ID: 1015381943

View in Genome Browser
Species Human (GRCh38)
Location 6:132579809-132579831
Sequence CCCCGAGCAGTGTTGGTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015381938_1015381943 22 Left 1015381938 6:132579764-132579786 CCAGCTTGCACTCTTTCTGAAGC No data
Right 1015381943 6:132579809-132579831 CCCCGAGCAGTGTTGGTAAGAGG No data
1015381939_1015381943 0 Left 1015381939 6:132579786-132579808 CCTACACATTTCAAGCAGCATGG No data
Right 1015381943 6:132579809-132579831 CCCCGAGCAGTGTTGGTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015381943 Original CRISPR CCCCGAGCAGTGTTGGTAAG AGG Intergenic
No off target data available for this crispr