ID: 1015381939

View in Genome Browser
Species Human (GRCh38)
Location 6:132579786-132579808
Sequence CCATGCTGCTTGAAATGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015381939_1015381946 8 Left 1015381939 6:132579786-132579808 CCTACACATTTCAAGCAGCATGG No data
Right 1015381946 6:132579817-132579839 AGTGTTGGTAAGAGGCAGACTGG No data
1015381939_1015381943 0 Left 1015381939 6:132579786-132579808 CCTACACATTTCAAGCAGCATGG No data
Right 1015381943 6:132579809-132579831 CCCCGAGCAGTGTTGGTAAGAGG No data
1015381939_1015381947 9 Left 1015381939 6:132579786-132579808 CCTACACATTTCAAGCAGCATGG No data
Right 1015381947 6:132579818-132579840 GTGTTGGTAAGAGGCAGACTGGG No data
1015381939_1015381941 -7 Left 1015381939 6:132579786-132579808 CCTACACATTTCAAGCAGCATGG No data
Right 1015381941 6:132579802-132579824 AGCATGGCCCCGAGCAGTGTTGG No data
1015381939_1015381948 15 Left 1015381939 6:132579786-132579808 CCTACACATTTCAAGCAGCATGG No data
Right 1015381948 6:132579824-132579846 GTAAGAGGCAGACTGGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015381939 Original CRISPR CCATGCTGCTTGAAATGTGT AGG (reversed) Intergenic
No off target data available for this crispr