ID: 1015381941

View in Genome Browser
Species Human (GRCh38)
Location 6:132579802-132579824
Sequence AGCATGGCCCCGAGCAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015381937_1015381941 30 Left 1015381937 6:132579749-132579771 CCTCTAAGCTATTTTCCAGCTTG No data
Right 1015381941 6:132579802-132579824 AGCATGGCCCCGAGCAGTGTTGG No data
1015381938_1015381941 15 Left 1015381938 6:132579764-132579786 CCAGCTTGCACTCTTTCTGAAGC No data
Right 1015381941 6:132579802-132579824 AGCATGGCCCCGAGCAGTGTTGG No data
1015381939_1015381941 -7 Left 1015381939 6:132579786-132579808 CCTACACATTTCAAGCAGCATGG No data
Right 1015381941 6:132579802-132579824 AGCATGGCCCCGAGCAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015381941 Original CRISPR AGCATGGCCCCGAGCAGTGT TGG Intergenic
No off target data available for this crispr