ID: 1015381947

View in Genome Browser
Species Human (GRCh38)
Location 6:132579818-132579840
Sequence GTGTTGGTAAGAGGCAGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015381939_1015381947 9 Left 1015381939 6:132579786-132579808 CCTACACATTTCAAGCAGCATGG No data
Right 1015381947 6:132579818-132579840 GTGTTGGTAAGAGGCAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015381947 Original CRISPR GTGTTGGTAAGAGGCAGACT GGG Intergenic
No off target data available for this crispr