-124134590 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1060582770 9:124766945-124766967 TGCTTGCATGTTTTGGAGCTTGG - Intronic
1060835770 9:126754258-126754280 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1061249465 9:129418047-129418069 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1061583213 9:131550166-131550188 GGCTTGCCTGGTTTTCGGACAGG - Intergenic
1061616541 9:131784020-131784042 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1061774358 9:132950841-132950863 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1061835180 9:133323929-133323951 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1061847998 9:133398856-133398878 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1062288058 9:135782196-135782218 TGCTTGGTTTTTTTTGAGACAGG - Intronic
1185758456 X:2671217-2671239 TGTTTGTATGGTTTTGAACCGGG - Intergenic
1186010054 X:5120063-5120085 TGGTTGGCTGGTTTTGAAACAGG - Intergenic
1186190531 X:7063647-7063669 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1186234636 X:7494219-7494241 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1186287972 X:8065882-8065904 TGCCTGCATGGAGTTGACACTGG - Intergenic
1186530798 X:10293351-10293373 TGGTTGCCTGGCTTTGGGACAGG + Intergenic
1187031674 X:15494113-15494135 TCATTGCCTGGTTTTGAGAAAGG + Intronic
1187162529 X:16777879-16777901 TGTTTTAATTGTTTTGAGACAGG + Intergenic
1187162531 X:16777927-16777949 TGTTTTAATTGTTTTGAGACAGG + Intergenic
1187239754 X:17501720-17501742 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1187240458 X:17508476-17508498 TGTTTGTTTGTTTTTGAGACTGG + Intronic
1187403438 X:18982826-18982848 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1187430472 X:19219463-19219485 TGTTTGTTTTGTTTTGAGACAGG - Intergenic
1188069125 X:25697140-25697162 TGTTTACATGGTTTTAAGATGGG + Intergenic
1188184601 X:27098356-27098378 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1188186762 X:27125900-27125922 TTCTTGTTTTGTTTTGAGACAGG + Intergenic
1188702148 X:33278095-33278117 TGCTTGTTTGTTTTTGAGACAGG - Intronic
1189340010 X:40197813-40197835 TGTTTGTTTGCTTTTGAGACGGG + Intergenic
1189362483 X:40363465-40363487 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1190249234 X:48709513-48709535 TAATTGCATTGTTTTGAGACAGG - Intergenic
1190321641 X:49183482-49183504 TGATTGATTGTTTTTGAGACAGG - Intronic
1190424752 X:50324032-50324054 TGTTTGTTTTGTTTTGAGACAGG + Intronic
1190474128 X:50811299-50811321 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1190854652 X:54282043-54282065 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1191996815 X:67104663-67104685 TGTTTGCAGGGATTTGGGACTGG + Intergenic
1192148625 X:68698206-68698228 AGCTTGGATGGTATTGAGAAGGG + Intronic
1192623567 X:72704599-72704621 TGTTTACTTGTTTTTGAGACTGG + Intronic
1193039237 X:76987373-76987395 TGGTGGCATGGTTTTGCGAGTGG - Intergenic
1193598538 X:83478931-83478953 TGCTTGCTTGTTTTTGAGACAGG - Intergenic
1194092075 X:89590450-89590472 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1194102316 X:89721067-89721089 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1194613788 X:96076249-96076271 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1195382064 X:104280384-104280406 TGCTTGCTTGTTTTGTAGACAGG - Intergenic
1195483570 X:105375502-105375524 TGTTTGTTTGTTTTTGAGACAGG - Intronic
1195594014 X:106667320-106667342 TGTTTGTTTGTTTTTGAGACAGG + Intronic
1196015855 X:110939235-110939257 TGCTTTCATGGGTTTGAGTCTGG - Intergenic
1196023290 X:111012784-111012806 TATTTGCATTTTTTTGAGACAGG + Intronic
1196082287 X:111646025-111646047 TGTTTGTTTTGTTTTGAGACAGG + Intergenic
1196387315 X:115172288-115172310 TGCTAGCATGGGTTAGAGCCAGG - Intronic
1197244277 X:124152198-124152220 TCCTTTTATGTTTTTGAGACAGG + Intronic
1197787886 X:130218155-130218177 TGTTTGTTTGTTTTTGAGACGGG - Intronic
1198446692 X:136724494-136724516 TGTTTGATTGTTTTTGAGACAGG + Intronic
1198649381 X:138844785-138844807 TGCTTTCATGGTTTTAATACTGG + Intronic
1198923268 X:141755514-141755536 TGTTTGTTTGTTTTTGAGACTGG + Intergenic
1199108868 X:143906811-143906833 TGTTTGCTTGTTTTTGAGACAGG + Intergenic
1199768792 X:150960238-150960260 TGTTTGTTTGTTTTTGAGACAGG - Intergenic
1200322849 X:155207599-155207621 TGCTGGCATGGGGCTGAGACAGG + Intronic
1200444705 Y:3246486-3246508 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1200454905 Y:3378345-3378367 TGTTTGTTTGTTTTTGAGACAGG + Intergenic
1200703467 Y:6421815-6421837 TGCTTGCTTGTTCATGAGACAGG + Intergenic
1201030644 Y:9742892-9742914 TGCTTGCTTGTTCATGAGACAGG - Intergenic